Acoustic phase-transition nanodroplets for delivering bio-orthogonal PDL1 degraders and methods of making and using same
By delivering bioorthogonal PDL1 degrading agents via acoustic phase change nanodroplets, the permeability and metabolism issues of PD1/PDL1 monoclonal antibodies in tumor therapy were resolved, achieving highly efficient tumor treatment and immune activation.
Patent Information
- Application Number
- CN202411505993.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-28
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2044-10-28
AI Technical Summary
Existing PD1/PDL1 monoclonal antibodies face challenges in cancer treatment, including immune-related adverse reactions, poor tumor tissue penetration, insufficient drug metabolism characteristics, and high production costs, making it difficult to effectively block the PD1/PDL1 pathway.
We developed acoustic phase-change nanodroplets for delivering bioorthogonal PDL1 degraders. Guided by ultrasound targeting, the nanodroplets utilize perfluorohexane as the internal core and a cell membrane shell expressing RGD and the bioorthogonal PD1 mutant mPD1 to promote drug accumulation and phase change in the tumor vascular system, thereby achieving covalent binding and lysosomal degradation of PDL1.
It achieves better accumulation in tumor blood vessels, improves drug delivery efficiency, enhances intratumoral drug diffusion, improves PDL1 degradation efficiency, activates immunosuppression to suppress tumor growth, and overcomes resistance to immune checkpoint blockers.
Smart Images

Figure CN119367318B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a sound phase change nanodroplet for delivering a biological ortho type PDL1 degrading agent and a preparation method and application thereof. BACKGROUND
[0002] Immunotherapy targeting the programmed death 1 (PD1) / programmed death ligand 1 (PDL1) pathway has revolutionized the mode of cancer treatment, showing significant clinical treatment advantages and broad prospects. Although a variety of PD1 / PDL1 monoclonal antibody inhibitors have been approved for the treatment of various tumors, they face challenges such as immune-related adverse reactions, poor tumor tissue permeability, insufficient drug metabolism characteristics, and high production costs, all of which limit their more extensive clinical application. PDL1 degradation has advantages in terms of functional blocking efficiency, and it will serve as an alternative to antibodies.
[0003] Vascular dysfunction in tumors, characterized by vascular leakage, fenestration, tortuosity, and dilation, significantly hinders drug delivery and undermines therapeutic efficacy. Due to the functional heterogeneity of microvessels within tumors, only a small fraction of injected drugs reaches solid tumors. Developing a highly efficient drug delivery system with enhanced tumor accumulation is also crucial for achieving the desired therapeutic effect. Promoting drug extravasation from the tumor vasculature wall and facilitating drug diffusion to poorly perfused areas within solid tumors is crucial for improving targeted therapeutic efficacy. Therefore, there is an urgent need to develop a novel degrading agent targeting PDL1 protein to block the PD1 / PDL1 pathway. SUMMARY
[0004] The present application provides a sound phase change nanodroplet for delivering a biological ortho type PDL1 degrading agent and a preparation method and application thereof, which can be used for delivering a biological ortho type PDL1 degrading agent through ultrasonic targeted guidance, and has better tumor treatment effect.
[0005] The first object of the present application is to provide a sound phase change nanodroplet for delivering a biological ortho type PDL1 degrading agent, comprising an internal core and a shell layer.
[0006] The internal core comprises perfluorohexane; and the shell layer expresses or comprises RGD and a biological ortho PD1 mutant mPD1.
[0007] In one specific embodiment of the present application, the shell layer comprises a cell membrane that expresses the RGD and the biological ortho PD1 mutant mPD1.
[0008] In one specific embodiment of the present application, the source of the cell membrane comprises a eukaryotic cell.
[0009] The second object of the present application is to provide a preparation method of the above-mentioned acoustic phase change nanodroplet, comprising the following steps: (1) constructing eukaryotic cells expressing RGD and bio-orthogonal PD1 mutant mPD1, and collecting cell membranes after lysis;
[0010] (2) dissolving the collected cell membranes and mixing with perfluorohexane, ultrasonic treating the mixture solution, and extruding to obtain the acoustic phase change nanodroplet.
[0011] In one specific embodiment of the present application, the method for collecting the cell membranes in step (1) comprises resuspending the eukaryotic cells in a lysis buffer containing protease inhibitors, breaking the cells and removing the cell nucleus and mitochondria, and then centrifuging the supernatant to collect the cell membrane precipitate.
