Application of LRG-1 targeting antagonist in preparation of medicine for treating acute kidney injury

Abstract

The invention discloses application of an antagonist targeting LRG-1 to preparation of a medicine for treating acute kidney injury. The acute kidney injury is renal ischemia / reperfusion injury. Specifically, the application discloses that the antagonist is zafirlukast, and specifically discloses that zafirlukast can significantly reduce the serum creatinine and urea nitrogen levels of KIRI mice; renal tissue pathological section staining and flow cytometry detection show that inflammatory cell infiltration and tissue damage are obviously reduced compared with those of a non-medication group; multicolor immunofluorescence and western blot show that the zafirlukast can be used for remarkably inhibiting the formation of a macrophage extracellular trap (Macrophage Extracellular Trap, METs) in a kidney tissue of a KIRI model and the expression of a CitH3 histone protein, and the zafirlukast can be used for remarkably inhibiting the formation of the Macrophage Extracellular Trap and the expression of the CitH3 histone in the kidney tissue of the KIRI model. In conclusion, zafirlukast shows a strong and effective treatment potential for KIRI. The application shows that zafirlukast has certain potential in treating renal ischemia / reperfusion injury for the first time, and the new application strategy of the old medicine can greatly reduce the cost and risk of medicine research and development.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and in particular relates to the use of an antagonist targeting LRG-1 in the preparation of a medicine for treating acute kidney injury. Background Art

[0002] Kidney ischemia reperfusion injury (KIRI) is the most common pathophysiological phenomenon in clinical acute kidney injury. Nephrectomy, renal transplantation, renal artery ligation or embolization therapy can all lead to the occurrence and development of KIRI. KIRI-induced acute kidney injury is considered to be one of the important factors affecting the delayed recovery of renal function and reduced survival rate after renal transplantation [1-2]. The pathogenic mechanism of KIRI is very complex, involving numerous stimulating factors or cytokines such as inflammatory factors, complement proteins, chemokines and adhesion molecules [3]. In addition to traditional pre-ischemic preconditioning prevention methods [4], some immunosuppressants such as tacrolimus can also be used for the prevention and treatment of KIRI [5], but they still face the dilemma of limited therapeutic effect and large side effects. At present, it is believed that the activation of resident monocytes and macrophages triggered by renal tubular cell damage, as well as the infiltration and activation of circulating monocytes and macrophages, are considered to be the key links in renal injury in the early stage of KIRI. In clinical renal transplant patients, early tissue biopsies also found that the number of macrophage infiltration was significantly positively correlated with the degree of renal injury [6-9]. Depletion of macrophages in renal tissue in the early stage of KIRI using colony stimulating factor receptor inhibitors can effectively protect renal injury

[10] . Therefore, starting from the common pathological feature of macrophage activation in the early stage of KIRI, the development of therapeutic drugs that effectively intervene in cell damage or necrosis is of great significance for the prevention and treatment of acute kidney injury and even multi-organ injury.

[0003] Research on the mechanism of KIRI currently focuses on the two stages of ischemia and reperfusion. The kidney is an aerobic organ. When the kidney is ischemic and hypoxic, the damaged renal tubular cells release stimulatory factors such as damage-associated molecular patterns, which activate the renal resident mononuclear macrophages to release inflammatory factors and chemokines, which constitute the initial source of renal inflammatory response

[11] . During the reperfusion phase, driven by leukocyte adhesion molecules and chemokines, a large number of peripheral mononuclear macrophages infiltrate the injured part of the kidney, and stimulated by activated platelets, IL-1β and other factors, promote the release of granular proteins, ionic peptides and inflammatory cytokines through paracrine or autocrine signals, further initiate acquired immunity, amplify the aseptic inflammatory response, and lead to acute renal failure or even death

[12] . Therefore, the activation of resident mononuclear macrophages triggered by renal tubular cell damage, as well as the infiltration and activation of circulating mononuclear macrophages, are considered to be the key links in renal injury in the early stage of KIRI. Using colony stimulating factor receptor inhibitors to deplete macrophages in renal tissue in the early stage of KIRI can effectively protect renal injury

[10] . In clinical renal transplant patients’ early tissue biopsies, it was also found that the number of macrophage infiltration was positively correlated with the degree of renal injury [6-9]. However, the specific mechanism of macrophage infiltration and activation in the early stage of KIRI remains unclear.

[0004] Recent studies have shown that macrophage extracellular traps (METs, also written as METosis) are a special activation mode of macrophages and the main form of initiation and amplification of tissue sterile inflammation. METosis refers to a mechanism in which macrophages release METs composed of DNA, histones (CitH3), myeloperoxidase (MPO) and macrophage elastase (MMP12) when stimulated by bacteria, viruses, activated platelets, hypoxia and inflammatory cytokines (IL-β, TNF-α) to protect the body from pathogen attacks [13,14]. A large amount of clinical evidence shows that the proportion of METs is significantly negatively correlated with the prognosis of renal transplant patients. In patients with acute kidney injury and mouse models, the use of lactoferrin can significantly inhibit macrophage METosis and improve acute kidney injury

[15] . It can be seen that the accumulation of METs in renal tissue is an important cause of the occurrence and development of acute kidney injury, and may become an important obstacle to the application and treatment effect of renal transplantation surgery, suggesting that macrophage METs may be a new target for METs-related diseases such as acute kidney injury. At present, there are no reports on the research of specific inhibitors for macrophage METs. Only reports indicate that lactoferrin can inhibit the formation of macrophage METs and improve acute kidney injury in mouse models. However, lactoferrin is currently mainly used as the main active ingredient of health products. If it is used as a macrophage METs inhibitor for the clinical treatment of acute kidney injury, it still needs to face more stringent drugability evaluation. Therefore, if there are drugs that have been approved by the FDA for the treatment of other clinical diseases, which can significantly inhibit the formation of macrophage METs, it will not only be safe and reliable, but also greatly shorten the research and development cycle, and the development of new indications can quickly enter clinical evaluation, saving development costs.

