Nanometer antibody and application thereof

Abstract

The invention provides a nano antibody and application thereof, a variable region in an amino acid sequence of the nano antibody comprises a complementarity determining region CDR and a framework region FR, the complementarity determining region CDR comprises a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, the CDR3 is RWPDXY family, and binding sites of the CDR3 and AAV capsid are W99, D101 and Y103. The nano antibody provided by the invention has very high affinity and activity, and can specifically recognize and combine various serotypes of AAV, and an adsorbent prepared from the nano antibody has very strong adsorption capacity on AAV, can be applied to AAV affinity chromatography, and is beneficial to industrial application of an AAV affinity chromatography column. In addition, the method can also be applied to the field of AAV detection, and can detect empty capsid and virions together.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a nano antibody and an application thereof. Background Art

[0002] Adeno-associated virus (AAV) belongs to the genus Dependoviridae of the family Parvoviridae. It has an icosahedral structure and is the simplest type of single-stranded DNA defective virus discovered so far. It requires a helper virus (usually adenovirus) to participate in replication. The diameter of the virus particle is between 20 and 26 nm, and contains a linear single-stranded DNA genome with a size of 4.7 to 6 kb. AAV is not pathogenic to humans. Studies have shown that about 80% of the population test positive for AAV serum.

[0003] Recombinant adeno-associated virus (rAAV) is developed based on non-pathogenic wild AAV. Due to its good safety, wide range of host cells (dividing and non-dividing cells), low immunogenicity, and long-term expression of foreign genes in vivo, it is regarded as one of the most promising gene transfer vectors and has been widely used in gene therapy and vaccine research around the world, including in vivo and in vitro gene function research, construction of disease models, gene knockout, gene therapy and vaccine research.

[0004] Since the upstream production of rAAV is completed in cells, there are nucleic acids, residual impurities in the culture medium, and host cell proteins (HCP) in its cleavage products. Although the residual DNA can be treated with nucleases, the removal of HCP is a complex process, usually with multiple steps, which may reduce the yield, delay process development, and bring great challenges to the downstream purification process. In particular, AAV has a variety of different serotypes (AAV1-AAV10), which have different capsid protein spatial structures, sequences, and tissue specificity, have different infection efficiencies for different tissues and cells, and recognize and bind to different cell surface receptors. Therefore, a universal affinity chromatography solution is difficult to implement.

[0005] Traditional downstream processes require multiple different processing steps, including cesium chloride or iodixanol gradient centrifugation and multiple chromatography steps. This type of process is not ideal because when multiple steps are required, even a high single-step yield will result in a significant reduction in the final overall yield. And the main disadvantage of this method is that it is not suitable for direct purification of viruses from large volumes of lysate and is only suitable for scientific research level.

[0006] To address this challenge, the latest affinity chromatography methods have reduced the number of steps required to purify AAV, improved yields, and shortened process time. For example, heparin-affinity chromatography columns can be used to purify rAAV3 and rAAV6; mucin-affinity chromatography columns can be used to purify rAAV1, rAAV4, rAAV5, and rVVA6; antibody-affinity columns are used to detect and purify rAAV, such as monoclonal antibodies that recognize and bind to AAVXL32.1 (Patent Document 1), polyclonal antibodies that specifically recognize AAV9 capsid protein (Patent Document 2), etc.

[0007] However, traditional antibody preparation is expensive, and the large size of the antibody leads to a low amount of coupling on the carrier, which limits its industrial application. Camel-derived nanobodies have high specificity and stability. AVB Sepharose based on nanobodies TM (GE Healthcare TM ) Filler and POROS TM CaptureSelectAAVX (Thermo Scientific TM ) fillers (non-patent document 1) perform well in the column chromatography process, making the industrial application of AAV affinity chromatography columns possible. However, the affinity, stability, and binding spectrum of nanobodies with different sequences screened out by different screening methods are very different.

[0008] Patent document 1: CN113583112B

[0009] Patent document 2: CN114685651A

[0010] Non-patent document 1: Orjana Terova, et.al, Overcoming Downstream PurificationChallenges for ViralVector Manufacturing: Enabling Advancement of GeneTherapies in the Clinic, Cell Gene Therapy Insights 2018; 4(2), 101-111. Summary of the invention

[0011] The purpose of the present invention is to provide nanobodies with amino acid sequences of specific structures and their applications, so as to solve the problems of complex antibody preparation process, high cost, poor antibody affinity, stability and binding spectrum faced by existing AAV enrichment, purification and detection. In order to achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0012] In the first aspect, the present invention provides a nanobody, wherein the variable region in the amino acid sequence of the nanobody includes a complementary determining region CDR and a framework region FR, the complementary determining region CDR includes a complementary determining region CDR1, a complementary determining region CDR2 and a complementary determining region CDR3, and the nanobody can recognize and specifically bind to AAV, wherein the complementary determining region CDR3 is of the ArgTrpProAspXaaTyr family, the Xaa is selected from Pro, Arg or Gly, and the binding sites of the complementary determining region CDR3 and AAV are Trp99, Asp101 and Tyr103.

[0013] Preferably, the amino acid sequence of the complementarity determining region CDR3 is selected from SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3 or SEQ ID No: 4, and an amino acid sequence with more than 75% homology to SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3 or SEQ ID No: 4.

[0014] Preferably, the amino acid sequence of the complementarity determining region CDR1 is selected from any one of SEQ ID No: 5 to SEQ ID No: 16; the amino acid sequence of the complementarity determining region CDR2 is selected from any one of SEQ ID No: 17 to SEQ ID No: 27.