[0012] The centrifugal force of the centrifugation is 100,000g, and the centrifugation time is 60 minutes.
[0013] In one specific embodiment of the present application, the solvent used for dissolving in step (2) is a mixture of PBS and glycerol, and the volume ratio of PBS to glycerol is 9:1.
[0014] In one specific embodiment of the present application, the volume of perfluorohexane is 1 / 8 of the volume of the solvent.
[0015] In one specific embodiment of the present application, the ultrasonic treatment in step (2) is performed at a temperature of 4°C, a frequency of 20kHz, a power of 500W, and a time of 130 seconds.
[0016] The third object of the present application is to provide the use of the above-mentioned acoustic phase change nanodroplet or the acoustic phase change nanodroplet prepared by the above-mentioned preparation method in the preparation of a tumor treatment drug.
[0017] The last object of the present application is to provide a tumor treatment drug, wherein the above-mentioned acoustic phase change nanodroplet or the acoustic phase change nanodroplet prepared by the above-mentioned preparation method is used as an active ingredient, and pharmaceutically acceptable excipients are further included.
[0018] Beneficial effects: the present application provides an acoustic phase change nanodroplet NDs for delivering bio-orthogonal PDL1 degrading agent mTx , comprising an inner core and a shell layer; the inner core of the nanodroplet is perfluorohexane PFH (C6F 14 ), and the shell layer expresses or contains RGD and bio-orthogonal PD1 mutant mPD1, and can undergo liquid-gas phase change. RGD-guided NDs can promote drug enrichment in tumor vasculature, and can be seen by ultrasound. Subsequently, the nanodroplet rupture caused by inertial cavitation promotes the perfusion of mPD1 into the tumor and forms a covalent bond with PDL1, thereby initiating the lysosomal degradation process. As a very promising method, the NDsmTx PDL1 degradation agent can be effectively delivered and overcome the drug resistance of immune checkpoint blockers. Specifically, (1) NDs mTx With its relatively small volume advantage, it overcomes the limitation of tumor blood vessels and can better enrich in tumor blood vessels; (2) NDs mTx With good phase change advantage, it can be phase changed under LFUS induction for ultrasound imaging; (3) Under the induction of LFUS, NDs mTx The radiofrequency force generated by inertial cavitation can promote drug delivery to the tumor parenchyma and improve delivery efficiency; (4) The constructed biorthogonal mPD1 has a higher PDL1 degradation efficiency than the wild-type PD1 in combination with PDL1; (5) The synthesized NDs mTx In tumor-bearing mice, compared with NDs Tx , it has better activation of immune suppression and tumor growth effect. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 is the construction diagram of NDs RGD targeting tumor blood vessels, Figure A: extraction flowchart of cell membrane modified by RGD fusion protein, B: western blot analysis of HEK293T cells and cell membranes derived RGD fusion protein, C: synthesis diagram of NDs RGD targeting β3, D: in vitro experimental procedure diagram, HUVEC was incubated with DiO-labeled NDs, E: fluorescence staining analysis of NDs preferentially accumulated on the surface of HUVEC, NDs were labeled with DiO (green), HUVEC and HEK293T were labeled with CellTracker (red), and the nucleus was stained with Hoechst 33342 (blue), F: quantitative analysis of (E), G: schematic diagram of in vivo experiment, mice were injected with DiR-labeled NDs, H: ex vivo images of DiR-labeled NDs distribution in tumor tissues and major organs, I: statistical evaluation of fluorescence intensity of each organ of mice injected with ND sCtrl or NDs RGD ;
[0020] Figure 2 is the echo characteristic result diagram of NDs, Figure A: schematic diagram of in vitro experiment, NDs were subjected to LFUS irradiation and phase change; B: representative ultrasound images of NDs in vitro, NDs Ctrl and PBS as control group; C: quantitative result diagram of B; D: schematic diagram of in vivo experiment, NDs were injected into tumor-bearing mice, then subjected to LFUS irradiation for phase change; E: representative ultrasound images of tumor, NDs Ctrl and PBS as control group; F: quantitative result diagram of E;
