Preparation and application of self-assembled glycopeptide nanoparticles for mRNA vaccine delivery

Abstract

The invention belongs to the technical field of biological medicine, and particularly discloses preparation and application of self-assembly glycopeptide nanoparticles for mRNA vaccine delivery, and the nanoparticles are formed by self-assembly of glycopeptide carriers, mRNA and manganese ions. In the preparation process of the nanoparticles, manganese ions are adsorbed to tryptophan and histidine through metal chelation, and the adjuvant effect of activating a cGAS-STING pathway is achieved after administration. The nanoparticle can effectively adsorb mRNA, can stably exist at 4 DEG C for 4 weeks, can protect mRNA from enzymatic degradation, can promote mRNA internalization and lysosome escape, can effectively transfect eGFP-mRNA and Flucc-mRNA in DC2.4 and BMDC cells, can effectively deliver mRNA to lymph nodes in a targeted manner, activates a cGAS-STING pathway, effectively activates a specific immune system in a B16F10-OVA prevention model, delays tumor growth, and can be used for preparing a drug for preventing cancer. The mouse life cycle is prolonged.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the preparation and application of self-assembled glycopeptide nanoparticles for mRNA vaccine delivery. Background Art

[0002] In recent years, mRNA vaccines have become an increasingly popular means of treating infectious diseases or cancer. mRNA vaccines have the following advantages: high efficiency, high potential for rapid development, low-cost manufacturing, and safe administration. Since mRNA is easily degraded and needs to be expressed in the cytoplasm, effective mRNA delivery and expression are crucial. However, for mRNA delivery vectors, targeted delivery and lysosomal escape remain challenging, highlighting the need for safe and effective mRNA delivery materials.

[0003] A variety of materials have been developed for mRNA delivery, including lipids, lipid-like materials, polymers, and protein derivatives. Lipid nanoparticles (LNPs) can be widely used to deliver small molecules, siRNA, and mRNA and have successfully entered the clinic, but their lack of targeting ability can cause inflammatory responses in non-immune cells and organs (such as the liver and kidneys), posing a significant safety risk. For mRNA cancer vaccines, targeted delivery to lymphoid organs is a promising strategy to improve efficacy and reduce side effects. Peptide-based delivery vehicles have been widely studied, and self-assembling peptides (SAPs) composed of amino acids can spontaneously form nanoparticles, are very suitable for structural modification, and exhibit high biosafety. Although previous studies have reported the use of SAPs to deliver mRNA, they are limited by defects such as poor targeting and expression efficiency.

[0004] The above problems can be solved by structural modification and introduction of adjuvants to enhance the targeting ability and immunostimulatory efficacy of SAPs. Adjuvants are key components for inducing and enhancing the breadth, amplitude and persistence of immune responses. Alum, as the most widely used adjuvant, can effectively induce strong humoral immune responses and CD4 + T cell responses but failed to induce CD8 + T cell response. The results showed that Mn 2+ It is a novel agonist of the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway and has the potential to be used as an adjuvant, especially for enhancing cellular immune responses. 2+ The nonspecific distribution of Mn limits the therapeutic effect and makes 2+ It tends to accumulate in the brain and spinal cord, causing neurotoxicity. Mn can be effectively adsorbed in suitable carriers. 2+ is an indispensable prerequisite for fully utilizing its immune adjuvant function, but this remains a challenge to be solved. Summary of the invention

[0005] In order to solve the above technical problems, the present invention proposes the preparation and application of self-assembled glycopeptide nanoparticles for mRNA vaccine delivery.

[0006] The self-assembling glycopeptide nanoparticles for mRNA vaccine delivery of the present invention, wherein the nanoparticles are self-assembled from glycopeptide carriers, mRNA and manganese ions to form Man-MPm nanoparticles, which can effectively deliver mRNA to lymph nodes, activate the cGAS-STING pathway, and activate the specific immune system;

[0007] The glycopeptide carrier structure is expressed as Man-H8-R9-(WL)7, which comprises, from the C-terminus to the N-terminus, a hydrophobic peptide segment (WL)7 that promotes glycopeptide self-assembly, a cationic peptide segment R9 that adsorbs mRNA, a peptide segment H8 that promotes lysosomal escape, and a mannose ligand that achieves lymph node targeting.