[0015] Preferably, the Nanobody comprises an amino acid sequence such as CDR1 as shown in SEQ ID No: 5, CDR2 as shown in SEQ ID No: 17, and CDR3 as shown in SEQ ID No: 1; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 5, CDR2 as shown in SEQ ID No: 18, and CDR3 as shown in SEQ ID No: 1; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 6, CDR2 as shown in SEQ ID No: 17, and CDR3 as shown in SEQ ID No: 1; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 6, CDR2 as shown in SEQ ID No: 18, and CDR3 as shown in SEQ ID No: 1; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 5, CDR2 as shown in SEQ ID No: 19, and CDR3 as shown in SEQ ID No: 1; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 6, CDR2 as shown in SEQ ID No: 20, and CDR3 as shown in SEQ ID No: 2; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 7, CDR2 as shown in SEQ ID No: 8, and CDR3 as shown in SEQ ID No: 1. or an amino acid sequence such as CDR1 as shown in SEQ ID No: 8, CDR2 as shown in SEQ ID No: 19, and CDR3 as shown in SEQ ID No: 2; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 9, CDR2 as shown in SEQ ID No: 20, and CDR3 as shown in SEQ ID No: 2; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 10, CDR2 as shown in SEQ ID No: 19, and CDR3 as shown in SEQ ID No: 2; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 11, CDR2 as shown in SEQ ID No: 21, and CDR3 as shown in SEQ ID No: 3; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 11, CDR2 as shown in SEQ ID No: 22, and CDR3 as shown in SEQ ID No: 3; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 12, CDR2 as shown in SEQ ID No: 21, and CDR3 as shown in SEQ ID No: 3. CDR3 as shown in SEQ ID No:3; or CDR1 as shown in SEQ ID No:12, CDR2 as shown in SEQ ID No:23, CDR3 as shown in SEQ ID No:3;or an amino acid sequence such as CDR1 as shown in SEQ ID No: 13, CDR2 as shown in SEQ ID No: 22, and CDR3 as shown in SEQ ID No: 3; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 14, CDR2 as shown in SEQ ID No: 24, and CDR3 as shown in SEQ ID No: 4; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 14, CDR2 as shown in SEQ ID No: 25, and CDR3 as shown in SEQ ID No: 4; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 14, CDR2 as shown in SEQ ID No: 26, and CDR3 as shown in SEQ ID No: 4; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 15, CDR2 as shown in SEQ ID No: 27, and CDR3 as shown in SEQ ID No: 4; or an amino acid sequence such as CDR1 as shown in SEQ ID No: 16, CDR2 as shown in SEQ ID No: 26, and CDR3 as shown in SEQ ID No: 4. ;

[0016] Preferably, the Nanobody framework region comprises: framework region FR1, framework region FR2, framework region FR3 and framework region FR4, or an amino acid sequence having more than 50% homology to framework region FR1, framework region FR2, framework region FR3 and framework region FR4;

[0017] The framework region FR1 is the following formula (I):

[0018] GlnLeuGlnGluSerGlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysXaa 11 AlaSerXaa 12 (I);

[0019] The framework region FR2 is the following formula (II):

[0020] MetGlyTrpTyrArgValGlyLeuArgSerGlyArgXaa 21 LeuValAlaXaa 22 (II);

[0021] The complementary determining region FR3 is the following formula (III):

[0022] TyrAlaAspSerValXaa 31 XA 32 ArgX 33 XoA 34SerArgXaa 35 XA 36 AlaLysXaa 37 XA 38 ValTyrLeuGlnMet Xaa 39 SerLeuLysXaa 310 GluAspThrAlaValTyrTyrCys(III);

[0023] Among them, Xaa 11 Independently selected from Ala, Val; and / or, Xaa 12 Independently selected from Gly, Val; and / or, Xaa 21 Independently selected from Glu, Asp; and / or, Xaa 22 independently selected from Thr, Ser, Ala; and / or, Xaa 31 independently selected from Lys, Gln; and / or, Xaa 32 are independently selected from Asp, Gly; and / or, Xaa 33 independently selected from Phe, Ser; and / or, Xaa 34 Independently selected from Ile, Val; and / or, Xaa 35 are independently selected from Asp, Asn; and / or, Xaa 36 independently selected from Asp, Asn, Tyr; and / or, Xaa 37 are independently selected from Asp, Asn; and / or, Xaa 38 are independently selected from Ala, Thr; and / or, Xaa 39 independently selected from Asn, Thr; and / or, Xaa 310 are independently selected from Leu, Pro;

[0024] The complementary determining region FR4 includes: TrpGlyGlnGlyThrGlnValThrValSerSer.

[0025] Preferably, the amino acid sequence of the Nanobody is selected from: SEQ ID No: 28, SEQ ID No: 29, SEQ ID No: 30, SEQ ID No: 31, SEQ ID No: 32, SEQ ID No: 33, SEQ ID No: 34, SEQ ID No: 35, SEQ ID No: 36, SEQ ID No: 37, SEQ ID No: 38, SEQ ID No: 39, SEQ ID No: 40, SEQ ID No: 41, SEQ ID No: 42, SEQ ID No: 43, SEQ ID No: 44, SEQ ID No: 45, SEQ ID No: 46 or SEQ ID No: 47.

[0026] The framework region FR2 sequence of the above-mentioned Nanobody of the invention can be replaced by a more common framework region FR2 sequence (such as MetGlyTrpTyrArgGlnAlaProGlyLysGlnArgAspLeuValAlaSer, but not limited thereto). Preferably, the FR2 replacement Nanobody sequence is selected from the group consisting of: SEQ ID No:48, SEQ ID No:49, SEQ ID No:50, SEQ ID No:51, SEQ ID No:52, SEQ ID No:53, SEQ ID No:54, SEQ ID No:55, SEQ ID No:56, SEQ ID No:57, SEQ ID No:58, SEQ ID No:59, SEQ ID No:60, SEQ ID No:61, SEQ ID No:62, SEQ ID No:63, SEQ ID No:64, SEQ ID No:65, SEQ ID No:66 or SEQ ID No:67.

