Artificial recognition / response structure of intelligent medicine capable of accurately deploying endostatin at Her2 positive tumor site

Abstract

The invention provides an artificial recognition / response structure of an intelligent drug capable of accurately deploying endostatin at a Her2 positive tumor site, and belongs to the technical field of biology. The artificial recognition / response structure comprises a recognition structure penetrating through a cell membrane of the mesenchymal stem cell and a response structure in a cell nucleus; the recognition structure comprises an affinity (Affibody) located outside a cell membrane, a core structural domain of Notch protein and VP64 located in the cell membrane; the response structure comprises a response sequence and a promoter sequence, endostatin can be accurately deployed to a Her2 positive tumor site, and existence of drugs in non-tumor sites can be avoided, so that toxic and side effects of the drugs are reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an artificial recognition / response structure of an intelligent drug capable of accurately deploying endostatin at Her2-positive tumor sites. Background Art

[0002] Endostatin is derived from the 21 amino acids at the C-terminus of type XVIII collagen and is considered to be the most effective endogenous angiogenesis inhibitor. In the field of cancer treatment, the application of endostatin shows great promise. As a powerful angiogenesis inhibitor, endostatin can inhibit tumor angiogenesis by inhibiting the proliferation and migration of endothelial cells and blocking angiogenesis signaling pathways. The combination of endostatin and chemotherapy drugs has achieved remarkable results in the treatment of lung cancer, breast cancer, ovarian cancer and lymphoma.

[0003] However, the biological half-life of endostatin is relatively short (about 8-10 hours), and treatment usually requires 2-4 cycles, each lasting about 14 days. In addition, endostatin is easily distributed in all tissues, and more than 90%-95% of endostatin accumulates in normal tissues and organs. Endostatin distributed in normal tissues and organs may have potential adverse effects on patients, and cardiotoxicity is the main side effect of endostatin. According to the clinical medication instructions for endostatin, about 6.38% of patients may experience varying degrees of cardiac adverse reactions during treatment, especially about 2.1% of patients have to terminate treatment due to cardiac reactions. Considering the potential cardiac risks of endostatin, this therapy may not be suitable for patients with existing heart disease. Recent studies have emphasized that patients with both tumors and heart disease may have a significantly increased risk of death from heart disease. Therefore, there is an urgent need to develop an effective endostatin application method to meet the needs of tumor patients with heart disease and endostatin intolerance (accounting for 2.1‰ of the population). Antibody-drug conjugates and cell carriers are generally considered to be effective methods for enhancing drug targeting and reducing adverse drug reactions.

[0004] However, the classical antibody-drug conjugate targeting approach usually lacks the chemotaxis ability to the tumor site, inevitably leading to the large accumulation of drug molecules in healthy tissues and organs. The toxic structures exposed on the surface of the fused drug may damage healthy tissue cells, which may lead to toxicity. In recent years, cell carriers, as an emerging targeting mode, have attracted great attention due to their low immunogenicity and disease targeting ability. For example, biological carrier platforms, such as mesenchymal stem cells (MSCs), bacteria, and platelets, can recognize tumor-released cytokines through chemokine receptors on the cell membrane surface to deliver drugs to the tumor site. Unfortunately, the microenvironment of many diseases may have similar characteristics to the tumor microenvironment. For example, in viral myocarditis, similar to the tumor microenvironment, the chemokine CCL4 is overexpressed. Since the initial function of these cell-carrying platforms is not to identify the tumor microenvironment, they may have difficulty in effectively distinguishing the source of chemokines, which may cause these transport platforms to deviate from their targets or lose direction during the metastasis process. In addition, in the early stages of tumorigenesis, when the characteristics of the tumor microenvironment are not obvious, it is also difficult to identify the tumor microenvironment because it is difficult to determine the tumor function. Furthermore, due to inconsistent expression of chemokine homing receptors carried by the cells and lack of restriction in the expression of endothelial adhesion molecules, most cells are enclosed in pulmonary capillaries and are unable to metastasize to lesions.