[0008] Preferably, the polypeptide portion of the glycopeptide carrier is synthesized by solid phase peptide synthesis, and an alkyne-containing linker is coupled to the N-terminus of the polypeptide.

[0009] Preferably, the peptide segments of the glycopeptide carrier are connected using PEG4 as a linker.

[0010] Preferably, the alkyne-containing polypeptide of the glycopeptide carrier is coupled to the azide-containing mannose via a Click reaction.

[0011] The present invention also provides a method for preparing the above-mentioned nanoparticles, comprising the following steps:

[0012] S1. Prepare peptides H8-R9-(WL)7 and Man-H8-R9-(WL)7 respectively using RNase / DNase-free water, and mix them to form a peptide mixture;

[0013] S2, adding manganese chloride mother solution to the polypeptide mixture and shaking at room temperature;

[0014] S3. Prepare mRNA solution, add the polypeptide-manganese chloride mixture into the mRNA solution, shake at room temperature, and form Man-MPm nanoparticle solution after ultrafiltration.

[0015] Preferably, the polypeptide H8-R9-(WL)7 and Man-H8-R9-(WL)7 solutions in S1 are mixed so that the mannose content is 10% to form a polypeptide mixture.

[0016] Preferably, in S2, manganese chloride mother solution is added to the polypeptide mixture to make the concentration added to the polypeptide solution 63.41% (w / w, Mn 2+The mass ratio of the peptide was 0.0447 W / v / v and the mixture was shaken at room temperature for 30 min.

[0017] Preferably, the mRNA solution and the polypeptide-manganese chloride mixture in S3 are mixed to make N:P=8:1, shaken at room temperature for 30 minutes, and ultrafiltered at 4500rpm with a 10kDa ultrafiltration tube to form a Man-MPm nanoparticle solution, wherein the manganese ion content after ultrafiltration is 7.41% (w / w, Mn 2+ relative to the mass ratio of the peptide).

[0018] Finally, the present invention also provides the use of the above nanoparticles in preparing tumor prevention vaccines or drugs.

[0019] The beneficial effects of the present invention are:

[0020] Compared with the prior art, (1) the present invention designs and prepares a novel self-assembling glycopeptide delivery nanoparticle Man-MPm, and determines its excellent performance as an mRNA delivery carrier and its potential for developing mRNA vaccines.

[0021] (2) The present invention combines the lymph node targeting function and the cGAS-STING pathway activation ability into a new vector, which can synergistically improve the immune level of mRNA vaccines.

[0022] (3) The present invention utilizes the metal chelating ability of amino acids to adsorb manganese ions and uses them as vaccine adjuvants to develop mRNA vaccines, thereby expanding the application of metal adjuvants. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0024] Figure 1 It is a synthetic route map for self-assembling glycopeptides;

[0025] Figure 2 are the (a) purity and (b) molecular weight plots of self-assembled glycopeptides;

[0026] Figure 3 is the average particle size diagram of self-assembled glycopeptide nanoparticles;

[0027] Figure 4 is the potential map of self-assembled glycopeptide nanoparticles;

[0028] Figure 5 is the TEM image of self-assembled glycopeptide nanoparticles;

[0029] Figure 6 is the agarose gel electrophoresis diagram of self-assembled glycopeptide nanoparticles on mRNA at different N:P;

[0030] Figure 7 This is a diagram showing the effect of self-assembled glycopeptide nanoparticles on the enzyme protection of mRNA;

[0031] Figure 8 This is a graph showing the effect of self-assembled glycopeptide nanoparticles at different concentrations on the cell viability of DC2.4 cells;

[0032] Fig. 9 Schematic diagram of self-assembled glycopeptide nanoparticles promoting mRNA cell uptake, wherein (a) is a laser confocal micrograph of cell uptake, and (b) is the percentage of cells with positive Cy5 fluorescence signals at different time points detected by flow cytometry;

[0033] Fig.10 Schematic diagram of self-assembled glycopeptide nanoparticles promoting mRNA to achieve lysosomal escape, where (a) is a laser confocal micrograph of lysosomal escape, and (b) is a quantitative graph of the Pearson correlation coefficient of each group;