[0027] Preferably, the Nanobody is a Nanobody obtained by humanization. Preferably, the humanized Nanobody is selected from the group consisting of: SEQ ID No: 68, SEQ ID No: 69, SEQ ID No: 70, SEQ ID No: 71, SEQ ID No: 72, SEQ ID No: 73, SEQ ID No: 74, SEQ ID No: 75, SEQ ID No: 76, SEQ ID No: 77, SEQ ID No: 78, SEQ ID No: 79, SEQ ID No: 80, SEQ ID No: 81, SEQ ID No: 82, SEQ ID No: 83, SEQ ID No: 84, SEQ ID No: 85, SEQ ID No: 86, SEQ ID No: 87, SEQ ID No: 88, SEQ ID No: 89, SEQ ID No: 90, SEQ ID No: 91, SEQ ID No: 92, SEQ ID No: 93, SEQ ID No: 94, SEQ ID No: 95, SEQ ID No: 96, SEQ ID No: 97, SEQ ID No: 98, ID No:99, SEQ ID No:100, SEQ ID No:101, SEQ ID No:102, SEQ ID No:103, SEQ ID No:104, SEQ ID No:105, SEQ ID No:106, SEQ ID No:107, SEQ IDNo:108, SEQ ID No:109, SEQ ID No:110, SEQ ID No:111, SEQ ID No:112, SEQ ID No:113, SEQ ID No:114, SEQ ID No:115, SEQ ID No:116, SEQ ID No:117, SEQ ID No:118, SEQ ID No:119, SEQ ID No:120, SEQ ID No:121, SEQ ID No:122, SEQ ID No:123, SEQ ID No:124, SEQ ID No:125、SEQ ID No:126、SEQ ID No:127、SEQ ID No:128、SEQ ID No:129, SEQ ID No:130, SEQ ID No:131, SEQ ID No:132, SEQ ID No:133, SEQ ID No:134, SEQ ID No:135, SEQ ID No:136, SEQ ID No:137, SEQ ID No:138, SEQ IDNo:139, SEQ ID No:140, SEQ ID No:141, SEQ ID No:142, SEQ ID No:143, SEQ ID No:144, SEQ ID No:145, SEQ ID No:146 or SEQ ID No:147.

[0028] Preferably, the Nanobody is a Nanobody obtained by CDR transplantation of Nanobodies between the same family. Preferably, the CDR-grafted Nanobody is selected from: SEQ ID No: 148, SEQ ID No: 149, SEQ ID No: 150, SEQ ID No: 151, SEQ ID No: 152, SEQ ID No: 153, SEQ ID No: 154, SEQ ID No: 155, SEQ ID No: 156, SEQ ID No: 157, SEQ ID No: 158, SEQ ID No: 159, SEQ ID No: 160, SEQ ID No: 161, SEQ ID No: 162, SEQ ID No: 163, SEQ ID No: 164, SEQ ID No: 165, SEQ ID No: 166 or SEQ ID No: 167.

[0029] In a second aspect, the present invention provides a nucleic acid encoding the above-mentioned Nanobody.

[0030] In a third aspect, the present invention provides an expression vector comprising an expression cassette of the nucleic acid described above in claim 1.

[0031] In a fourth aspect, the present invention provides a host cell comprising the expression vector as claimed in claim 1.

[0032] In a fifth aspect, the present invention provides the use of the nanobody in immunodetection, enrichment and / or purification.

[0033] Preferably, the nanobody is used in the preparation of a virus adsorbent, a virus purification kit, and a virus detection kit; further preferably, the virus is AAV.

[0034] In a sixth aspect, the present invention provides a virus adsorbent comprising a carrier matrix and the above-mentioned nanobody.

[0035] In a seventh aspect, the present invention provides a virus purification kit comprising a carrier matrix and the above-mentioned nanobody.

[0036] In an eighth aspect, the present invention provides a virus detection kit comprising a carrier matrix and the above-mentioned nanoantibody.

[0037] In a ninth aspect, the present invention provides an AAV detection method for non-diagnostic purposes, comprising coupling a carrier matrix and the above-mentioned nanoantibody through HRP, and then detecting by direct enzyme immunosorbent assay or sandwich enzyme immunosorbent assay.

[0038] The nanobody of the present invention is an anti-AAV nanobody with a new amino acid sequence discovered through screening. The nanobody has high affinity and activity, can specifically recognize and bind to AAV, and the adsorbent prepared by the nanobody has a strong adsorption capacity for AAV, can be applied to AAV affinity chromatography, and is conducive to the industrial application of AAV affinity chromatography columns. In addition, it can also be applied to the field of AAV detection, and empty capsids and virus particles can be detected together. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is the purified Nanobody in Example 4 of the present invention.

[0040] Figure 2 It is the kinetic sensor diagram of the nano C1-C5 antibodies of the present invention.

[0041] Figure 3a , 3b 3c and 3c are molecular docking diagrams of the nanobody and AAV capsid protein at different angles in Example 6 of the present invention.

[0042] Figure 4 It is the standard curve of direct ELISA detection in Example 12 of the present invention.