[0005] Leucine Rich Alpha-2-Glycoprotein 1 (LRG-1) is an important member of the leucine-rich repeat (LRR) protein family. It is a secretory granule protein that was first discovered in serum

[16] . LRG-1 is mainly synthesized by hepatocytes and monocytes and is expressed in tissues such as the kidney, heart, and brain. It plays an important role in a variety of pathological and physiological processes such as leukocyte migration, platelet adhesion and activation, and innate immune response [16,17]. More and more studies have found that LRG-1 plays a very important role in the occurrence and development of a variety of inflammatory and immune diseases. For example, inhibiting the expression of LRG-1 in an acute brain injury model can significantly alleviate inflammation and improve brain injury

[18] . Similarly, LRG-1 plays an important regulatory role in the inflammatory response stage of diseases such as acute myocardial infarction

[19] . In summary, LRG-1, as an acute response protein, is not only a key factor with high expression in the early stage of inflammation, but also a key gene that affects the migration and activation of inflammatory cells and participates in the formation of inflammatory factor networks. KIRI is a classic acute inflammatory disease, and the role and mechanism of LRG-1 in KIRI are still unclear.

[0006] Zafirlukast (CAS No: 107753-78-6) is a G protein-coupled receptor (GPCR)-cysteinyl leukotrienes receptor 1 (CYSLTR1) antagonist that can selectively act on cysteinyl leukotrienes receptors and is commonly used in the prevention and long-term treatment of asthma in clinical practice. In addition, studies have shown that zafirlukast can protect the integrity of the blood-brain barrier from ischemic brain damage and can be used as a regulator of innate immune cell function, playing an important role in anti-inflammatory, prevention and reduction of mucosal inflammatory cell infiltration. However, there are currently no reports on the use of zafirlukast in the treatment of symptoms related to acute kidney injury.

[0007] References

[0008] [1]Gallagher S M,Jones D A,Kapur A,Wragg A,Harwood S M,Mathur R,Archbold R A,Uppal R,Yaqoob M M.Remote ischemic preconditioning has a neutraleffect on the incidence of kidney injury after coronary artery bypass graftsurgery[J].Kidney Int,2020,87(2):473-481.

[0009] [2]Smith S F,Hosgood S A,Nicholson M L.Ischemia-reperfusion injury inrenal transplantation:3key signaling pathways in tubular epithelial cells[J].Kidney Int,2019,95(1):50-56.

[0010] [3]Pefanis A,Ierino F L,Murphy J M,Cowan P J.Regulated necrosis inkidney ischemia-reperfusion injury[J].Kidney Int,2019,96(2):291-301.

[0011] [4]Kyrychenko M I,Biliaiev A V,Mazur A P.Remote Donor Preconditioningfor Increasing Transplant Survival in the Recipient's Body during the KidneyTransplantation from the Living-Related Donor[J].Wiad Lek,2022,75(2):397-403.

[0012] [5]Kim SM,Lim Y,Min S,Min BJ,Seo ME,Lee KH,Kim JH,Ha J.FlatPattern Peaks of Tacrolimus Absorption and Associated PharmacogenomicVariants in Kidney Transplantation Recipients[J].J Korean Med Sci,2022,37(5):e33.

[0013] [6]Wang J,Luo P,Zhao J,Tan J,Huang F,Ma R,Huang P,Huang M,Huang Y,WeiQ,Wei L,Wang Z,Meng L.Profiling the Resident and Infiltrating Monocyte / Macrophages during Rejection following Kidney Transplantation.

[0014] [7]Yao W,Chen Y,Li Z,Ji J,You A,Jin S,Ma Y,Zhao Y,Wang J,Qu L,Wang H,Xiang C,Wang S,Liu G,Bai F,Yang L.Single Cell RNA Sequencing Identifies aUnique Inflammatory Macrophage Subset as a Druggable Target for Kidney Disease Injury[J].Adv Sci(Weinh),2022,9(12):e2103675.

[0015] [8]Dangi A,Natesh N R,Husain I,Ji Z,Barisoni L,Kwun J,Shen X,Thorp EB,Luo X.Single cell transcriptomics of mouse kidney transplants reveals amyeloid cell pathway for transplant rejection[J].JCI Insight,2020,5(20):e141321.

[0016] [9]Brasen J H,Khalifa A,Schmitz J,Dai W,Einecke G,Schwarz A,Hallensleben M,Schmidt B M W,Kreipe H H,Haller H,von Vietinghoff S.Macrophagedensity in early surveillance biopsies predicts future renal transplantfunction[J].Kidney Int,2020,92(2):479-489.

[0017]

[10] Deng X,Yang Q,Wang Y,Zhou C,Guo Y,Hu Z,Liao W,Xu G,Zeng R.CSF-1Rinhibition attenuates ischemia-induced renal injury and fibrosis by reducingLy6C(+)M2-like macrophage infiltration[J].Int Immunopharmacol,2020,88:106854.

[0018]

[11] DeWolf S E,Kasimsetty S G,Hawkes A A,Stocks L M,Kurian S M,McKayD B.DAMPs Released From Injured Renal Tubular Epithelial Cells ActivateInnate Immune Signals in Healthy Renal Tubular Epithelial Cells[J].Transplantation,2022,106(8):1589-1599.

[0019]

[12] Lau A,Rahn J J,Chappellaz M,Chung H,Benediktsson H,Bihan D,vonMassenhausen A,Linkermann A,Jenne C N,Robbins S M,Senger D L,Lewis I A,ChunJ,Muruve D A.Dipeptidase-1governs renal inflammation during ischemiareperfusion injury[J].Sci Adv,2022,8(5):eabm0142.

[0020]

[13] Doster R S,Rogers L M,Gaddy J A,Aronoff D M.MacrophageExtracellular Traps:A Scoping Review[J].J Innate Immun,2018,10(1):3-13.