[0034] Fig.11 The effects of self-assembled glycopeptide nanoparticles on (a) IFN-β and (b) CXCL10 mRNA in DC2.4 cells at different manganese ion concentrations;

[0035] Fig.12 The effect of self-assembled glycopeptide nanoparticles transfected with (a) eGFP-mRNA and (b) Fluc-mRNA in DC2.4 cells, and (c) eGFP-mRNA in BMDC cells;

[0036] Fig.13 Schematic diagram of self-assembled glycopeptide nanoparticles promoting BMDC cell maturation and antigen presentation, wherein (a) is the expression of CD80 and CD86 on BMDC cells after administration to characterize the effect of nanoparticles in promoting cell maturation, and (b) is the expression of BMDC cell surface antigens after administration to characterize the effect of nanoparticles in promoting antigen presentation;

[0037] Fig.14 This is a schematic diagram of the self-assembled glycopeptide nanoparticles lymph node targeted delivery of mRNA, where the left picture is an imaging picture of the lymph node after administration, and the right picture is a quantitative picture of bioluminescence in the lymph node;

[0038] Fig.15Schematic diagram of the use of self-assembled glycopeptide nanoparticles in a tumor prevention model, where (a) is an immune flow chart, (b) is the DC cell maturation effect in the lymph nodes after administration, (c) is the DC cell antigen presentation effect in the lymph nodes after administration, (d) is the antibody titer against OVA antigen in mouse serum after administration, and (e) is the IFN-γ in the lymph nodes after administration. + CD8 + Representative flow cytometry of T cells, (f) IFN-γ in lymph nodes after drug administration + CD8 + Quantitative image of T cells, (g) shows the expression of SIINFEKL-tetramer CD8 in lymph nodes after administration + Representative flow cytometry of T cells, (h) SIINFEKL-tetramer CD8 expressed in lymph nodes after administration + Quantitative graph of T cells, (i) is the tumor growth curve of mice after tumor bearing, and (j) is the survival curve of mice after tumor bearing. DETAILED DESCRIPTION

[0039] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0040] Example 1

[0041] 1) Preparation and purification of self-assembling glycopeptides

[0042] The peptide was synthesized by peptide solid phase synthesis with a synthesis scale of 0.1 mmol, starting from Fmoc-Leu-WangResin with a loading of 0.23 mmol / g. Fmoc removal was performed using a 20% piperidine-DMF solution. The amino acid was activated using DIEA and O-(benzotriazole-1-yl)-N,N,N',N'-tetramethylurea of ​​tetrafluoroborate (TBTU) in N-methylpyrrolidone (NMP), and the Fmoc-amino acid and resin were coupled. Fmoc-amino acid (6.0 eq), TBTU (6.0 eq) and DIEA (12 eq) were automatically added using a peptide synthesizer. Fmoc-12-amino-4,7,10-trioxadodecanoic acid and propargyl-PEG3-carboxylic acid were used as building blocks similar to amino acids and connected to the peptide ( Figure 1). After all building blocks were coupled, the resin was transferred from the peptide synthesizer to a flask and treated with a mixture of trifluoroacetic acid / thioanisole / 1,2-ethanedithiol / anisole (90 / 5 / 3 / 2, v / v / v / v) for 2 hours to cleave the peptide. The crude peptide was purified by high performance liquid chromatography (HPLC) on a Waters e2695 HPLC system equipped with a dual absorbance UV detector. The column was a C18 column (Waters Symmetry PrepTM, 19×300 mm, 7 μm) at a flow rate of 20 mL / min, using a linear gradient of 60%-80% acetonitrile containing 0.1% trifluoroacetic acid for 20 minutes. The target glycopeptide ( Figure 1 ), the azide-modified Man ligand (1.2 eq), the alkynyl-modified peptide (1.0 eq), the catalytic equivalent of trihydroxypropyltriazolemethylamine (THPTA) and CuOAc were dissolved in water, the mixture was stirred at 40°C for 18 hours, lyophilized, the crude product was purified by preparative reverse phase HPLC, and the purity of the glycopeptide was determined by analytical HPLC ( Figure 2 a), MALDI-TOF MS determination of the molecular weight of glycopeptides ( Figure 2 b).