[0021] Figure 3 Results of the penetration of NDs fragments into tumor for inertia cavitation-promoted nanodroplet penetration into tumor, Figure A: experimental scheme for evaluating penetration depth, 4T1 tumor-bearing mice were injected with DiI-labeled NDs, followed by control or LFUS irradiation, and tumors were collected for immunofluorescence staining; B: representative immunostaining images showing the distribution of NDs in tumor tissue, tumor vasculature was stained with anti-CD31 (green), NDs were stained with DiI (red), and nuclei were labeled with Hoechst (blue), NDs Ctrl Scale bar = 50 pm; C: quantification of DiI in B, n = 3, ***P < 0.001; P < 0.0001 by one-way ANOVA; D: 3D image analysis results of tumor penetration in mice using the indicated treatments; E: 3D imaging showing the distribution of red fluorescence signal; F: penetration quantification determined from the relative volume of red fluorescence signal;
[0022] Figure 4 Results of the effect of NDs on mice, Figure A: experimental scheme for mice treated with different doses of NDs; B: penetration efficiency reached a peak when NDs were injected at 3X10 7 de; C: experimental scheme for mice treated with different intensities of LFUS; D: penetration efficiency reached a peak when intensity reached 2.5 W / cm 2 ;
[0023] Figure 5 Results of mPD1 binding to PDL1 through proximity reaction covalent binding, Figure A: schematic diagram of PD1 plasmid, mPD1 plasmid, and bio-orthogonal PylRS / tRNA Pyl plasmid; B: schematic diagram of mPD1 expression on cell membrane; C: western analysis on treated HEK293T cell membrane, GAPDH was used as control; D: schematic diagram of covalent binding of mPD1 to PDL1; E: western blot confirming covalent binding between mPD1 and PDL1;
[0024] Figure 6 Results of NDs mPD1 fragments inducing PDL1 degradation in tumor cells, Figure A: schematic diagram of NDs mPD1 construction; B: western analysis of mPD1 fusion protein expression from cells and cell membranes; C: schematic diagram of experimental procedure, NDs mPD1 were destroyed by LPUS irradiation, and then the fragments were incubated with PDL1 -expressing cells; D: fragments of NDs mPD1 were theoretically endocytosed by 4T1-PDL1 cells; E: immunostaining showed that 4T1 cells and 4T1-PDL1 cells were not affected by NDs mPD1uptake of fragments, NDs Ctrl As a control, NDs were stained with Dil (red) and nuclei were labeled with Hoechst (blue); E: Western blot analysis of PDL1 expression in treated cells using GAPDH as a control; F-G: Flow cytometry for the evaluation of PDL1 expression in 4T1-PDL1 cells treated as described above, F is a representative flow cytometry image; H-I: NDs mPD1 lysosomal degradation of PDL1 by fragments, PDL1-GFP (green) overexpressing 4T1 cells were treated with PBS, NDs Ctrl or NDs mPD1 fragment treatment, otherwise treated with bafilomycin A Nuclei were labeled with Hoechst (blue) and lysosomes were stained with LysoTracker Deep Red (red);
[0025] Figure 7 for NDs mTx Inhibition of tumor progression in 4T1 mouse model Results graph, panel A: Schematic of the experiment, tumor-bearing mice were injected with NDs and LFUS irradiation was applied every hour for 3 times starting 30 min after injection, the above procedure was repeated every other day and tumors were collected on day 25; B: Tumor growth was monitored every 5 days in mice treated as indicated; C: Tumor weights at the end of the experiment; D: TUNEL staining of 4T1 tumor tissues showing cell death in each group; E: Statistical analysis of D;
[0026] Figure 8 for NDs mTx Activation of anti-tumor immunity by degradation of PDL1 Results graph, panel A: Schematic of the experiment, 4T1 tumor-bearing mice were injected with NDs via tail vein on day 7 after inoculation and then subjected to LFUS, mice were sacrificed on day 8 and tumors were collected for subsequent analysis; B: Western blot analysis of PDL1 expression in tumor samples from mice treated differently, GAPDH was used as a control; C: Representative immunohistochemistry images showing PDL1 expression (brown) in tumor tissues, scale bar = 50 pm; D: Flow cytometry analysis of CD8+ T cell infiltration in tumor tissues of mice receiving the indicated treatments; E: Statistical analysis of D; F: Immunostaining images showing CD3 (red) and CD8 (green) expression in tumor tissues of treated mice; G: Quantification of IFN-g levels in tumor tissues by ELISA assay; H: Representative immunohistochemistry images showing granzyme B expression in tumor tissues from mice receiving the indicated treatments;
[0027] Figure 9 for PDL1 overexpression Results graph, panel A: qPCR confirming PDL1 overexpression results graph; B: western confirming PDL1 overexpression results graph. DETAILED DESCRIPTION
[0028] The application provides a sound phase transition nanodroplet ND for delivering a biological ortho type PDL1 degrading agent mTx , comprising an internal core and a shell layer;
[0029] The internal core comprises perfluorohexane; the shell layer expresses or comprises RGD and a biological ortho PD1 mutant mPD1.