[0021]

[14] Boe D M,Curtis B J,Chen M M,Ippolito J A,Kovacs E J.Extracellulartraps and macrophages:new roles for the versatile phagocyte[J].J Leukoc Biol,2015,97(6):1023-1035.

[0022]

[15] Okubo K,Kurosawa M,Kamiya M,Urano Y,Suzuki A,Yamamoto K,Hase K,Homma K,Sasaki J,Miyauchi H,Hoshino T,Hayashi M,Mayadas T N,HirahashiJ.Macrophage extracellular trap formation promoted by platelet activation isa key mediator of rhabdomyolysis-induced acute kidney injury[J].Nat Med,2018,24(2):232-238.

[0023]

[16] Camilli C,Hoeh A E,De Rossi G,Moss S E,Greenwood J.LRG1:anemerging player in disease pathogenesis[J].J Biomed Sci,2022,29(1):6.

[0024]

[17] O′Donnell L C,Druhan L J,Avalos B R.Molecular characterizationand expression analysis of leucine-rich alpha2-glycoprotein,a novel marker ofgranulocytic differentiation[J].J Leukoc Biol,2002,72(3):478-485.

[0025]

[18] Miao Y,Wang M,Cai X,Zhu Q,Mao L.Leucine rich alpha-2-glycoprotein1(Lrg1)silencing protects against sepsis-mediated brain injury by inhibitingtransforming growth factor beta1(TGFbeta1) / SMAD signaling pathway[J].Bioengineered,2022,13(3):7316-7327.

[0026]

[19] Su Q,Lv XW,Sun YH,Ye ZL,Kong BH,Qin Z B.MicroRNA-494Inhibitsthe LRG1 Expression to Induce Proliferation and Migration of VECs in Ratsfollowing Myocardial Infarction[J].Mol Ther Nucleic Acids,2019,18:110-122. Summary of the invention

[0027] Purpose of the invention: The technical problem to be solved by the present invention is to address the limitations and serious side effects of traditional KIRI treatment methods, and to reveal the role and mechanism of LRG-1 in KIRI.

[0028] The technical problem that the present invention needs to solve is to provide a new use of zafirlukast in the treatment of KIRI, and to provide an experimental basis and a new treatment strategy for the treatment of KIRI.

[0029] Specifically, the present application proposes the use of an antagonist targeting LRG-1 in the preparation of a drug for treating acute kidney injury.

[0030] The applicant evaluated the degree of renal damage in LRG-1 knockout (Lrg1-KO) mice after ischemia-reperfusion and found that LRG-1 knockout not only significantly reduced the degree of renal tubular necrosis or damage in KIRI mice, restored serum BUN and Creatinine levels, but also significantly inhibited renal inflammatory response.

[0031] Furthermore, flow cytometry was used to detect immune cells in the kidneys of Lrg1-KO and wild-type KIRI model mice, and it was found that compared with KIRI model mice, the number of macrophages in the kidneys of Lrg1-KO KIRI mice was significantly reduced, and other immune cells (neutrophils, T cells, NK cells, etc.) did not change significantly. Immunofluorescence triple staining (LRG-1, CitH3, F4 / 80 and DAPI) technology was used to verify the kidney tissues of Lrg1-KO-KIRI and WT-KIRI model mice, showing that a large number of macrophage METs and LRG1 co-expression were observed in the kidney tissues of WT-KIRI model mice, while there was almost no macrophage METs in Lrg1-KO-KIRI mice, confirming that high expression of LRG-1 can significantly promote the expression of METs marker proteins. The macrophage-specific LRG-1 gene intervention technology was used to verify the hypothesis that LRG-1 can amplify the reperfusion inflammatory response and aggravate KIRI by regulating the formation and recruitment of macrophage METosis. The relevant transgenic animal models were further used in combination with multi-omics analysis to explore the signal network mechanism by which LRG-1 regulates macrophage METosis to amplify the reperfusion inflammatory response and aggravate the progression of KIRI. The correlation between LRG-1 and the severity of KIRI renal injury was verified through clinical samples and experimental models; in vivo and in vitro studies clarified the role and molecular mechanism of LRG-1 in driving the progression of KIRI, providing new strategies for the treatment of KIRI.

[0032] Furthermore, the present application screened and obtained the LRG-1 antagonist Zafirlukast, and verified its therapeutic effect on acute kidney injury.

[0033] Among them, the above-mentioned acute kidney injury is renal ischemia / reperfusion injury.

[0034] Specifically, the present invention uses zafirlukast for the first time to perform intraperitoneal injection on KIRI mice, and the results show that zafirlukast can significantly reduce the levels of serum creatinine and urea nitrogen in KIRI mice; renal tissue pathological section staining and flow cytometry detection show that inflammatory cell infiltration and tissue damage are significantly reduced compared with the untreated group; multicolor immunofluorescence and protein immunoblotting show that zafirlukast can significantly inhibit the formation of macrophage METs and the expression of CitH3 histones in the renal tissue of the KIRI model. In summary, zafirlukast shows strong and effective therapeutic potential for KIRI. .

[0035] The present invention also proposes the use of zafirlukast in preparing medicines for treating diseases mediated by macrophage METs.

[0036] The drug is in the form of capsules, powders, tablets, granules, pills, injections, syrups, oral solutions, inhalants, ointments, suppositories or patches.