[0043] 2) Preparation and characterization of Man-MPm nanoparticles

[0044] To construct Man-MP nanoparticles, glycopeptide and peptide were dissolved in DNase / RNase-free water, mixed to make Man content reach 10%, added manganese chloride to make manganese ion concentration reach 63.41% (w / w, manganese ion relative to polypeptide), and incubated at room temperature for 30 minutes to allow polypeptide self-assembly. Man-MP and mRNA were shaken and mixed at room temperature for another 30 minutes to make nitrogen-phosphorus ratio reach 8:1 to obtain Man-MPm nanoparticles. Man-Pm and Pm were prepared in the same way, except that Mn was not included. 2+ Finally, the Man-MPm nanoparticles were ultrafiltered and the Mn adsorbed in the Man-MPm was determined by ICP-OES. 2+ The average particle size of nanoparticles was measured using ZetasizerNano ZS90 ( Figure 3 ) and zeta potential ( Figure 4 The nanoparticle morphology was determined using transmission electron microscopy ( Figure 5 ).

[0045] The characterization results show that the Mn finally adsorbed to Man-MPm 2+ The content is 7.41%, the average particle size of the nanoparticles is 70nm, the potential is +25.58mV, and the morphology is spherical.

[0046] III) Determination of the adsorption capacity of Man-MP nanoparticles to mRNA

[0047] The adsorption capacity of Man-MP nanoparticles for mRNA was determined by agarose gel hysteresis test. Different concentrations of Man-MP were mixed with the same amount of mRNA (1 μg) at different N / P ratios. Free mRNA and different Man-MPm complexes were mixed with 5× loading buffer (2.5 μL) and electrophoresed on a 1% agarose gel in Tris-EDTA at 80 V for 30 minutes. The RNA bands were visualized and analyzed by a gel image analysis system. The results are shown in Figure 6 As shown, mRNA can be completely adsorbed when N / P is 2:1.

[0048] IV) Enzyme protection test of Man-MP nanoparticles on mRNA

[0049] To explore the enzymatic protection ability of Man-MP on mRNA, Man-MPm (N / P ratio of 8) was incubated with 75 ng RNase A at 37°C for 10 min. Then, RNase inhibitor and heparin solution were added to the above solution in sequence and incubated at 37°C for 15 min and 50°C for 4 h, respectively ( Figure 7 , Line 5). Finally, the integrity of the mRNA in the nanoparticles was detected by agarose gel electrophoresis. Figure 7 As shown, when Man-MPm nanoparticles are subjected to enzymatic degradation, the displaced mRNA still maintains structural integrity, indicating that the nanoparticles can protect mRNA from enzymatic degradation.

[0050] 5) Man-MP nanoparticle cytotoxicity assay

[0051] DC2.4 cells were cultured at 1 × 10 4 The cells were seeded at a density of 100 μg / mL in a 96-well plate. The next day, cells were treated with a series of concentrations of Man-MPm. After 24 hours, CCK-8 reagent was added to the culture medium and the absorbance was measured at 450 nm after 2 hours of incubation. The results are shown in Figure 2. Figure 8 As shown, the cell viability was still above 80% when the concentration of Man-MP was 128 μg / mL, indicating that Man-MP has high safety.

[0052] VI) Intracellular uptake and lysosomal escape

[0053] To evaluate cellular internalization and lysosomal escape, Man-MPm was prepared using Cy5-labeled mRNA. DC2.4 cells were seeded in confocal culture dishes (1 × 10 5After incubation with Man-MPm (Cy5 mRNA) for different time periods (0, 0.25, 0.5, 1, 2, 4, and 6 h), the cells were washed three times with PBS, stained with DAPI, and analyzed for intracellular uptake ( Fig. 9 After incubation with Man MPm (Cy5 mRNA) for 24 h, the cells were washed three times with PBS, and lysosomes and nuclei were stained with LysoTracker Red and DAPI, respectively, to analyze lysosomal escape ( Fig.10 ). Intracellular fluorescence was observed under a confocal laser scanning microscope. Alternatively, cells were seeded in 6-well plates and incubated with Man-MPm (Cy5 mRNA) for the same time, and intracellular uptake was analyzed by flow cytometry.