[0005] We believe that the traditional targeting paradigm faces challenges of low efficiency and lack of intelligence, and therefore it may not be the best strategy to reduce endostatin-related cardiotoxicity. If a drug can be endowed with simple "intelligence" that allows it to autonomously distinguish / judge tumor cells from healthy tissue cells and deliver the drug specifically to the tumor site, this may be a more effective means. This approach may be preferable to approaches that aim to enhance affinity for tumors or rely on imprecise and inadequate homing effects of cells. Summary of the invention

[0006] In view of this, the present invention provides an artificial recognition / response structure of an intelligent drug that can accurately deploy endostatin at Her2-positive tumor sites, which can deploy endostatin only to Her2-positive tumor sites, avoid the presence of endostatin in non-tumor sites, and thus reduce the side effects of endostatin.

[0007] In order to solve the above technical problems, the specific solutions of the present invention are as follows: An artificial recognition / response structure of an intelligent drug capable of precisely deploying endostatin at the site of a Her2-positive tumor, wherein the artificial recognition / response structure is located in a mesenchymal stem cell, and the artificial recognition / response structure comprises a recognition structure that runs through the cell membrane of the mesenchymal stem cell and a response structure in the cell nucleus; The recognition structure includes an Affibody located outside the cell membrane, a core domain of the Notch protein, and VP64 located inside the cell membrane; The response structure includes a response sequence and a promoter sequence.

[0008] Preferably, the mesenchymal stem cells of the intelligent drug are umbilical cord mesenchymal stem cells.

[0009] Preferably, the artificial recognition structure includes an Affibody outside the cell membrane, a core domain of the Notch protein, and VP64 located inside the cell membrane.

[0010] Preferably, the response structure includes a response sequence and a promoter sequence.

[0011] Preferably, the protein expressed by the response sequence is human endostatin.

[0012] Preferably, the promoter is Gal4 DBD (GGAGCACTGTCCTCCGAACG).

[0013] The improvement of the present invention is that Her2-positive tumor cells are recognized by the affinity body outside the cell membrane, and the corresponding affinity body transmits the signal from the outside of the cell to the VP64 inside the cell through the transmembrane core domain of the Notch protein, thereby regulating a series of reactions inside the cell. After receiving the signal, VP64 located in the cell membrane will enter the cell nucleus to drive the response structure. After entering the cell nucleus, VP64 will bind to the promoter structure of the response structure in the cell nucleus, and then the endostatin on the response sequence will be expressed.

[0014] In summary, compared with the prior art, the present application has at least one of the following beneficial technical effects: The improvement of the present invention is that, in view of the lack of Her2 protein stimulation signals in normal tissues, intelligent drugs default these cells to normal tissue cells and do not activate artificial recognition / response structures. Her2-positive tumor cells highly express Her2 protein, so intelligent drugs can recognize this structure and accurately release endostatin at the tumor site. 2. Compared with traditional targeting strategies, intelligent drugs have several obvious characteristics. First, intelligent drugs are a drug formulation with simple "intelligence". Its intelligence is reflected in the recognition and distinction between tumor cells and healthy tissue cells. By reshaping cell behavior, intelligent drugs can convert recognized tumor signals into drug production / secretion, establishing a logical connection between the two. This allows intelligent drugs to deploy endostatin only at the tumor site, thereby limiting / locking treatment and drug toxicity to the tumor site. Therefore, even if the biological barrier can isolate drugs outside the lesion, unactivated intelligent drugs in healthy tissues will not deploy any drug molecules. The pursuit of defense is the core advantage of intelligent drugs, which is different from traditional targeting strategies, which focus on increasing drug concentrations within lesions; intelligent drugs focus more on avoiding the presence of endostatin in healthy tissues. Secondly, smart drugs consist of MSCs and artificial recognition / response structures. The advantage of MSCs is that they can home to tumors like T cells, but unlike T cells, they can avoid tumor-induced immunosuppression blockade. In addition, the artificial recognition / response structure in smart drugs operates independently of the original structural proteins of the cell, freeing it from the limitations of the MSC endogenous system. The expression / secretion of endostatin in smart drugs is only regulated by the tumor signals received by the smart drugs. Finally, smart drugs are both a drug and a "drug factory". Therefore, once the recognition of the tumor is completed, it can continue to produce and secrete endostatin at a high yield, which can greatly shorten the treatment cycle and frequency.