[0037] Beneficial effects: Currently, in addition to traditional pre-ischemic pretreatment prevention methods, some immunosuppressants such as tacrolimus can also be used for the prevention and treatment of KIRI, but they still face the problems of limited therapeutic effects and large side effects. This application reveals the association between LRG-1 and KIRI for the first time. Zafirlukast is a first-line drug for the clinical treatment of asthma with few side effects. The present invention shows for the first time that zafirlukast has certain potential in the treatment of KIRI, and this strategy of using old drugs in new ways can greatly reduce the cost and risk of drug research and development. The present invention explores for the first time the efficacy and mechanism of zafirlukast in the treatment of KIRI, and provides an experimental basis for studying the intervention of zafirlukast in the formation of macrophage METs and the treatment of KIRI. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 is the expression of Lrg1 in the progression of KIRI, where A is the expression of Lrg1 in RNA-seq of KIRI mice, and B is the expression of Lrg1 in the chip data of renal transplant patients; C is the expression of LRG1 mRNA in the kidney of WT mice detected by q-PCR and ELISA methods after 30 minutes of ischemia and 24 hours of reperfusion; D is the protein level of serum Lrg1 in WT mice detected by q-PCR and ELISA methods after 30 minutes of ischemia and 24 hours of reperfusion; E is the expression of Lrg1 in renal endothelial cells (Endothelial), interstitial cells (Intersititial), macrophages (Macrophage) and nephrons (Nephron) 24 hours after reperfusion, where the left side is the expression value of Lrg-1 in Endothelial, Interstitial, Macrophages and Nephron in three different samples in the sham group and KIRI group; the right side is the statistical chart of the expression matrix on the left;

[0039] Figure 2 The results of LRG-1 significantly promoting the progression of KIRI are shown in Figure 1, where A is the expression of LRG-1 in the kidney tissue of LRG1-KO and control mice detected by WB and qPCR; B is the level of serum BUN and Creatinine detected by ELISA in KIRI mice 24 hours later; C is the pathological structure and glycogen deposition of kidney tissue in the two groups of KIRI mice detected by H&E and PAS staining; D is the score of kidney tissue injury in each group of mice after 24 hours of reperfusion using Image proplus software; E is the mRNA expression of inflammatory factors in the kidney tissue of the two groups of KIRI mice after 24 hours of reperfusion determined by qPCR;

[0040] Figure 3The results of LRG-1 regulating macrophage infiltration are shown in Figure 1. A shows the renal tissue immune cell clustering strategy established based on literature reports; B shows the total immune cells (CD45 + ) The proportion of myeloid cells, T cells and NK cells respectively; C is the proportion of macrophages, neutrophils and monocytes in myeloid cells; D is the proportion of CD4 + T and CD8 + The proportion of T cells and CD56 in NK cells + 、CD16 + Changes in the proportion of subgroups;

[0041] Figure 4 Detection of macrophage METs in the KIRI model, where A is the KEGG signaling pathway and GO functional annotation analysis of differentially expressed genes (Fc ≥ 1.5 or Fc ≤ -1.5) between KIRI and Sham; B is the multicolor fluorescence staining of macrophage METs in the KIRI model;

[0042] Figure 5 The results of LRG-1 regulating macrophage METosis, where A is the correlation analysis between LRG-1 and MMP12, F4 / 80, Mac-1 and MPO; B is the F4 / 80 in the kidney tissue of WT-KIRI and LRG1-KO-KIRI model mice + Macrophage METs fluorescence staining; C is the protein level of serum METs marker (MMP12) in WT-KIRI and LRG1-KO-KIRI model mice; D and E are the effects of J774A.1-AAV9-LRG-1 conditioned medium co-cultured with mononuclear bone marrow macrophages on the expression of macrophage MMP12; F is the Transwell chamber detection of the effect of J774A.1 macrophage LRG-1 overexpression conditioned medium on METs formation and METs-related F4 / 80 + the impact of macrophage recruitment;

[0043] Figure 6 This is a diagram showing the molecular simulation results between zafirlukast and endoglin, the receptor of LRG-1;

[0044] Figure 7 This is the result diagram of the improvement of KIRI pathological damage by zafirlukast, where KIRI (ischemia 40 min, reperfusion 24 h); zafirlukast (10 mg / kg);

[0045] Figure 8 The results of the effect of zafirlukast on serum creatinine and blood urea nitrogen (BUN) levels in KIRI, where KIRI (ischemia 40 min, reperfusion 24 h); zafirlukast (10 mg / kg);

[0046] Fig. 9 The effect of ZFK on renal macrophages. (A): Gating strategy for flow cytometry. (B&C): The proportion of macrophages in sham kidney and renal I / R group after treatment with saline or zafirlukast (n=6). *p<0.05, **p<0.01, ***p<0.001; sham vs I / R, two-way ANOVA;

[0047] Fig.10 The improvement of zafirlukast on renal tissue inflammation in KIRI; A to C are the mRNA levels of IL-1β, IL-6 and TNF-α in the sham operation group and renal I / R group after treatment with normal saline or zafirlukast, n=6, *p<0.05, **p<0.01, ***p<0.001, sham vs I / R, two-way ANOVA analysis;

[0048] Fig.11 is the inhibition of METs in KIRI renal tissue by zafirlukast, where AD is the effect of zafirlukast on the gene expression levels of CCL2, MMP2, MMP9, and PAD4; EF is the multicolor immunofluorescence staining of METs-related markers in KIRI renal tissue, KIRI (ischemia 40 min, reperfusion 24 h); zafirlukast (10 mg / kg);

[0049] Fig.12 In order to verify the effect of zafirlukast on METs formation in vitro cell experiments, A is the inhibition of CitH3 histone expression in CoCl2-induced BMDM model by zafirlukast; B is the statistical result of the effect of zafirlukast on METs formation, CoCl2 (24h); Zafirlukast (5μM);

[0050] Fig.13 The effect of Zafirlukast and Tacrolimus on the gene expression profile of kidney tissue in KIRI; Zafirlukast (10 mg / kg); Tacrolimus (1 mg / kg);

[0051] Fig.14 Effects of Zafirlukast and Tacrolimus on pathways related to down-regulated genes in renal tissue of KIRI; Zafirlukast (10 mg / kg); Tacrolimus (1 mg / kg). DETAILED DESCRIPTION

[0052] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0053] The experimental materials and experimental methods involved in the examples of this application are as follows.