[0030] In one specific embodiment of the application, the shell layer can be a cell membrane that is engineered to express the RGD and the biological ortho PD1 mutant mPD1, and the source of the cell membrane comprises eukaryotic cells, such as HEK293T cells used in the examples. In one embodiment of the application, the internal core of the nanodroplet is perfluorohexane PFH (C6F 14 ), and the external layer is a cell membrane that is engineered to express RGD and mPD1. The NDs mTx have a spherical structure, a particle size of 580±20 nm, and a potential of 20±5 mV. In one embodiment, the RGD has the sequence shown in SEQ ID No. 1: TGTCGCGGTGATAAGGGTCCGGATTGT.
[0031] In the embodiments of the application, HEK293T cells overexpressing mPD1 and RGD are constructed, specifically comprising co-transfecting HEK293T cells with PylRS / tRNA Pyl , RGD-PTGFRN and mPD1-PTGFRN-flag three plasmids, so as to obtain HEK293T cells overexpressing mPD1 and RGD. The nucleotide sequence of the PylRS / tRNA Pyl plasmid is shown in SEQ ID No. 4; the construction method of the RGD-PTGFRN-flag plasmid comprises fusing and cloning RGD (SEQ ID No. 1) and PTGFRN (SEQ ID No. 2) fragments into a pcDNA3.1(-) vector, so as to construct the plasmid shown in SEQ ID No. 3; the construction method of the mPD1-PTGFRN-flag plasmid comprises cloning mPD1-PTGFRN into a pcDNA3.1(-) vector, mPD1 (SEQ ID No. 5) is a mutation of the codon CAG75 of PD1 (SEQ ID No. 6) to TAG, and the sequence of the constructed plasmid mPD1-PTGFRN-flag is shown in SEQ ID No. 7.
[0032] The shell layer can also be coupled with mPD1 and RGD on the cell membrane through other methods, such as chemically coupling the purified polypeptide on the surface of the nanodroplet, which can be produced in large quantities.
[0033] A second object of the present application is to provide a preparation method of the above-mentioned acoustic phase transition nanodroplet, comprising the following steps: (1) constructing eukaryotic cells that express RGD and biorthogonal PD1 mutant mPD1, and collecting cell membranes after lysis;
[0034] (2) dissolving the collected cell membranes and mixing with perfluorohexane, ultrasonic treating the mixture solution, and extruding to obtain the acoustic phase transition nanodroplet.
[0035] In one specific embodiment of the present application, the acoustic phase transition nanodroplet NDs is prepared by overexpressing mPD1 and RGD on the cell membrane as a shell layer mTx , first, eukaryotic cells that express RGD and biorthogonal PD1 mutant mPD1 are constructed, and cell membranes are collected after lysis, wherein the method for collecting cell membranes comprises resuspending the eukaryotic cells in a lysis buffer containing protease inhibitors, standing, breaking the cells and removing the cell nucleus and mitochondria, and then centrifuging the supernatant to collect the cell membrane precipitate; the centrifugal force of the centrifugation is 100,000g, and the centrifugation time is 60 minutes. In one embodiment of the present application, HEK293T cells overexpressing mPD1 and RGD are harvested in a centrifuge tube and resuspended in a hypotonic lysis buffer containing protease inhibitors (Roche, Switzerland), and placed on ice for more than 30 minutes. The suspension is homogenized 20 times by a Dounce homogenizer (Kimble 885300-0002, Mexico) to break the cells. Then the homogenized lysis buffer is centrifuged at 700g for 5 minutes to remove the cell nucleus and unbroken cells, and then centrifuged at 7000g for 15 minutes to separate the mitochondria. Finally, the remaining supernatant is centrifuged at 100,000g for 60 minutes to collect the cell membrane precipitate.