[0054] The results showed that the proportion of Cy5-positive DC2.4 cells reached 96.1% 1h after administration, indicating that Man-MPm can be quickly taken up by cells. The Pearson correlation coefficient indicates the co-localization of lysosomes and mRNA. After Man-MPm administration, the Pearson correlation coefficient was less than 0.5, indicating that Man-MPm can promote mRNA to escape from lysosomes.

[0055] VII) Activation of STING pathway by Man-MP nanoparticles

[0056] To study the activation effect of the STING pathway, qRT-PCR was used to detect the in vitro IFN-β and CXCL10 mRNA levels after administration. DC2.4 cells were cultured at 2×10 5 The concentrations of 2+ The total RNA was then extracted with Trizol, reverse transcribed into cDNA, and RT-PCR was performed to calculate 2 -ΔΔCt The primers used in the experiment are shown in Table 1:

[0057] Table 1 Primers used in the experiment

[0058] ForwardPrimer ReversePrimer CXCL10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA IFN-β CTGGGTGGAATGAGACTATTGT AAGTTCCTGAAGATCTCTGCTC GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA

[0059] The results are as follows Fig.11 As shown, the levels of IFN-β and CXCL10 mRNA in DC2.4 cells increased with the addition of manganese ions, indicating that Man-MP nanoparticles have a dose-dependent activation effect on the STING pathway.

[0060] 8) Transfection of mRNA by Man-MP nanoparticles

[0061] For mRNA transfection, DC2.4 cells (1×10 5cells / mL) and incubated overnight. The cells and Man-MPm / Man-Pm / Pm (2μg / mL eGFP-mRNA or Fluc-mRNA) were cultured in serum-free RPMI 1640 for 6 hours and then incubated with serum for 18 hours. Subsequently, flow cytometry was used to quantify the expression of fluorescent proteins. After lysing DC2.4 cells, D-luciferin potassium salt was added as a substrate for firefly luciferase. The fluorescence expression (RLU) was then measured using a chemiluminescence instrument, and the protein content (mg / mL) was determined by the Bradford assay. The expression level of Fluc-mRNA is expressed as RLU / mg. BMDCs were inoculated (2×10 5 cells / mL) and were transfected with eGFP-mRNA using the same method as DC2.4 cells.

[0062] The results are as follows Fig.12 As shown, Man-MP nanoparticles can effectively transfect eGFP-mRNA and Fluc-mRNA into DC2.4 cells, and can effectively transfect eGFP-mRNA into BMDCs.

[0063] IX) Man-MP nanoparticles induce DC maturation and antigen presentation

[0064] BMDCs were collected from healthy C57BL / 6 mice and inoculated in culture dishes (5 × 10 5 Cells / dish) were incubated with complete RPMI1640 medium containing granulocyte-macrophage colony-stimulating factor (GM-CSF, 20 ng / mL) and interleukin-4 (IL-4, 20 ng / mL) for 7 days to obtain BMDCs. After culturing with Man-MPm / Man-Pm / Pm (2 μg / mL OVA-mRNA) for 24 hours, DC maturation was determined by flow cytometry after staining with anti-CD11c-APC, anti-CD80-PE, and anti-CD86-PE-Cy7 antibodies. b -After staining with PE-Cy7 antibody, antigen presentation by DCs was determined.

[0065] The results are as follows Fig.13 As shown, Man-MP nanoparticles can effectively stimulate BMDC maturation and antigen presentation.

[0066] 10) Targeted delivery of Man-MP nanoparticles to LN

[0067] In vivo distribution and expression were assessed using an in vivo imaging system (IVIS). ManMPm / Man-Pm / Pm containing 10 μg of Fluc-mRNA was subcutaneously injected into female C57BL / 6 mice (6 to 8 weeks old). 24 hours after injection, D-luciferin potassium salt (150 mg / kg) was injected intraperitoneally into the mice. Ten minutes later, the mice were euthanized and isolated LNs were imaged for bioluminescence using the IVIS system.