[0054] 1. Experimental Materials

[0055] 1.1 Experimental instruments: flow cytometer (BD), dehydrator (JJ-12J, Wuhan Junjie Electronics Co., Ltd.), embedding machine (JB-P5, Wuhan Junjie Electronics Co., Ltd.), pathological slicer (RM2016, Shanghai Leica Instrument Co., Ltd.), freezing table (JB-L5, Wuhan Junjie Electronics Co., Ltd.), tissue spreader (KD-P, Jinhua Kedi Instrument Equipment Co., Ltd., Zhejiang Province), oven (GFL-230, Tianjin Laiborui Instrument Equipment Co., Ltd.), slides (Hunan Aifang Biological Co., Ltd.), upright optical microscope (Nikon Eclipse E100, Japan), imaging system (NIKON DS-U3, Japan), vortex mixer (DLAB, MX-E), handheld centrifuge (DLAB, D1008E), pipette (Dragon, KE0003087 / KA0056573), histochemical pen (Beyotime, FPP06B), upright fluorescence microscope (NIKON ECLIPSE, Japan) C1), imaging system (Nikon DS-U3, Japan).

[0056] 1.2 Experimental drugs and reagents: Zafirlukas (abbreviated as ZFK), normal saline, serum creatinine and urea nitrogen detection kit (Solarbio), flow cytometry antibody (BD pharmingen, Biolegend, eBioscience), CitH3 antibody (abcam), anhydrous ethanol (Sinopharm Chemical Reagent Co., Ltd., 100092683), xylene (Sinopharm Chemical Reagent Co., Ltd., 10023418), HE stain (Hunan Aifang Biological Co., Ltd., AFIHC1005), differentiation solution (Hunan Aifang Biological Co., Ltd., AFIHC019), blueing solution (Hunan Aifang Biological Co., Ltd., AFIHC020), Neutral gum (Sinopharm Chemical Reagent Co., Ltd., 10004160), EDTA (PH8.0) antigen retrieval solution (Aifang Biotechnology, AFIHC010, 1:49), PBS buffer (Aifang Biotechnology, AFIHC009), autofluorescence quencher (Solebo, S8300), DAPI (Solebo, C0060), anti-fluorescence quenching mounting medium (Solebo, S2100), primary antibody: F4 / 80 (CST, 1:500), secondary antibody: 488 Goat Anti-Mouse IgG (Aifang Biotechnology, AFSA002, 1:200), CY3 Goat Anti-Rabbit IgG (Aifang Biotechnology, AFSA006, 1:150).

[0057] 1.3 Experimental animals

[0058] This experiment used C57BL / 6J mice, about 8-10 weeks old, weighing 20-22g, provided by Beijing Weitong Lihua Experimental Animal Co., Ltd., and constructed a renal ischemia-reperfusion injury model by clamping the bilateral renal arteries for 30min and reperfusion for 24h. Housing conditions: room temperature 18-20℃, humidity 50-60%, alternating light and dark (12h), moderate light intensity, good ventilation and cleanliness. All experiments were approved and conducted in accordance with the guidelines of the Experimental Animal Ethics Committee of Wenzhou Medical University.

[0059] 2. Experimental Methods

[0060] C57BL / 6J mice aged about 8-10 weeks and weighing 20-22 g were randomly divided into 3 groups. 3 days before renal ischemia-reperfusion surgery, the 3rd group was intraperitoneally injected with 10 mg / kg of zafirlukast every day, and the other 2 groups were given the same volume of normal saline. After the surgery, they were divided into a normal control group, a KIRI group, and a zafirlukast+KIRI group for the next experiment.

[0061] 2.1 Serum creatinine and urea nitrogen testing

[0062] 24 hours after modeling, blood was collected from the retro-orbital venous plexus of mice, centrifuged at 3000 rpm / min for 15 min at room temperature, and the supernatant was collected. The levels of creatinine (Nanjing Jiancheng, C011-2-1) and urea nitrogen (Solarbio, BC1535) in serum were detected according to the instructions of the kit.

[0063] 2.2 Renal tissue pathological analysis

[0064] 1) Dewaxing of paraffin sections: sequentially place the sections in xylene for 20 min, xylene for 20 min, anhydrous ethanol for 5 min, anhydrous ethanol for 5 min, and 75% alcohol for 5 min, and then wash with tap water.

[0065] 2) Hematoxylin staining: Stain the sections with hematoxylin solution for 3-5 minutes, wash with tap water, differentiate with differentiation solution, wash with tap water, reblue with bluing solution, and rinse with running water.

[0066] 3) Eosin staining: The sections were dehydrated in 85% and 95% graded alcohol for 5 min each, and then stained in eosin solution for 5 min.

[0067] 4) Dehydration and sealing: The slices were sequentially placed in anhydrous ethanol for 5 min - anhydrous ethanol for 5 min - anhydrous ethanol for 5 min - xylene for 5 min - xylene for 5 min to make them transparent, and then sealed with neutral gum.

[0068] 5) Microscope examination, image acquisition and analysis. Interpretation of results: cell nuclei appear blue and cytoplasm appears red.