[0036] In one specific embodiment of the present application, the acoustic phase transition nanodroplet NDs is prepared by overexpressing mPD1 and RGD on the cell membrane as a shell layer
[0037] The present application provides the use of the above-mentioned acoustic phase transition nanodroplet or the acoustic phase transition nanodroplet prepared by the above-mentioned preparation method in the preparation of a tumor treatment drug.
[0038] The present application provides the use of the above-mentioned acoustic phase transition nanodroplet or the acoustic phase transition nanodroplet prepared by the above-mentioned preparation method in the preparation of a tumor treatment drug.mTx PDL1 degradation agent can be effectively delivered and the drug resistance of immune checkpoint blockers can be overcome. Specifically, (1) NDs mTx With its relatively small volume advantage, it overcomes the limitation of tumor blood vessels and can better enrich in tumor blood vessels; (2) NDs mTx With the phase change advantage, it can be imaged by ultrasound under the induction of LFUS; (3) Under the induction of LFUS, NDs mTx The radiofrequency force generated by inertial cavitation can promote the delivery of drugs to the tumor parenchyma and improve the delivery efficiency; (4) The constructed biorthogonal mPD1 has a higher PDL1 degradation efficiency than the wild-type PD1 in combination with PDL1; (5) The synthesized NDs mTx In tumor-bearing mice, compared with NDs Tx It has a better effect of activating immune suppression and inhibiting tumor growth.
[0039] The last object of the present application is to provide a drug for treating tumors, wherein the above-mentioned acoustic phase change nanodroplet or the acoustic phase change nanodroplet prepared by the above-mentioned preparation method is used as an active ingredient, and pharmaceutically acceptable adjuvants are also included.
[0040] In order to further illustrate the present application, the acoustic phase change nanodroplet for delivering biorthogonal PDL1 degradation agent and the preparation method and application thereof provided by the present application are described in detail below in conjunction with examples, but they cannot be understood as limiting the protection scope of the present application.
[0041] In the examples of the present application, the reagents and methods used are conventional reagents and methods in the art unless otherwise specified.
[0042] (1) Raw material type: RGD-PTGFRN-flag plasmid, PD1-PTGFRN-flag plasmid (SEQ ID No. 8), mPD1-PTGFRN-flag plasmid, HEK293T cell, PylRS / tRNA Pyl plasmid, fluorosulfate-L-tyrosine (FSY) and perfluorohexane (PFH);
[0043] (2) Raw material source: The plasmid is synthesized by Nanjing Kingsrui Company, PFH is purchased from Thermo Fisher Company, and FSY is purchased from Achemblock, USA.
[0044] (3) Plasmid construction method: GenScript software is used to introduce sequences on pcDNA3.1(-) vector. PTGFRN selects △687 fragment, introduces RGD, PD1 / mPD1 extracellular segment at N segment of △687 PTGFRN. C segment introduces flag.
[0045] (4) Cell transfection: Prepare the constructed plasmid PylRS / tRNA Pyl , RGD-PTGFRN-flag, PD1-PTGFRN-flag and mPD1-PTGFRN-flag.
[0046] HEK293T cells were seeded in culture dishes 24 hours before the experiment and transfected with 20 μL of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and 5 μg of mPD1-PTGFRN-flag / 5 μg of PD1-PTGFRN and 5 μg of PylRS / tRNA Pyl (or 5 μg of RGD-PTGFRN) plasmid. After 6 hours of transfection, the culture medium was replaced with fresh DMEM containing 1 mM FSY.
[0047] (5) Cell membrane extraction: Overexpressed mPD1 / PD1 and RGD-HEK293T cells were harvested in centrifuge tubes and resuspended in hypotonic lysis buffer containing protease inhibitors (Roche, Switzerland) and left on ice for more than 30 minutes. The suspension was homogenized by a Dounce homogenizer (Kimble 885300-0002, Mexico) for 20 strokes to break the cells. The homogenized lysis buffer was then centrifuged at 700 g for 5 minutes to remove the nuclei and unbroken cells, and then mitochondria were isolated by centrifugation at 7000 g for 15 minutes. Finally, the remaining supernatant was centrifuged at 100,000 g for 60 minutes to collect the cell membrane pellet.