[0015] In general, the introduction of intelligent drugs with artificial recognition / response structures is a new design concept that opens up a new direction for the targeted treatment of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Design schematics of intelligent drugs; Figure 2 Intelligent drug recognition map for Her2-positive tumors; Figure 3 Intelligent drugs distinguish tumor and normal tissue cell maps; Figure 4 Intelligent drug production / deployment Endostatin diagram; Figure 5 Dynamic display of intelligent drug identification and deployment; Figure 6Quantitative analysis of intelligent drug deployment and endostatin production capacity; Figure 7 Intelligent drug inhibition of angiogenesis in vitro; Figure 8 Intelligent drugs recognize Her2-positive tumor cells in vivo and show their anti-tumor effects; Fig. 9 Intelligent drug-induced cardiotoxicity detection map. DETAILED DESCRIPTION

[0017] To make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the following will be combined with the appended drawings of the embodiments of the present invention. Figure 1-9 , the technical scheme of the embodiment of the present invention is clearly and completely described. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field belong to the scope of protection of the present invention.

[0018] The data and experimental basis involved in the embodiments of the present invention are specifically described and organized below.

[0019] Experiment 1: Establishment of intelligent drugs and fluorescently labeled cells Notch (core) in the smart drug is derived from mouse Notch1 (nm_008714; Ile1427 to Arg1752). The SA sequence in both the smart drug and endostatin is MALPVTALLPLALLLHAARP. The C-myc sequence is EQKLISEEDL. BT474-GFP, Skov3-GFP, 293T-GFP, BJ-GFP, L02-GFP, Svog-GFP, HUVECs-GFP, and AC16-GFP cells were lentivirally labeled with GFP.

[0020] Experiment 2: Immunofluorescence and Western Blot Human breast cancer tissue: Sections were permeabilized with 0.5% Triton X-100 and blocked with 10% goat serum. The primary antibodies were rat anti-human Her2 (MA1-82367; Invitrogen), mouse anti-human mmp-2 (AB3284; Abways), and rabbit anti-human mmp-9 (MA5-32705; Invitrogen). Secondary antibodies were goat anti-rat Cy5-labeled, mouse anti-mouse FITC-labeled, and goat anti-rabbit Cy3-labeled IgG.

[0021] Intelligent drugs: The permeabilization and blocking process were the same as above. The primary antibody was mouse-derived c-myc tag (AB0001; Abways). The secondary antibody was goat anti-mouse FITC-labeled IgG.

[0022] WB (Western Blotting): Protein samples were denatured in a 95°C metal bath and blocked with 5% skim milk powder. The primary antibodies were rabbit anti-c-myc (ab56; Abcam), rabbit anti-Cyclin B1 (ET1608-27; HUABIO), rabbit anti-CDK2 (ET1602-6; HUABIO), rabbit anti-PCNA (ET1605-38; HUABIO), and mouse anti-GAPDH (60004-1; Proteintech). The secondary antibodies were goat anti-mouse IgG-HRP and goat anti-rabbit IgG-HRP.

[0023] Experiment 3: Intelligent drugs identify Her2-positive tumors Smart drugs were co-cultured with BT474-GFP, Skov3-GFP, 293T-GFP, BJ-GFP, L02-GFP, Svog-GFP, HUVECs-GFP, and AC16-GFP cells in DMEM medium for 24 h. Subsequently, confocal microscopy, live cell imaging, and flow cytometry analyses were performed.

[0024] Experiment 4: Qualitative and quantitative analysis of endostatin production Fluorescence analysis: Smart drugs and Skov3-GFP were seeded into 24-well plates coated with fibronectin and co-cultured at different time points (15 minutes, 12 hours, 24 hours, 36 hours, and 48 hours). Subsequently, the cells were fixed with 4% paraformaldehyde (PFA) and the cells with fluorescence changes were imaged under a microscope.