[0069] 2.3 Detection of mRNA of inflammatory factors in renal tissue

[0070] According to the instructions, total RNA from renal tissues of Ctrl, KIRI and KIRI+Zafirlukast was extracted using Trizol (Invitrogen) and reverse transcribed into cDNA using Novagen HiScript@III RT SuperMix for qPCR (+gDNA wiper)-RNA reverse transcription reagent. qPCR was performed using ChamQ Universal SYBR qPCR Master Mix and primers in Roche LightCycler 96 to detect the expression of CCL2, IL-6, and IL-1β. The primer sequences are as follows:

[0071] CCL2 upstream primer: ACCTGCTGCTACTCATTCACC

[0072] CCL2 downstream primer: ATTCCTTCTTGGGGTCAGCA

[0073] IL-6 upstream primer: TCACAGAAGGAGTGGCTAAGGACC

[0074] IL-6 downstream primer: ACGCACTAGGTTTGCCGAGTAGAT

[0075] IL-1β upstream primer: GAAATGATGGCTTATTACAGTGGCA

[0076] IL-1β downstream primer: GTAGTGGTGGTCGGAGATTCGTAG

[0077] Staining protocol:

[0078] CD45-FITC (BD pharmingen, 561088)

[0079] CD11b-APC (BD pharmingen, 561690)

[0080] F4 / 80-PE(BD pharmingen, 565410)

[0081] LD-405 (BD pharmingen, 565520)

[0082] 2.4 Immunofluorescence staining

[0083] 1) Dewaxing of paraffin sections: sequentially place the sections in xylene for 15 min - xylene for 15 min - anhydrous ethanol for 5 min - anhydrous ethanol for 5 min - 85% alcohol for 5 min - 75% alcohol for 5 min - and wash with distilled water.

[0084] 2) Antigen repair: Place the tissue sections in a repair box filled with EDTA antigen repair buffer (PH8.0) in a microwave oven for antigen repair. Boil on medium heat for 8 minutes, stop the heat for 8 minutes, and then turn to medium-low heat for 7 minutes. During this process, prevent the buffer from evaporating excessively and do not let the slides dry. After natural cooling, place the slides in PBS (PH7.4) and wash them on a decolorizing shaker 3 times, 5 minutes each time.

[0085] 3) Circle serum blocking: After the slices are slightly dried, use a histochemical pen to draw circles around the tissue (to prevent the antibody from flowing away), dry the PBS, add BSA, and block for 30 minutes (if the primary antibody is from goat, use 10% donkey serum to block, and if the primary antibody is from other sources, use 3% BSA to block).

[0086] 4) Add primary antibody: Gently shake off the blocking solution, add primary antibody prepared in a certain proportion of PBS on the slices, and incubate the slices flat in a humidified box at 4°C overnight (add a small amount of water in the humidified box to prevent evaporation of the antibody).

[0087] 5) Add secondary antibody: Place the slide in PBS (PH7.4) and shake on a decolorizing shaker for 3 times, 5 minutes each time. After the slices are slightly dried, add the secondary antibody of the same species as the primary antibody to cover the tissue in the circle and incubate at room temperature for 50 minutes in the dark.

[0088] 6) DAPI counterstaining of cell nuclei: Place the slide in PBS (PH7.4) and shake on a decolorizing shaker for 3 times, 5 minutes each time. After the slices are slightly dried, add DAPI staining solution in the circle and incubate at room temperature for 10 minutes away from light.

[0089] 7) Quenching tissue autofluorescence: Place the slide in PBS (PH7.4) and wash on a decolorizing shaker for 3 times, 5 minutes each time. Add autofluorescence quencher in the circle for 5 minutes and rinse with running water for 10 minutes.

[0090] 8) Sealing: After the slices are slightly dried, they are sealed with anti-fluorescence quenching sealing medium.

[0091] 9) Microscopic examination and photography: The sections were observed and images were collected under a fluorescence microscope. (DAPI has an ultraviolet excitation wavelength of 330-380nm, an emission wavelength of 420nm, and emits blue light; 488 has an excitation wavelength of 465-495nm, an emission wavelength of 515-555nm, and emits green light; CY3 has an excitation wavelength of 510-560, an emission wavelength of 590nm, and emits red light. The cell nucleus stained with DAPI is blue under ultraviolet excitation, and positive expression is red or green light of the corresponding fluorescent marker.

[0092] 2.6 Western blot experiment

[0093] 1) Prepare 12% SDS-PAGE gel;

[0094] 2) Electrophoresis: After the power is turned on, constant voltage electrophoresis is performed, the voltage is concentrated to 80V, the time is 30min, and the sample is fully concentrated in the concentrated gel. After electrophoresis for 30min, the voltage is increased to 120V and the electrophoresis is continued for 60min;

[0095] 3) Transfer: After turning on the power, wet transfer at a constant voltage of 100V for 60 minutes;

[0096] 4) Blocking: Add 5 ml of 5% skim milk and block at room temperature for 2 hours;

[0097] 5) Incubation with primary antibodies: CitH3 (≈17 kDa): 1:800, incubate at 4°C overnight; Actin (≈43 kDa): 1:5000, incubate at 4°C overnight;

[0098] 6) Incubation with secondary antibody: CitH3-rabbit secondary antibody (1:5000) incubated at room temperature for 1 hour, Actin-mouse secondary antibody (1:5000) incubated at room temperature for 1 hour; 7) Exposure: Expose the PVDF membrane and save the development data.

[0099] Example 1 Expression of LRG-1 during KIRI progression.

[0100] The transcriptome data of the mouse KIRI model and the gene chip data of renal transplant patients showed that the LRG-1 gene level was significantly upregulated during reperfusion and 24 hours after renal transplantation (e.g. Figure 1 A and 1B). The expression of Lrg1 in mouse and human kidney tissue samples was obtained by bioinformatics analysis using the (GSE52004 and GSE30718) datasets in the GEO database; FPKM represents fragments per kilobase of transcription per million mapped reads, and Sham represents the sham operation group. We then detected the LRG-1 protein expression and mRNA levels in the kidney and serum of KIRI mice by ELISA and qPCR, respectively, and found that LRG-1 was significantly upregulated 24 hours after reperfusion injury ( Figure 1 C and Figure 1 D) and is mainly highly expressed in renal macrophages ( Figure 1 E).