[0048] (6) Nanodroplet construction: The extracted cell membranes were dissolved in a mixture of PBS and glycerol mixed at a volume ratio of 9:1, and PFH was added to the cell membrane mixed solution at a ratio of 1 / 8 of the total volume. The mixture solution was sonicated on ice for 130 seconds (Cole-Parmer, IL, USA), and then extruded using an avanti mini-extruder with 800 nm and 400 nm polycarbonate membranes (Avanti Polar Lipids Inc., AL, USA). The final solution was stored at 4°C.
[0049] Example 1
[0050] NDs used in this example RGD The cell membrane used was the cell membrane collected after transfecting HEK293T cells with the RGD-PTGFRN-flag plasmid, and the nanodroplets obtained by extrusion; NDs Ctrl The cell membrane used was the cell membrane collected after transfecting HEK293T cells with the pcDNA3.1(-) vector, and the nanodroplets obtained by extrusion.
[0051] Cell level observation of NDs RGD Targeting performance: HUVEC highly expresses integrin β3, HEK293T cells as negative control, to observe the enrichment ability of NDs on the surface of HUVEC. Grouped as NDs RGD and NDs Ctrl , NDs Ctrl as control group. Celltracker labeled cells, DiO labeled NDs were added to the cell culture dish for 30 min, and more NDs Ctrl , NDs RGD targeted to HUVEC, and only a few droplets targeted to HEK293T cells were observed Figure 1 D-F).
[0052] Animal level: Balb / c mice were purchased from the animal center of Air Force Medical University, 1x10 6 4T1 cells were injected into the right fat pad of the mouse breast to establish a breast cancer 4T1 tumor-bearing mouse model, and the tumor volume was 100mm 3 When the volume was 100mm RGD , the mice were randomly divided into NDs Ctrl and NDs Ctrl , and DiI labeled NDs were injected into the tail vein, and IVIS analysis was performed 4 hours later. As expected, more NDs RGD distributed in the tumor RGD than NDs Ctrl ( Figure 1 G-I).
[0053] Example 2
[0054] The continuous expansion and compression of nanodroplets during the phase transition process is called stable cavitation, in which the volume of nanodroplets increases to form microbubbles, producing enhanced ultrasound signals. Therefore, ultrasound irradiation is used to induce the phase transition of NDs to enhance the echo of conventional ultrasound.
[0055] 293 cells were transfected with empty plasmid or RGD plasmid, cell membranes were extracted, and NDs were prepared.
[0056] The in vitro imaging results are shown in Figure 2 A-C, the echo intensity of NDs was significantly enhanced under low-frequency ultrasound (LFUS) irradiation at a frequency of 650kHZ. In addition, no significant difference in echo intensity was observed between NDs RGD and NDs Ctrl after phase transition, indicating that modification does not affect the phase transition ability of NDs. Figure 2 D-F, tumor vasculature-targeted ultrasound imaging was performed on tumor-bearing mice. Compared with NDs Ctrl , ultrasound image examination showed that NDs RGD had stronger echo signals in the tumor.
[0057] Example 3
[0058] During the phase transition of nanodroplets, inertial cavitation generates a large number of microjets and enhances subsequent payload delivery. To assess whether inertial cavitation promotes the penetration of nanodroplet fragments, 4T1 tumor-bearing mice were injected with DiI-labeled NDs and irradiated with LFUS (650 kHz, 5 min, 2.5 W / cm²) 4 h later. 2 The mice were then sacrificed, and tumor tissue was collected for sectioning and fluorescent staining, followed by confocal observation.
[0059] 293 cells were transfected with empty plasmid or RGD plasmid, cell membranes were extracted, and NDs were prepared.
[0060] The results are as follows Figure 3 As shown, NDs RGD and NDs Ctrl Primarily distributed in the tumor vascular system (CD31 staining marker), with more NDs RGD Co-localization with blood vessels before the eruption. Increased permeation of NDs fragments was observed after inertial cavitation. Furthermore, NDs... RGD The fragments are greater than those of NDs Ctrl More. 3D analysis of tumor tissue further confirmed the correlation with NDs. Ctrl Compared to before the outbreak, there were more NDS RGD It is co-located with the tumor vascular system, and higher penetration efficiency can be observed after inertial cavitation.
[0061] This invention further explores whether the number and burst intensity of NDs affect tumor penetration.
[0062] Cell membrane origin is the same as above. Mouse treatment is the same as above.