[0043] Figure 5 This is the standard curve for sandwich ELISA detection in Example 12 of the present invention. DETAILED DESCRIPTION

[0044] The above contents and other aspects of the present invention will be further described below, wherein:

[0045] (1) Unless otherwise indicated, the term "sequence" as used herein (e.g., in phrases such as "antibody sequence," "variable region sequence," "V HH The term "sequence" or "protein sequence" should generally be understood to include the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding the amino acid sequence, unless the context requires a narrower interpretation.

[0046] (2) Unless otherwise indicated, all methods, steps, techniques and operations not specifically described are known and well-known to those skilled in the art. For example, reference is still made to the comprehensive background technology cited above and other references cited therein.

[0047] (3) The term "specificity" refers to the ability of a particular antigen-binding molecule (such as a Nanobody of the invention) to bind to different types of antigens or antigenic determinants. The specificity of an antigen-binding molecule can be determined based on its affinity and / or activity. Affinity is expressed as the dissociation equilibrium constant (K) between the antigen and the antigen-binding molecule. D ), is a measure of the binding strength between antigen and antigen-binding molecule, K D The smaller the value, the stronger the binding strength between the antigen and the antigen-binding molecule. D The larger the value, the weaker the binding strength between the antigen and the antigen-binding molecule. a represents the binding constant, K a The larger the value, the faster the binding. a The smaller the K, the slower the binding; d represents the dissociation constant, K d The larger the K, the faster the dissociation. d The smaller the K, the slower the dissociation; and D =K d / K a The ability of the nanobody of the present invention to bind to AAV can also be characterized by the ELISA method, and the data obtained are expressed as a percentage relative to the untreated sample. The closer the value is to 1.00, the closer the binding ability of the antibody under the treatment condition is to the untreated state, that is, the better the binding ability; the smaller the value is, the lower the binding ability of the antibody under the treatment condition is, that is, the poorer the stability is.

[0048] (4) The amino acid residues of a single domain antibody (i.e., a nanobody) can be determined according to the V sequence given by Kabat et al. in "Sequence of proteins of immunological interest", US Public Health Services, Publication No. 91. HH The domains are numbered according to the common numbering scheme used by Riechmann and Muyldermans for V from Camelidae. HH Domain. According to this numbering method, FR1 of a single domain antibody includes amino acid residues at positions 1 to 30, CDR1 of a single domain antibody includes amino acid residues at positions 31 to 36, FR2 of a single domain antibody includes amino acid residues at positions 37 to 49, CDR2 of a single domain antibody includes amino acid residues at positions 50 to 65, FR3 of a single domain antibody includes amino acid residues at positions 66 to 94, CDR3 of a single domain antibody includes amino acid residues at positions 95 to 102, and FR4 of a single domain antibody includes amino acid residues at positions 103 to 113. In this regard, it should be noted that as described in the art regarding VHH Domain and About V HH It is well known that the total number of amino acid residues in each CDR may be different and may not correspond to the total number of amino acid residues indicated by the Kabat numbering (i.e., one or more positions according to the Kabat numbering may not be occupied in the actual sequence, or the actual sequence may contain more amino acid residues than the number allowed by the Kabat numbering). This means that, in general, the amino acid residues in the actual sequence may be the same or different from the actual numbering according to the Kabat numbering. It can also be said that the amino acid residue numbering of the CDR is not taken into account according to the Kabat numbering, but position 1 according to the Kabat numbering corresponds to the start of FR1, and vice versa.

[0049] They can also be numbered according to the natural position of the amino acids in the single-domain antibody, or numbered in sequence as they are; or, in order to maintain the comparability of antibodies of the same family, placeholders are ignored for numbering, such as the 5th position of the CDR1 of the nanobody of the present invention (the 29th position of the full-length sequence), which is N, S, and F in SEQ ID No: 28 to SEQ ID No: 42, respectively, and is vacant in the sequence SEQ ID No: 43 to SEQ ID No: 46. However, for the sake of overall coordination and comparability, the vacancy is assigned to the 29th position of the full-length sequence.

[0050] (5) The term "immobilized" refers to binding of the Nanobody to a solid support.

[0051] (6) The term "homologous" refers to a family of Nanobody sequences that bind to the same antigen, have the same number of amino acids in CDR3, and have an amino acid sequence identity greater than 75%.

[0052] (7) The term "homology" refers to the similarity, resemblance or association between two or more sequences. "Percentage of sequence homology" can be calculated by comparing two sequences to be aligned in a comparison window, determining the number of positions at which the same nucleic acid base (e.g., A, T, C, G, I) or the same amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) is present in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to produce the percentage of sequence homology. Alignment for determining the percentage of sequence homology can be achieved in a variety of ways known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximum alignment over the full length of the sequences being compared or within a region of the sequence of interest. The homology can also be determined by the following methods: FASTA and BLAST. A description of the FASTA algorithm can be found in W. R. Earson and DJ. Lipman, "Improved tools for biological sequence comparisons," Proc. Natl. Acad. Sci., 85: 2444-2448, 1988; and DJ. Lipman and W. R. Earson, "Rapid and sensitive protein similarity searches," Science, 227: 1435-1441, 1989. A description of the BLAST algorithm can be found in S. Altschul, W. Gish, W. Miller, E. W. Myers and D. Lipman, "A basic local alignment search tool," Journal of Molecular Biology, 215: 403-410, 1990.

[0053] (8) Amino acid substitution can generally be described as a substitution in which an amino acid residue can be substituted with an amino acid having a similar chemical structure or with an amino acid having a dissimilar chemical structure, as long as there is little or no effect on the function, activity or other biological properties of the polypeptide. Preferably, the amino acid residue can be substituted with an amino acid having a similar chemical structure.