[0068] The results are as follows Fig.14 As shown, the lymph nodes isolated from the Man-MPm-administered group had the strongest bioluminescence, indicating that Man-MP nanoparticles can achieve effective LN-targeted delivery of mRNA.

[0069] XI) Mouse immunity and tumor prevention model

[0070] For the prevention model, female C57BL / c mice (6 to 8 weeks old) were randomly divided into several groups. Mice were immunized with different formulations containing 10 μg of OVA-mRNA every seven days for a total of two subcutaneous immunizations. On the 7th day after the second administration, blood and LN were collected for analysis of antibody titers and immune cell ratios, respectively. The remaining mice were given 5×10 5 B16F10-OVA cells were added, and the tumor volume was monitored every two days to evaluate the inhibitory effect of the established immune response on tumor growth. The tumor volume was calculated as follows: V = 0.5 × L × W 2 (L is the longest diameter of the tumor and W is the shortest diameter perpendicular to the length).

[0071] The results are as follows Fig.15 As shown, Man-MP nanoparticles can effectively activate the mouse immune system, promote DC maturation and antigen presentation in LN, increase antibody titers in serum, and the proportion of cytotoxic T lymphocytes and antigen-specific CD8 T cells in lymph nodes. The established immune barrier can effectively inhibit tumor growth in mice and prolong the survival period of mice.

[0072] The preferred embodiments of the present invention disclosed above are only used to help illustrate the present invention. The preferred embodiments do not describe all details in detail, nor do they limit the invention to only the specific embodiments described. Obviously, many modifications and changes can be made according to the content of this specification.

Claims

1. A self-assembling glycopeptide nanoparticle for mRNA vaccine delivery, characterized in that: The nanoparticles are self-assembled from glycopeptide carriers, mRNA and manganese ions to form Man-MPm nanoparticles, which can effectively deliver mRNA to lymph nodes, activate the cGAS-STING pathway, and activate the specific immune system. The glycopeptide carrier structure is expressed as Man-H8-R9-(WL)7, which comprises, from the C-terminus to the N-terminus, a hydrophobic peptide segment (WL)7 that promotes glycopeptide self-assembly, a cationic peptide segment R9 that adsorbs mRNA, a peptide segment H8 that promotes lysosomal escape, and a mannose ligand that achieves lymph node targeting.

2. The self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 1, characterized in that The polypeptide part of the glycopeptide carrier is synthesized by solid phase polypeptide synthesis, and an alkyne-containing linker is coupled to the N-terminus of the polypeptide.

3. The self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 2, characterized in that: The peptide segments of the glycopeptide carrier are connected by using PEG4 as a linker.

4. The self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 3, characterized in that The alkyne-containing polypeptide of the glycopeptide carrier is coupled with the azide-containing mannose via a Click reaction.

5. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1. Prepare peptides H8-R9-(WL)7 and Man-H8-R9-(WL)7 respectively using RNase / DNase-free water, and mix them to form a peptide mixture; S2, adding manganese chloride mother solution to the polypeptide mixture and shaking at room temperature; S3. Prepare mRNA solution, add the polypeptide-manganese chloride mixture into the mRNA solution, shake at room temperature, and form Man-MPm nanoparticle solution after ultrafiltration.

6. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 5, characterized in that: The polypeptide H8-R9-(WL)7 and Man-H8-R9-(WL)7 solutions in S1 are mixed so that the mannose content is 10% to form a polypeptide mixture.

7. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 5, characterized in that: In step S2, manganese chloride mother solution is added to the polypeptide mixture to make the concentration of the polypeptide solution 63.41% (w / w, Mn 2+ The mass ratio of the peptide was 0.0447 W / v / v and the mixture was shaken at room temperature for 30 min.

8. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 5, characterized in that: The mRNA solution and the polypeptide-manganese chloride mixture in S3 were mixed to make N:P=8:1, shaken at room temperature for 30 minutes, and ultrafiltered through a 10 kDa ultrafiltration tube at 4500 rpm to form a Man-MPm nanoparticle solution, wherein the manganese ion content after ultrafiltration was 7.41% (w / w, Mn 2+ relative to the mass ratio of the peptide).

9. Use of the self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to any one of claims 1 to 4 in the preparation of tumor prevention vaccines or drugs.

Images