[0063] The results are as follows Figure 4 As shown, both the number of NDs and the ultrasound intensity dose depend on increasing the number of NDs. RGD Fragments of tumor penetrate, when NDs RGD The quantity is 3×10 7 And LFUS is 2.5W cm -2 At that time, the penetration efficiency reaches its peak.
[0064] Example 4
[0065] This invention designs a plasmid expressing the fusion protein mPD1-PTGFRN-flag, in which the 75th codon CAG of mouse PD1 (18566) (homologically related to the 75th codon CAG of human PD1 (5133)) is mutated to the amber stop codon TAG. Orthogonal PylRS / tRNA is used. PylTransferring FSY, thus replacing Gin (Q) with FSY by Genetic Code Expansion (GCE) technology. mPD1 was overexpressed on the HEK293T cell membrane of mPD1-PTGFRN plasmid transfected cells. The results of Western blot analysis are shown in Figure 5 Figure 6B, where the mPD1-PTGFRN-flag fusion protein was overexpressed.
[0066] The ability of mPD1 to covalently bind PDL1 was then explored. Therefore, 4T1-PDL1 cells overexpressing PDL1 were established (4T1 cells were infected with blank and PDL1 expressing lentivirus), which were confirmed by qPCR and Western blot analysis Figure 9 ). Then, HEK293T-mPD1 cells overexpressing mPD1-PTGFRN-flag were mixed with 4T1-PDL1 cells.
[0067] The primers are shown below (5'-3'):
[0068] Pdl1-F (SEQ ID No. 9): GCCTGCTGTCACTTGCTACG;
[0069] Pdl1-R (SEQ ID No. 10): GTCCAGCTCCCGTTCTACAG;
[0070] Gapdh-F (SEQ ID No. 11): AGGTCGGTGTGAACGGATTTG;
[0071] Gapdh-R (SEQ ID No. 12): GGGGTCGTTGATGGCAACA.
[0072] The results are shown in Figure 5 Figure 6E, where bands with altered molecular weight can be observed, confirming the formation of covalent bonds between mPD1 and PDL1 through proximity reactivity (PER).
[0073] Example 5
[0074] To evaluate whether mPD1 on nanodroplets can induce PDL1 degradation, NDs mPD1 were prepared with mPD1-PTGFRN fusion protein engineered cell membranes. mPD1 LFUS irradiation induced inertial cavitation of DiI-labeled NDs mPD1 . Then, the debris of NDs
[0075] The results are shown in Figure 6 Figure 6D, where compared with control 4T1 cells, NDsmPD1 The fragments were preferentially taken up by 4T1-PDL1 cells. Meanwhile, both 4T1-PDL1 cells and control 4T1 cells showed reduced activity against NDs. Ctrl The intake levels are similar, but much lower.
[0076] To assess mPD1-induced PDL1 degradation, NDs were used. mPD1 After treating 4T1-PDL1 cells with fragments and culturing them at 37°C for 24 hours, a decrease in PDL1 expression was observed. Figure 6 (Zhong EG).
[0077] To further confirm whether lysosomal degradation was involved in the process, cells were treated with a lysosomal inhibitor (bafloxacin A1). 4T1 cells were transfected with the PDL1-GFP plasmid and randomly divided into bafloxacin A1-treated and untreated groups, and NDs were added. mPD1 The fragments lasted 4 hours.
[0078] The results of microfluorescence analysis are as follows Figure 6 As shown in the HI, lysosomal inhibition almost completely blocked the decrease in PDL1 expression, further confirming the effects of NDs. mPD1 Fragmentation induces PDL1 lysosomal degradation.
[0079] Example 6
[0080] Delivering mPD1 to tumor cells to construct NDs mTx In this study, both mPD1 and RGD were located on the nanodroplets. Additionally, nanodroplets carrying wild-type PD1 and RGD were included as a control, referred to as NDs. Tx As a comparison.
[0081] Investigating NDs in Balb / c mice inoculated with 4T1 mTx Therapeutic effects on inhibiting tumor growth. Mice were divided into 6 groups for targeted treatment. G1:NDs Ctrl / LFUS(+)G2:NDs Ctrl / LFUS(+)G3:NDs Tx / LFUS(-)G4:NDs Tx / LFUS(+)G5:NDs mTx / LFUS(-)G6:NDs mTx / LFUS(+). Tumor-bearing mice were injected with NDs, followed by LFUS radiation 30 minutes later, once per hour, for a total of three times. This procedure was repeated every other day for three times.