[0054] For the above-mentioned substitution modes, the situations disclosed in documents WO04 / 037999, WO 98 / 49185, WO 00 / 46383 and WO 01 / 09300 can be cited, but they are not limited thereto. In addition, the (preferred) types and / or combinations of the substitutions can be selected based on the relevant information of other references cited in WO 04 / 037999 and WO 06 / 122786.

[0055] (9) The term “framework amino acid substitution” refers to the replacement of one or more amino acid residues in the framework region (FR) of an antibody to optimize various properties of the antibody, such as stability, expression level, affinity and immunogenicity, while maintaining its specific recognition ability for the antigen.

[0056] (10) The term “framework replacement” refers to replacing an amino acid sequence in the framework region (FR) of one antibody with an amino acid sequence in the framework region of another antibody to improve the stability, expression level, affinity or reduce the immunogenicity of the antibody while maintaining its specific recognition ability for the antigen.

[0057] (11) The term “humanization” refers to the humanization of mouse or other non-human monoclonal antibodies through genetic engineering technology to reduce their immunogenicity and retain or improve their specificity and affinity for antigens.

[0058] (12) The term "inter-family nanoantibody CDR transplantation" refers to the transplantation of CDR1 and CDR2 between the same family. This transplantation retains the antigen binding properties of the original CDR while taking advantage of the stability and solubility advantages provided by the framework region of the new host. The resulting new CDR-transplanted nanoantibody has the same or similar properties to the original antibody, but may have different forms of expression and application potential.

[0059] (13) The ArgTrpProAspXaaTyr family or RWPDXY family described in the present invention refers to a class of antibodies having a specific amino acid sequence in the CDR3 region, wherein "Xaa" represents any one of proline, arginine, and glycine. Antibodies with this sequence have the same Arg, Trp, Pro, Asp, and Tyr residues as their core features, thus retaining the ability to widely recognize different AAV antigens.

[0060] The main amino acid residues involved in antigen recognition and binding on the nanoantibody of the present invention are W99, D101, and Y103, which bind to R487, R490, K530, E533, T576, and E577 on the AAV capsid (gray) through hydrophobic interactions, electrostatic interactions, and hydrogen bonding interactions.

[0061] In one embodiment of the present invention, the amino acid sequence of the complementary determining region CDR3 can be listed as SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3 or SEQ ID No: 4, and an amino acid sequence with more than 75% homology to SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3 or SEQ ID No: 4, but is not limited thereto.

[0062] In one embodiment of the present invention, the amino acid sequence of the complementary determining region CDR1 can be listed as SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7, SEQ ID No: 8, SEQ ID No: 9, SEQ ID No: 10, SEQ ID No: 11, SEQ ID No: 12, SEQ ID No: 13, SEQ ID No: 14, SEQ ID No: 15 or SEQ ID No: 16, but is not limited thereto.

[0063] In one embodiment of the present invention, the amino acid sequence of the complementary determining region CDR2 can be listed as SEQ ID No: 17, SEQ ID No: 18, SEQ ID No: 19, SEQ ID No: 20, SEQ ID No: 21, SEQ ID No: 22, SEQ ID No: 23, SEQ ID No: 24, SEQ ID No: 25, SEQ ID No: 26 or SEQ ID No: 27, but is not limited thereto.

[0064] In one embodiment of the invention, the Nanobody comprising the amino acid sequences CDR1, CDR2 and CDR3 can be listed as follows:

[0065]

[0066]

[0067] For the framework region, it is more conservative than the complementary determining region. Those skilled in the art will reasonably screen the sequence structure of the framework region according to the actual use and function of the nanobody. As the amino acid sequence of the framework region, an amino acid sequence with a homology of more than 50% is preferred, and an amino acid sequence with a homology of more than 70% is further preferred, and an amino acid sequence with a homology of more than 95% is further preferred.

[0068] The framework region FR1 comprises the following formula (I):

[0069] GlnLeuGlnGluSerGlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysXaa 11 AlaSerXaa 12 (I);

[0070] The framework region FR2 comprises the following formula (II):

[0071] MetGlyTrpTyrArgValGlyLeuArgSerGlyArgXaa 21 LeuValAlaXaa 22 (II);

[0072] The complementary determining region FR3 comprises the following formula (III):

[0073] TyrAlaAspSerValXaa 31 XA 32 ArgX 33 XoA 34 SerArgXaa 35 XA 36 AlaLysXaa 37 XA 38 ValTyrLeuGlnMet Xaa 39 SerLeuLysXaa 310 GluAspThrAlaValTyrTyrCys(III);

[0074] Among them, Xaa 11 Independently selected from Ala, Val; and / or, Xaa 12 Independently selected from Gly, Val; and / or, Xaa 21 Independently selected from Glu, Asp; and / or, Xaa 22 independently selected from Thr, Ser, Ala; and / or, Xaa 31 independently selected from Lys, Gln; and / or, Xaa 32 are independently selected from Asp, Gly; and / or, Xaa 33 independently selected from Phe, Ser; and / or, Xaa 34 Independently selected from Ile, Val; and / or, Xaa 35 are independently selected from Asp, Asn; and / or, Xaa 36 independently selected from Asp, Asn, Tyr; and / or, Xaa 37 are independently selected from Asp, Asn; and / or, Xaa 38are independently selected from Ala, Thr; and / or, Xaa 39 independently selected from Asn, Thr; and / or, Xaa 310 are independently selected from Leu, Pro;

[0075] The complementary determining region FR4 includes: TrpGlyGlnGlyThrGlnValThrValSerSer.

[0076] The amino acid sequence of the above-mentioned Nanobody can be listed as follows:

[0077]

[0078] However, it is not limited to the above examples, as long as there is little or substantially no effect on the function, activity or other biological properties of the polypeptide.