[0025] Enzyme-labeled detection: Intelligent drugs and Skov3-GFP were co-cultured, and the mCherry signal in the culture medium was detected at 15 minutes, 12 hours, 24 hours, 36 hours, and 48 hours. Alternatively, the intelligent drugs were co-cultured with Skov3-GFP for 48 hours, and the mCherry signal was detected every 4 hours.

[0026] ELISA: MSCs or smart drugs were co-cultured with Skov3-GFP for 48 hours, MSCs and smart drug cells were selected by flow cytometry, and inoculated in 24-well plates coated with fibronectin for 24 hours. The content of endostatin was detected using an ELISA detection kit.

[0027] Experiment 5: Detection of endothelial cell viability Skov3h or AC16 cells were co-cultured with intelligent drugs for 48 hours using a 1:1 mixture of DMEM and ECM medium. The conditioned medium was then collected and concentrated 5-fold using ultracentrifuge tubes.

[0028] CCK-8: 8×10^3 HUVECs were added to a 96-well plate and cultured in different conditioned medium for 48 hours. Cell viability was detected using the CCK-8 method.

[0029] CD105&WB: HUVECs were cultured in 6-well plates with different conditioned media for 48 hours. Flow cytometry was performed after incubation with CD105-Fitc for 30 minutes. Alternatively, the expression of C-myc, Cyclin B1, CDK2 and PCNA was detected by WB.

[0030] Experiment 6: Tubule formation assay and Matrigel plug assay Tubule formation assay: HUVECs cells were cultured in the above conditioned medium for 24 hours. Subsequently, 50 µL of Matrigel was added to each well of a 96-well plate, and HUVECs cells were incubated with the corresponding conditioned medium for 6 hours. HUVECs cells were fluorescently stained and imaged using a fluorescence microscope.

[0031] Matrigel plug assay: 200 µL Matrigel containing 50 µg bFGF was mixed with the above conditioned medium and transplanted subcutaneously into female Balb / c nude mice. After 9 days, Matrigel was collected for sectioning and CD34 staining.

[0032] Experiment 7: Intelligent drugs recognize and anti-tumor effects on Her-positive tumors in vivo Lung metastasis model: 2×106 Emt-6-GFP cells were injected into female Balb / c mice via the tail vein. On day 3 after colonization, 3×10^6 intelligent drug cells were injected via the tail vein. After 48 hours, samples were collected, sliced ​​and imaged with a confocal microscope.

[0033] Solid tumor model: 1×106 Emt-6-GFP cells were transplanted subcutaneously into mice, and 3×106 smart drug cells were transplanted via the tail vein on day 11. After 48 hours, tumors were harvested, sectioned and imaged with a confocal microscope.

[0034] Anti-tumor experiment: 1×106 Emt-6 cells were subcutaneously transplanted into mice. Subsequently, 3×106 smart drugs or MSCs were transplanted through the tail vein on days 4, 7, and 10, respectively. Tumors were collected on day 14.

[0035] Experiment 8: Cardiotoxicity test On day 14, the above solid tumor-bearing mice were subjected to electrocardiogram (ECG) testing, serum was extracted for myocardial enzyme testing, and the hearts were stained with hematoxylin and eosin (HE).

[0036] Embodiment 1 This embodiment is aimed at the construction and combination of intelligent release carrier Figure 1 Describe in detail.

[0037] The mesenchymal stem cells used in the intelligent drug are umbilical cord mesenchymal stem cells, and an artificial recognition / response structure is constructed for the surface antigen protein of Her2 cancer cells.