[0082] The results are as follows Figure 7 As shown, NDs mTxThe mice with LFUS showed the best therapeutic effect, and the tumor volume and tumor weight were the lowest. During the treatment, the body weight of each group showed no significant change. H&E staining of major organs and serum biochemical analysis showed no abnormal infiltration of inflammatory cells and no adverse effects on liver and kidney function, indicating that the NDs were non-toxic.
[0083] In view of the therapeutic effect, the present application also explores the NDs mTx Whether LFUS treatment works by inducing PDL1 degradation and CD8+T cell activation. Mice were divided into 6 groups to receive different treatments, G1: NDs Ctrl / LFUS(+)G2: NDs Ctrl / LFUS(+)G3: NDs Tx / LFUS(-)G4: NDs Tx / LFUS(+)G5: NDs mTx / LFUS(-)G6: NDs mTx / LFUS(+). NDs were injected on the seventh day, and LFUS radiation was performed 30 minutes later, once an hour, for three consecutive times. The mice were treated on the eighth day.
[0084] The results are shown in Figure 8 As consistent with the in vitro data, western blot and immunohistochemical analysis both showed that NDs mTx LFUS treatment can reduce the expression of PDL1 in tumors. Flow cytometry and immunostaining showed that the proportion of CD3+CD8+T cells in the tumor was significantly higher. In addition, the pro-inflammatory factors IFN-γ and Granzyme B secreted by CTLs were significantly increased in the treatment group compared with other groups. All these data indicate that NDs mTx inhibit tumor growth by degrading PDL1 and triggering an immune response.
[0085] Although the above embodiment makes a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which are within the protection scope of the present application.
Claims
1. An acoustic phase-transition nanodroplet delivering a bio-orthogonal PDL1 degrader, characterized in that, The internal core and the shell layer are included; The internal core includes perfluorohexane; the shell layer expresses or contains RGD and a biologically orthogonal PD1 mutant mPD1; the shell layer includes a cell membrane that expresses RGD and the biologically orthogonal PD1 mutant mPD1; the cell membrane is derived from a eukaryotic cell; The nucleotide sequence of the RGD is shown in SEQ ID No. 1; The nucleotide sequence of the biologically orthogonal PD1 mutant mPD1 is shown in SEQ ID No.
5.
2. The method of claim 1, wherein the acoustic phase transition nanodroplet is prepared by, The method includes the following steps: (1) Constructing a eukaryotic cell that expresses RGD and the biologically orthogonal PD1 mutant mPD1, and collecting the cell membrane after lysis; (2) Dissolving the collected cell membrane, mixing it with perfluorohexane, and then performing ultrasonic treatment on the mixture solution and extruding it to obtain the acoustic phase change nanodroplet.
3. The preparation method according to claim 2, characterized in that, The method for collecting the cell membrane in step (1) includes resuspending the eukaryotic cell in a lysis buffer containing a protease inhibitor, standing, breaking the cell and removing the nucleus and mitochondria, and then centrifuging the supernatant to collect the cell membrane precipitate. The centrifugal force of the centrifugation is 100,000 g, and the centrifugation time is 60 minutes.
4. The preparation method according to claim 2, characterized in that, The solvent used for dissolving in step (2) is a mixture of PBS and glycerol, and the volume ratio of PBS to glycerol is 9:
1.
5. The preparation method according to claim 4, characterized in that, The volume of the perfluorohexane is 1 / 8 of the volume of the solvent.
6. The preparation method according to claim 2, characterized in that, The ultrasonic treatment in step (2) is performed at a temperature of 4℃, a frequency of 20 kHz, a power of 500 W, and a time of 130 seconds.
7. The use of the acoustic phase change nanodroplet of claim 1 or the acoustic phase change nanodroplet prepared by the preparation method of claims 2-6 in the preparation of a drug related to tumor treatment.
8. A medicament related to tumor therapy, characterized in that, The acoustic phase change nanodroplet of claim 1 or the acoustic phase change nanodroplet prepared by the preparation method of claims 2-6 is used as an active ingredient, and further includes a pharmaceutically acceptable excipient.
Citation Information
Patent Citations
Genetically engineered cell membrane coating liposome nano-vesicle as well as preparation and application thereof
CN115120572A
Nano liquid drop as well as preparation method and application thereof
CN118267493A