[0079] Furthermore, the total number of residues in a Nanobody may be in the interval 110 - 120. However, parts, fragments or analogs of Nanobodies are not particularly limited in their length and / or size, as long as such parts, fragments or analogs meet the further requirements listed below and are also suitable for the purposes described herein.

[0080] The nanobodies of the present invention belong to the same family of nanobodies, whose CDR3 amino acid sequences are of the same length, and the lengths of the framework regions FR and antigen-binding region CDR are the same or similar (difference of no more than 1 amino acid) and have high sequence identity, similar structure, and substantially equivalent antigen-binding ability.

[0081] As a method for preparing "nanoantibodies", in its broadest sense, it is not limited to specific biological resources or specific preparation methods. For example, the nanoantibodies of the present invention can be obtained by the following methods: (1) isolating the VHH domain from naturally occurring heavy chain antibodies; (2) expressing the nucleotide sequences encoding these natural VHH domains; (3) humanizing the isolated VHH domains, or expressing the humanized VHH domain encoding sequences; optionally performing FR2 backbone replacement or CDR transplantation to further optimize antibody properties; (4) preparing the desired protein, polypeptide or other amino acid sequence using synthetic or semi-synthetic technology; (5) preparing nucleic acids encoding nanoantibodies by nucleic acid synthesis technology, and then expressing them; and / or (6) any one or more of the above methods can be combined to obtain the desired nanoantibodies.

[0082] The effect of the framework region on affinity is relatively limited, so amino acid substitutions in the framework region usually do not affect the affinity of the nanobody. As long as the nanobody can exist in a soluble form, the amino acids in the framework region can also adopt the above substitution strategy.

[0083] A variation of the nanobody of the present invention also includes nanobodies obtained by replacing the FR2 backbone. Normally, FR2 does not participate in antigen recognition, but exists as a supporting structure. Therefore, we replace the FR2 of the nanobody of the present invention with the FR2 sequence of a common general nanobody, with the aim of reducing its immunogenicity and obtaining a nanobody having an amino acid sequence corresponding to a naturally occurring VHH domain, but having been humanized.

[0084] FR2 replacement is a typical example of framework region amino acid substitution. SEQ ID No: 48 to SEQ ID No: 67 in the present invention are FR2 replacement forms of SEQ ID No: 28 to SEQ ID No: 47, and none of them affects the affinity of the original sequence.

[0085] A variant of the Nanobody of the invention also includes a V HH The amino acid sequence of the nanobody corresponds to the structural domain but has been humanized. Humanization refers to the use of V from a conventional 4-chain antibody from humans. H One or more amino acid residues existing at corresponding positions in the structural domain replace the naturally occurring V HH One or more amino acid residues of a domain sequence.

[0086] A variation of the Nanobody of the present invention also includes Nanobodies obtained by humanization. SEQ ID No: 68 to SEQ ID No: 147 in the present invention are 4 humanized forms of SEQ ID No: 28 to SEQ ID No: 47, none of which affect the affinity of the original sequence.

[0087] A variation of the nanobody of the present invention also includes nanobodies obtained by CDR transplantation of nanobodies of the same family. The nanobodies of the present invention belong to the same family of nanobodies, and the CDR1 lengths are roughly the same and the properties are similar, and the CDR2 lengths are all the same and the properties are similar, so the CDR1 and CDR2 of the same family can be replaced and transplanted with each other, and the obtained new CDR-transplanted nanobodies have the same or similar properties as the original antibodies. It can be cited that SEQ ID No: 148 to SEQ ID No: 167 in the present invention are CDR transplanted forms of SEQ ID No: 28 to SEQ ID No: 47, and none of them affects the affinity of the original sequence.

[0088] In addition, the dissociation equilibrium constant (K) of the nanoantibodies of the present invention for binding to AAV D ) is 10 -7 ~10 -9 Mole / liter (M). The dissociation equilibrium constant of the present invention is measured using the plasma resonance technique.

[0089] The specific binding between the above antigen and the antigen binding molecule can be determined by any known appropriate method, including Scatchard Analysis and / or competitive binding assays such as radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA), as well as other new methods known in the art, such as plasma resonance technology (SPR) and / or biomembrane interferometry (BLI) technology, etc. It should be known to those skilled in the art that the affinity parameters measured by different methods vary greatly, and may even differ by 2 to 3 orders of magnitude.

[0090] The structure of the nanoantibody of the present invention can be determined by any appropriate method known, including Alohafold2mutimer v3 (a protein structure prediction tool used to predict the three-dimensional structure of protein complexes, which can help researchers understand how different proteins interact with each other to form complexes), Amber (a widely used molecular dynamics simulation software package that can be used to simulate the behavior of proteins and other biological molecules. In structural biology, Amber is often used to perform energy minimization, side chain optimization and molecular dynamics simulation), Relax Process (in molecular dynamics simulation, Relax Process usually refers to the process of energy minimization of protein structure to optimize the geometric configuration of side chains and reduce conflicts and poor geometric configurations within molecules), ADT (AutoDock Tools, a software toolset for molecular docking and molecular dynamics simulations that can help researchers predict the binding mode and affinity between ligands and receptors) and / or Ligplot+ (a tool for analyzing the interface of protein-ligand complexes that can identify and visualize hydrogen bonds, hydrophobic interactions and other non-covalent interactions).

[0091] The Nanobodies of the invention and the nucleic acids encoding them can be prepared in a known manner, which will be clear to those skilled in the art from the further description herein. A particularly useful method for preparing the Nanobodies and nucleic acids generally comprises the following steps:

[0092] (1) expressing a nucleic acid encoding a Nanobody of the invention in a suitable host cell or host organism or in another suitable expression system, optionally followed by;

[0093] (2) Isolating and / or purifying the Nanobody of the present invention obtained in this way.