[0101] Example 2 LRG-1 significantly drives KIRI progression

[0102] Whether the high expression of Lrg1 is a concomitant phenomenon or a driving factor in the progression of KIRI needs further verification. We used Lrg1-KO mice and wild-type control mice of the same litter as research subjects. First, Lrg1-KO mice were constructed, and CRISPR / Cas9 technology was used to introduce mutations using non-homologous recombination repair, resulting in a frameshift of the Lrg1 gene protein and loss of function. The brief process is as follows: Cas9 mRNA and gRNA were obtained by in vitro transcription; Cas9 mRNA and gRNA were microinjected into the fertilized eggs of C57BL / 6J mice to obtain F0 mice. F0 mice that were positive for PCR amplification and sequencing were mated with C57BL / 6J mice to obtain positive F1 mice.

[0103] The degree of renal injury after ischemia-reperfusion in Lrg1-KO mice was evaluated. The results showed that Lrg1 knockout not only significantly reduced the degree of renal tubular necrosis or injury in KIRI mice, but also restored serum BUN and Creatinine levels (such as Figure 2 BD), and significantly inhibited the expression of renal inflammatory factors (such as Figure 2 E). In summary, LRG-1 knockout can significantly inhibit KIRI progression and renal inflammatory response, indicating that LRG-1 may be a key target for intervening in KIRI progression.

[0104] Example 3 LRG-1 regulates the infiltration of exogenous macrophages in the renal microenvironment

[0105] Studies have shown that in the early stages of KIRI, the renal inflammatory cascade is mainly mediated by immune cells in the renal tissue microenvironment. Macrophages, neutrophils, inflammatory monocytes, natural killer cells, and T cells are the main participants in the inflammatory response in ischemia-reperfusion injury. Therefore, we further analyzed the infiltration of immune cells in the renal tissue of KIRI mice after LRG-1 knockout by multicolor flow cytometry. Figure 3 As shown in A.

[0106] Flow cytometry results showed that among the total immune cells (CD45 + ), LRG1-KO group CD45 + The proportion of total mononuclear myeloid cells decreased significantly, and there was no significant difference in the proportion of T cells and NK cells ( Figure 3 B) Based on the above results, we further analyzed the changes in myeloid cells, T lymphocytes and NK cell subsets. The results showed that in CD45 + CD11b + Among the total myeloid cell subsets, neutrophils (CD11b + 6G + ) and inflammatory monocytes (CD11b+ Ly6C + ) had no significant changes, while macrophages (CD11b + F4 / 80 + ) ratio decreased significantly ( Figure 3 C) In CD3 + Among T cell and NK cell subsets, CD4 + T, CD8 + T cells and CD56 + 、CD16 + There was no significant change in the proportion of NK cells ( Figure 3 E). In summary, in the early stage of KIRI injury, LRG-1 knockout can significantly inhibit the infiltration of macrophages in the damaged part of renal tissue and improve renal injury.

[0107] Example 4 LRG-1 regulates the formation and recruitment of macrophage METosis in the renal tissue microenvironment of KIRI mice.

[0108] The above studies have shown that macrophages are the main target cells in the process of LRG-1 driving the progression of KIRI. So how does LRG-1 regulate the function of macrophages and drive the progression of KIRI? The applicant previously conducted KEGG signaling pathway and GO functional annotation analysis on the differential genes (Fc ≥ 1.5 or Fc ≤ -1.5) between KIRI vs Sham by RNA-seq and bioinformatics. KEGG analysis showed that the Allograft rejection signaling pathway was significantly enriched during reperfusion injury, indicating that the innate immune response was significantly activated in the process of KIRI. GO functional annotation showed that biological functions such as Immune response, Extracellular region part, Extracellular space, and Extracellular region were significantly enriched, suggesting that LRG-1 may be involved in regulating the formation of extracellular-related components of macrophages, thereby promoting the pro-inflammatory function of macrophages and aggravating the progression of KIRI ( Figure 4 A). Recent studies have shown that METs are an important activation form of macrophages that induce immune inflammation in diseases such as acute kidney injury. It is worth noting that the applicant also observed a large number of METs in the kidney tissue of the KIRI model in the early stage ( Figure 4 B). Therefore, we speculate that the effect of LRG-1 on the pro-inflammatory function of macrophages may be related to regulating the formation of METs.

[0109] Therefore, we performed correlation analysis between LRG-1 and the mRNA levels of F4 / 80, Mac-1, MPO, and MMP12. The results showed that LRG-1 was significantly correlated with macrophages and their METosis markers, suggesting that LRG-1 may be involved in the formation of macrophage METs ( Figure 5 A).

[0110] Furthermore, the present application used immunofluorescence multi-label staining (LRG-1, CitH3, F4 / 80 and DAPI) technology to verify the renal tissues of Lrg1-KO-KIRI and KIRI model mice. The results showed that a large number of macrophages METs and LRG-1 co-expression were observed in the renal tissues of KIRI model mice, while there was almost no macrophage METs in Lrg1-KO-KIRI mice ( Figure 5 B), and the protein level of METs-related marker (MMP12) in the serum of LRG1-KO model mice was significantly reduced ( Figure 5 C). Furthermore, the applicant previously constructed a J774A.1-AAV9-LRG1 overexpression cell line, collected the cell culture medium of the overexpression cells and the control group cells under HR conditions, co-incubated the bone marrow mononuclear macrophages with the collected conditioned medium in vitro, and detected MMP12 by flow cytometry 8 hours later. + F4 / 80 + The results showed that LRG-1 could significantly induce the expression of MMP12 in macrophages ( Figure 5 D). The results of this study revealed that the driving effect of LRG-1 on KIRI may be related to its induction of METs formation. The above in vivo experiments showed that after LRG-1 knockout, the number of macrophages in mouse kidney tissue was significantly reduced. So does LRG-1 regulate the recruitment of macrophages carrying METs to the inflammatory sites of kidney tissue? The applicant collected the conditioned medium (CM) of J774A.1-AAV9-LRG1 cells after hypoxia and reoxygenation and acclimated mononuclear bone marrow macrophages for 8 hours to induce the formation of macrophage METs, and then co-cultured the macrophages carrying METs with J774A.1-AAV9-LRG1 cells in a Transwell system for 2 hours for chemotaxis experiments. The results showed that J774A.1-AAV9-LRG1 cells had a significant chemotactic effect on macrophages carrying METs ( Figure 5 E), suggesting that LRG-1 promoting KIRI progression is related to the formation of METs and the recruitment of METs-related macrophages, and the specific molecular mechanism still needs to be further explored.