[0038] This embodiment aims to design a smart drug that can recognize / distinguish normal tissue cells from Her2(+) tumor cells and selectively release the drug (endostatin) only at the tumor site. Her2 protein is a common clinical marker of malignant tumors, often accompanied by upregulation of matrix metalloproteinase (MMP)-2 and MMP-9, thereby promoting tumor proliferation and metastasis. Natural Notch protein consists of three parts: an extracellular domain, an intracellular domain, and a transmembrane domain. Previous studies have confirmed that the Notch protein can still perform Notch-like functions even if its extracellular and intracellular domains are replaced. Based on this principle, in order to endow intelligent drugs with intelligence and the ability to recognize HER2(+) tumors, we retained the core region of Notch protein (nm_008714; Ile1427 to Arg1752), replaced its extracellular and intracellular domains with Her2 affibody and VP64, and introduced CD8 signal peptide (SP, MALPVTALLPLALLHARP) and C-myc tag (EQKLISEEDL) at the N-terminus of Her2-affibody in sequence. Subsequently, in order to enable the intelligent drug to express endostatin, we designed a Gal4-endostatin structure in the response structure and added a BFP tag. VP64 and Gal4 in the intelligent drug can connect the recognition and response structures and convert tumor signals into signals related to the expression and secretion of endostatin. Since the core region of the natural Notch protein is retained in this scheme, when the intelligent drug recognizes Her2(+) tumors, the γ-secretase in the cell can act on the S3 hydrolysis site in the core region, causing VP64 to dissociate from the recognition structure and bind to the promoter in the response structure, thereby allowing the intelligent drug to express endostatin. Figure 1 The green fluorescence and blue fluorescence in C represent the recognition structure and response structure of the intelligent drug, respectively, and together constitute the intelligent driving reaction scheme of the intelligent drug. Embodiment 2 This example aims to verify the ability of smart drugs to recognize Her2(+) tumors. The IRES structure in the smart drug ensures the co-expression of endostatin and mCherry. When the smart drug recognizes the tumor, the cell will show red fluorescence (mCherry). To evaluate the ability of smart drugs to recognize Her2(+) tumors, two co-culture systems were established: BT474 (human breast cancer) - smart drug and Skov3 (human ovarian cancer) - smart drug. The results showed that the smart drug showed extraordinary recognition ability for Her2(+) tumor cells ( Figure 2 AC). In the BT474-intelligent drug co-culture system, the intelligent drug that recognized BT474 (red) tightly surrounded the tumor cell cluster area, while the inactivated intelligent drug that was not recognized (blue) appeared in the unrecognized area ( Figure 2 A and B). Similarly, in the Skov3-smart drug co-culture system, smart drugs that recognized Skov3 showed a distribution pattern similar to that of tumors ( Figure 2 C). To further verify the recognition reliability of the smart drug, we separated the tumor area and non-tumor area in a macroscopic field of view with a diameter of 20 mm. As expected, the smart drug was able to accurately distinguish between tumor and non-tumor sites and achieved the unique release of endostatin in the tumor area (red) ( Figure 2 D). Subsequent flow cytometry indirectly confirmed the superior recognition ability of the intelligent drug for Her2(+) tumors ( Figure 2 E).

[0039] Embodiment 3 This example aims to verify that the intelligent drug can not only identify tumors, but also distinguish tumor tissues from normal tissue cells. To verify this feature, two types of tumor cells (breast cancer and ovarian cancer) and four types of normal tissue cells (kidney, skin, liver and ovary) were co-cultured with the intelligent drug. The results showed that the intelligent drug can accurately distinguish tumors from normal tissue cells and is only activated in Her2(+) tumor cells, while having no response to the four normal tissue cells ( Figure 3 A).

[0040] Since the main side effect of endostatin is cardiotoxicity, the release of endostatin in the heart must be prevented. Considering the structure of the heart, cardiomyocytes (AC16) and vascular endothelial cells (HUVECs) were selected for co-culture with intelligent drugs. The results showed that neither AC16 nor HUVECs could activate intelligent drugs ( Figure 3 B).

[0041] Biological barriers prevent a large amount of drugs from reaching the tumor site, causing the drugs to be distributed in lesions and healthy tissues respectively. The ability of intelligent drugs to identify and distinguish tumor and normal tissue cells lays the foundation for the precise release of endostatin at the tumor site, thereby avoiding the toxic effects of drugs in healthy tissues and organs.