[0094] Alternatively, other methods may include the following steps:

[0095] (3) culturing and / or maintaining the host of the invention under conditions such that the host of the invention expresses and / or produces a Nanobody of the invention; optionally followed by;

[0096] (4) Isolating and / or purifying the Nanobody of the invention thus obtained.

[0097] Nucleic acid of the present invention can be the form of single-stranded or double-stranded DNA or RNA, and preferably double-stranded DNA form.For example, nucleotide sequence of the present invention can be genomic DNA, cDNA or synthetic DNA (as DNA with codon usage that is particularly suitable for expressing in the host cell or host organism to be used, that is, codon optimized).

[0098] The nucleic acids of the invention can be prepared or obtained in a manner known per se, based on the information given herein on the amino acid sequences of the Nanobodies of the invention, and / or can be isolated from suitable natural sources. For example, for naturally occurring V HH The nucleic acid sequence of the structural domain is subjected to site-directed mutagenesis to provide the nucleic acid of the present invention encoding the analog.

[0099] Nucleic acid of the present invention can also be in such a form, is present in and / or is the part of a genetic construct, which is well known to those skilled in the art. Such a genetic construct generally comprises at least one nucleic acid of the present invention, can be in the form of a vector, such as a plasmid, YAC, viral vector or transposon. Especially, the vector can be an expression vector, that is, a vector (such as in a suitable host cell, host organism and / or expression system) for external and in vivo expression can be provided.

[0100] The nucleic acids of the invention and / or the genetic constructs of the invention can be used to transform host cells or host organisms, i.e. for expressing and / or producing the Nanobodies of the invention. Suitable hosts or host cells are well known to those skilled in the art and may for example be any suitable fungal, prokaryotic or eukaryotic cell or organelle or organism, as well as all other hosts or host cells known per se for the expression and production of antibodies and antibody fragments (including but not limited to single domain antibodies and ScFv fragments), which are well known to those skilled in the art.

[0101] For production, the Nanobodies of the invention can be produced in the milk of transgenic mammals, for example in the milk of rabbits, cows, goats or sheep, but also in plants or parts of plants, including but not limited to their leaves, flowers, fruits, roots or seeds.

[0102] As mentioned above, one advantage of using nanobodies is that polypeptides based thereon can be expressed and prepared in prokaryotic systems, and suitable prokaryotic expression systems, vectors, host cells, etc. are well known to those skilled in the art, such as the references cited above. However, it should be noted that the present invention in its broadest sense is not limited to expression in bacterial systems.

[0103] Preferably, in the present invention, the Nanobodies are produced in bacterial cells, in particular in bacterial cells suitable for large-scale drug production, as described above.

[0104] When the Nanobodies of the invention are expressed for production in cells, the Nanobodies of the invention may be produced intracellularly (e.g. in the cytoplasm or periplasmic space), then isolated from the host cell, and optionally further purified; or may be produced extracellularly (i.e. secretory expression), then isolated from the culture medium, and optionally further purified.

[0105] Some preferred but non-limiting vectors for use with these host cells include vectors for expression in mammalian cells - pMANneo (Clonetech), pUCTtag (ATCC37460) and pMClneo (Stratagene); vectors for expression in bacterial cells - pET vectors (Novagen) and pQE vectors (Qiagen); vectors for expression in yeast or other fungal cells - pYES2 (Invitrogen) and Picha expression vector (Picha expression vector) (Invitrogen); vectors for expression in insect cells - pBlueBacⅡ (Invitrogen) and other baculovirus vectors; and the like.

[0106] The corresponding techniques for transforming the host or host cell of the present invention are well known to those skilled in the art.

[0107] After transformation, those hosts that can detect and select to have transformed nucleotide sequence / genetic construct of the present invention successfully.Converted host cell (it can be in the form of stable cell line) or host organism (it can be in the form of stable mutant line or strain) form another aspect of the present invention.

[0108] The amino acid sequence of the invention can then be isolated from the host cells / host organisms and / or from the culture medium in which the host cells or host organisms are cultivated, by means of protein separation and / or purification techniques known per se, such as (preparative) chromatography and / or electrophoresis techniques, differential precipitation techniques, affinity techniques (e.g. using specific / cleavable amino acid sequences fused to the amino acid sequence of the invention) and / or preparative immunological techniques (i.e. using antibodies directed against the amino acid sequence to be isolated).

[0109] The nanobody of the present invention can specifically bind to the antigen AAV, and therefore a preferred but non-limiting application of the present invention is an AAV adsorbent, which comprises a carrier matrix and the nanobody.

[0110] The aforementioned AAV includes AAV1 to AAV10 classified by serotype, and the nanoantibody of the present invention has a broad-spectrum adsorption capacity for different serotypes of AAV.

[0111] The aforementioned carrier matrix can be a porous material, for example, agarose gel microspheres, cellulose spheres, magnetic beads, silica microspheres, activated carbon or resin microspheres, etc.

[0112] The carrier used for the aforementioned adsorbent can be obtained by commercial purchase, and specific examples include, for example, agarose gel Sepharose CL-6B (GE Healthcare, US), resin microsphere Nanomicro series (Suzhou Nanomicro Technology Co., Ltd.), but not limited to these products.

[0113] When using the above carrier, preferably, the above carrier can be activated. The activation method can be, for example, but not limited to, the following method: first, epoxy activation, then diaminopropyl imine (DADPA) activation, and finally, iodoacetic acid activation, etc.