[0111] Based on the above research results, we used the LRG-1 receptor endoglin to screen the FDA's drug library and selected zafirlukast from several drugs with significant affinity to endoglin.

[0112] The molecular simulation diagram between zafirlukast and the LRG-1 receptor endoglin is shown in the figure below: Figure 6 The results showed that zafirlukast had hydrogen bonds with residues such as LYS157, ALA323, and PRO434 of endoglin, and had hydrophobic interactions with amino acid residues such as ALA26, ILE59, PRO434, PRO437, GLY436, VAL604, and PRO60. In addition, no salt bridge or electrostatic effects were involved.

[0113] Next, we further verified the application of zafirlukast in the preparation of drugs for the treatment of acute kidney injury.

[0114] Example 5 Use of zafirlukast in the preparation of a medicament for treating acute kidney injury.

[0115] Eight-week-old male C57BL / 6 mice (N=24) were divided into four groups: Sham+saline (n=6), Sham+zafirlukast (Sham+ZFK, n=6), KIRI+saline (n=6), and KIRI+zafirlukast (KIRI+ZFK, n=6). The mice in the Sham+ZFK and KIRI+ZFK groups were pretreated with ZFK (ischemia for 40 min, reperfusion for 24 h); Zafirlukast (10 mg / kg). The specific test results are shown in Table 1. Figure 7 and Figure 8 As shown. The results showed that ZFK effectively improved KIRI-induced renal tubular epithelial cell damage; in addition, ZFK had no effect on renal tissue pathological damage in sham-operated mice. At the same time, ZFK effectively reduced KIRI-induced increases in serum creatinine and urea nitrogen, and basically reached normal levels; in addition, ZFK had no significant effect on serum creatinine and urea nitrogen in sham-operated mice.

[0116] Next, we further explored whether ZFK improves KIRIs by inhibiting the infiltration and activation of macrophages. Therefore, we used flow cytometry to detect the effect of ZFK on renal macrophages. Fig. 9 As shown, ZFK significantly reduced the number of renal macrophages.

[0117] Further results showed that ZFK could significantly inhibit the levels of inflammatory factors such as IL-1β, IL-6 and TNF-α in kidney tissue. Fig.10 shown.

[0118] At the same time, we detected the effect of ZFK on the formation of METs. Fig.11 As shown, ZFK significantly inhibited the gene and protein levels of METs-related markers (CCL2, MMP2, MMP9, PAD4).

[0119] Furthermore, we used RAW264.7 macrophages in vitro to verify the effect of ZFK on METs formation. To simulate macrophage METosis under ischemic and hypoxic conditions, RAW264.7 cells were treated with cobalt chloride (CoCl2) and serum-free medium. Fig.12 As shown, CoCl2 and serum-free medium led to a significant increase in CitH3, a classic biomarker for METs, compared with the control group. ZFK pretreatment significantly alleviated METosis compared with the cobalt chloride and serum-free medium treatment groups, as indicated by a significant decrease in the expression of CitH3 in immunofluorescence staining.

[0120] In addition, based on the effective KIRI therapeutic effect of ZFK, we analyzed the gene expression profile of ZFK and tacrolimus, a first-line drug in clinical renal transplantation, by transcriptome sequencing. Fig.13 A total of 1,437 genes were identified as significantly different between the ZFK-treated group and the KIRI group (P<0.05, log2FC>1 or <-1). A total of 266 genes were identified as significantly different between the tacrolimus-treated group and the KIRI group (P<0.05, log2FC>1 or <-1). FK has a similar effect as Tacrolimus in improving KIRI.

[0121] Furthermore, KEGG signaling pathway enrichment analysis was performed on the down-regulated differentially expressed genes after treatment with Zafirlukast and Tacrolimus. Fig.14 As shown, the signaling pathways that improve KIRI by both are mainly enriched in IL-17, TNF-α, DNA synthesis, immune cell infiltration and chemokine release, indicating that ZFK has a similar effect as Tacrolimus in improving KIRI.

[0122] The present invention provides an application idea and method of zafirlukast in the preparation of a drug for treating acute kidney injury. There are many methods and approaches to specifically implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the scope of protection of the present invention. All components not specified in this embodiment can be implemented using existing technologies.

Claims

1. Use of an antagonist targeting LRG-1 in the preparation of a drug for treating acute kidney injury.

2. The use according to claim 1, characterized in that: The antagonists block the binding of LRG-1 to its receptor, endoglin.

3. The use according to claim 1, characterized in that: The antagonist is zafirlukast.

4. The use according to claim 1, characterized in that: The acute kidney injury is renal ischemia / reperfusion injury.

5. The use according to claim 3, characterized in that: Zafirlukast reduces serum creatinine and urea nitrogen levels in mice with renal ischemia / reperfusion injury.

6. The use according to claim 3, characterized in that: Zafirlukast reduces inflammatory cell infiltration and tissue damage.

7. The use according to claim 3, characterized in that: Zafirlukast inhibits the formation of macrophage METs in renal tissue of renal ischemia / reperfusion injury model.

8. The use according to claim 3, characterized in that: Zafirlukast inhibits the expression of CitH3 histone in renal tissue of renal ischemia / reperfusion injury model.

9. The use according to claim 3, characterized in that: Use of zafirlukast in preparing a drug for treating diseases mediated by macrophage METs.

10. The use according to claim 1 or 3, characterized in that: The dosage form of the drug is capsule, powder, tablet, granule, pill, injection, syrup, oral solution, inhalant, ointment, suppository or patch.

Images