[0042] Embodiment 4 This example aims to verify that the drug released by the smart drug after recognizing the tumor is endostatin. Endostatin is a 20 kDa proteolytic fragment of the C-terminal non-collagenous domain (NC1) of type 18 collagen. Natural endostatin lacks a signal peptide structure. The deployment ability of a smart drug refers to its secretion of the produced endostatin outside the cell. Therefore, we reconstructed the SP structure of endostatin in the smart drug. To verify the ability of the smart drug to produce and deploy endostatin, we removed mCherry from the response structure and fused it to the N-terminus of endostatin (smart drug) ( Figure 4 A). In this structure, the red fluorescent signal will represent the endostatin produced by the smart drug, and subsequent confocal imaging confirms the production capacity of the smart drug ( Figure 4 B) Through Figure 4 B Local 3D imaging further demonstrated the phenomenon of intelligent drug secretion and deployment of endostatin-mCherry ( Figure 4 C).

[0043] Subsequently, live cell workstation imaging also dynamically demonstrated the excellent recognition ability of intelligent drugs for Her2(+) tumor cells and the deployment of endostatin around tumors ( Figure 5 A and Video S1). To more intuitively demonstrate the ability of smart drugs to secrete endostatin, we Figure 4 C performed 3D model fluorescence intensity imaging ( Figure 5 B). Figure 5 The strong signal peak and weak signal peak in B correspond to the intracellular endostatin-mCherry that has not been secreted and the secreted extracellular endostatin-mCherry, respectively. After washing with PBS, these weak signal peaks disappeared in the endostatin-Skov3 co-culture system, confirming that these weak signal peaks come from the endostatin secreted by the smart drug to the extracellular space ( Figure 5 B).

[0044] Embodiment 5 This example indirectly evaluates the therapeutic potential of smart drugs by quantitatively analyzing their ability to produce and deploy endostatin. Since the IRES structure in the smart drug enables the co-expression of endostatin and mCherry genes, the cumulative red fluorescence intensity in the smart drug will reflect the expression of endostatin. Through fluorescence imaging of the co-culture system of smart drugs and Her2(+) tumor cells, we concluded that the smart drug can start producing endostatin within 12 hours after recognizing Her2(+) tumor cells, and reach a peak at 48 hours ( Figure 6 A). This conclusion is further supported by the strong accumulation of endostatin-mCherry every 12 hours in the culture medium of the intelligent drug-Her2(+) tumor cell co-culture system ( Figure 6 B).

[0045] Furthermore, once endostatin production reached its peak, the smart drug could continue to produce endostatin steadily, and similar amounts of endostatin-mCherry were secreted into the culture medium every four hours ( Figure 6 C). Given the similar structural domains of natural type 18 collagen and endostatin, in order to determine the concentration of endostatin, we subtracted the signal of the primary MSC group from the ELISA signal of the smart drug group to exclude the interference of type 18 collagen. The results showed that every 5×10^4 activated smart drug cells produced approximately 0.62 pg of endostatin every 24 hours ( Figure 6 D). It is noteworthy that in clinical practice, the number of stem cells injected intravenously can reach hundreds of millions, and these cells can survive for more than 6 months in animal models.

[0046] Smart drugs release drug molecules in specific response to received tumor signals, which will lock the drug's toxicity at the tumor site. Although the process of smart drugs processing tumor signals is a slow response, after full activation, it can continuously and selectively produce high yields of endostatin at the tumor site.

[0047] Embodiment 6 This example aims to verify the anti-tumor activity (mainly inhibiting angiogenesis) of smart drugs (endostatin in this article), which originates from drug proteins expressed by responsive structures. In in vitro experiments, smart drug-Her2(+) tumor cells and smart drug-AC16 cells (cardiomyocytes) co-culture systems simulated the activation (recognition) of smart drugs at tumor sites and the inactive (unrecognized) states of smart drugs in healthy tissues, respectively. In CCK-8 assays, we observed that only activated smart drugs that recognized tumors could inhibit the activity of vascular endothelial cells, while smart drugs that were not activated by cardiomyocytes (non-tumor cells) had no significant effect on the activity of vascular endothelial cells ( Figure 7 A).

[0048] CD105 is highly expressed in remodeled or newly formed blood vessels, and can accurately reflect the proliferation status of endothelial cells. It is a typical marker for evaluating the proliferation of vascular endothelial cells. Flow cytometry showed that only activated smart drugs significantly inhibited the expression of CD105 in HUVECs ( Figure 7 B and C), WB (Western Blotting) experiments obtained consistent results ( Figure 7 D and E).

[0049] In addition, the tube formation experiment is an important experiment to simulate in vitro angiogenesis. Our results further demonstrated that the coverage area, total number of branch points, total tube length and total number of tubes in the activated smart drug group were significantly lower than those in the control group ( Figure 7 FJ), which strongly indicates that the activated smart drug significantly inhibited angiogenesis in vitro. Similarly, in the subsequent matrix gel plug experiment, the fluorescence area of ​​CD34+ cells in the activated smart drug group was also significantly lower than that in the control group ( Figure 7 K and L).

[0050] The intelligent drug used in the above embodiment is called iMSC Endostatin .

[0051] In summary, cell sensing / response pathways customized for smart drugs enable them to autonomously sense user-specified disease or injury signals and selectively deploy therapeutic functions at the tumor site.

[0052] Embodiment 7 This example aims to verify the ability of intelligent drugs to recognize Her2(+) tumor cells in vivo and inhibit tumor growth. Intelligent drugs are based on MSCs, and previous studies have shown that the chemotaxis of MSCs enables them to sense chemotactic signals and penetrate into tumor tissues. In order to verify the effectiveness of intelligent drugs in recognizing Her2(+) tumor cells and inhibiting tumor growth in vivo, we established a solid Her2(+) tumor and lung metastasis model. The results showed that even in the in vivo environment, the intelligent response program of the intelligent drug is still effective, enabling it to recognize Her2(+) tumors and release endostatin ( Figure 8 AC). In addition, only a small number of cells are needed to fully activate the smart drug ( Figure 8 D). This may enable intelligent drugs to play an advantage in micro-metastatic lesions. After the intelligent drug was transplanted, the tumor weight of the model mice ( Figure 8 F), volume ( Figure 8 E and G) and vascular density ( Figure 8H and I) were significantly inhibited. However, since natural MSCs do not contain the intelligent response program that drives endostatin, they are unable to inhibit angiogenesis and tumor progression ( Figure 8 EI). More importantly, consistent with our design expectations, no significant cardiotoxicity was observed during intelligent drug treatment. Fig. 9 A) Serum myocardial enzyme concentration ( Fig. 9 BD)、ECG( Fig. 9 E) and heart rate ( Fig. 9 F) There was no significant difference compared with the control group.

[0053] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An artificial recognition / response structure of an intelligent drug capable of precisely deploying endostatin at the site of Her2-positive tumors, characterized in that: The artificial recognition / response structure is located in the umbilical cord mesenchymal stem cells, and the artificial recognition / response structure includes a recognition structure that runs through the cell membrane of the umbilical cord mesenchymal stem cells and a response structure in the cell nucleus; The recognition structure includes an Affibody located outside the cell membrane, a core domain of the Notch protein, and VP64 located inside the cell membrane; The response structure includes a response sequence and a promoter sequence.

2. According to claim 1, an artificial recognition / response structure of an intelligent drug capable of accurately deploying endostatin at the site of Her2-positive tumors, characterized in that: The mesenchymal stem cells of the intelligent medicine are umbilical cord mesenchymal stem cells.

3. According to claim 1, an artificial recognition / response structure of an intelligent drug capable of accurately deploying endostatin at the site of Her2-positive tumors, characterized in that: The artificial recognition structure includes an Affibody outside the cell membrane, a core domain of the Notch protein, and VP64 located inside the cell membrane.

4. The artificial recognition / response structure of an intelligent drug capable of accurately deploying endostatin at the site of Her2-positive tumors according to claim 1, characterized in that: The response structure includes a response sequence and a promoter sequence.

5. The artificial recognition / response structure of an intelligent drug capable of accurately deploying endostatin at the site of Her2-positive tumors according to claim 4, characterized in that: The protein expressed by the response sequence is human endostatin.

6. The artificial recognition / response structure of an intelligent drug capable of accurately deploying endostatin at the site of Her2-positive tumors according to claim 4, characterized in that: The promoter is Gal4 DBD (GGAGCACTGTCCTCCGAACG).

Images