[0114] The aforementioned adsorbent is obtained by coupling the nanobody to an activated carrier. The specific method is not particularly limited. For example, the final adsorbent can be obtained by mixing the purified nanobody solution with the carrier, separating by centrifugation, and finally washing / filtering the gel.

[0115] The adsorbent of the present invention can be used to specifically identify AAV.

[0116] The nanoantibodies or adsorbents of the present invention can be used to purify AAV and can also be used to prepare a kit for detecting AAV.

[0117] Example

[0118] The following examples are given to illustrate the specific implementation of the present invention, but the implementation of the present invention is not limited to the following examples, and any selection and change can be made within the scope that does not affect the technical effect to be achieved by the present invention.

[0119] Example 1 Construction of anti-AAV nanobody library

[0120] The phage display library used in the present invention is an immune library with T7 phage as a carrier, and the establishment steps are as follows:

[0121] (1) Alpacas (numbered 2309-1 and 2309-2) were immunized with AAV. Jugular vein blood was collected from two alpacas after four immunizations. Peripheral blood lymphocytes were isolated and total RNA was extracted (PuerLink TM RNAMini Kit, Life Technologies: 12183018A);

[0122] (3) Total RNA was reverse transcribed into cDNA and amplified using two rounds of nested PCR. HH Gene;

[0123] In the first round of PCR, cDNA was used as a template, UPprimer1 and DOWNprimer1 were used as upstream and downstream primers, respectively. After amplification, a band of 650-750 bp was recovered, which was used as a template for the second round of PCR. The upstream and downstream primers were UPprimer2 and DOWN primer2, respectively. A PCR product of 450-500 bp was recovered.

[0124] UPprimer1:CTTGGTGGTCCTGGCTGCTCT,

[0125] DOWNprimer1:GGTACGTGCTGTTGAACTGTTCC,

[0126] UPprimer2:TATCTAGTC GAATTC CGCCCAGGTGCAGCTC,

[0127] DOWNprimer2: AGCGACTAAGCTTTGAGGAGACGGTGAC;

[0128] (3) The PCR product was double-digested with EcoR Ι and Hind Ⅲ and subjected to agarose electrophoresis to recover the 350-500 bp gene band, which was V HH Gene fragments;

[0129] (4) Use T4 ligase to connect the T7 vector ( 10-3Cloning Kit,Meterck Metillipore 70550-3) and V HH Gene fragments;

[0130] (5) mixing the ligation product with the packaging protein to form a complete T7 phage, amplifying the mixture to obtain a phage original library;

[0131] (6) After testing, the titer of the original library was 8.82×10 9 pfu / mL, with a diversity of 6.1×10 6 .

[0132] Example 2 Screening of Nanobodies

[0133] First, dilute the antigen (AAV2) to 10 μg / mL with TBS, take 100 μL and add it to a 96-well plate, and incubate at 4°C for 12 hours. Aspirate the antigen dilution in the well, wash the plate 3 times with TBS, pat dry, add 1% protein-free blocking solution (purchased from Sangon Biotechnology Co., Ltd.), 300 μL / well, and incubate at room temperature for 2 hours (1% protein-free blocking solution and 1% BSA are used alternately during screening). Aspirate the blocking agent in the well, wash the plate 6 times with TBST, pat dry, add the amplified phage, 100 μL / well, and incubate at room temperature for 30 minutes. Wash the plate 10 times with TBST, add T7 elution buffer (1% SDS) to elute the phage, incubate at room temperature for 30 minutes, and amplify the eluate for the next round of screening.

[0134] The antigen (AAV6) was then diluted and coated in the same manner, and the eluate was incubated, selected, and amplified again for the next round of screening.

[0135] The antigen (AAV8) was diluted and coated in the same manner, and the above eluate was incubated, panned, and amplified again for the next round of screening.

[0136] The antigen (AAV9) was diluted and coated in the same manner, and the above eluate was incubated, selected, and amplified again.

[0137] Example 3 Construction of genetically engineered bacteria

[0138] (1) After four rounds of screening, the screening eluate was solid amplified, plaques were picked, and PCR amplification was performed using the plaque amplification solution as a template and UPprimer3 and DOWNprimer3 as upstream and downstream primers;

[0139] UPprimer3:TTCCTTAA CATATG GCCCAGGTGCAGCTCGT,

[0140] DOWNprimer3:TTAAGGAA CTCGAG CACGGTGACCAGGGTC;

[0141] (2) A portion of the PCR products were outsourced for sequencing to obtain the sequence information of the nanobody. Based on the length and homology of the CDR region, it was found that the 20 monoclonal clones belonged to the same family. The nanobody naming and sequence number information are shown in Table 1.

[0142] (3) Another part of the PCR product was double-digested with NdeI and XhoI, and the digestion product was recovered. At the same time, the digestion was performed in the same way and the vector was recovered. The digestion product and the vector were ligated with T4 ligase, and the ligation product was transferred into Escherichia coli to obtain a genetically engineered bacterium expressing AAV-specific nanobodies.

[0143] Table 1 Comparison table of nanobody naming and sequence numbers

[0144]

[0145] Example 4 Preparation of AAV Nanobodies

[0146] (1) The basic culture medium of the nanobody is TB medium, which is inoculated at a 5% inoculum and cultured at 37°C for 3-5 h, and the inducer IPTG (final concentration 0.25 mM, the same below) is added for overnight induction;

[0147] (2) After induction, centrifuge at 4000 rpm for 20 min to obtain wet bacteria containing nanobodies;

[0148] (3) Add lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.40.02M PB) to the obtained wet bacteria at a ratio of 1:10, and use a 700 bar high-pressure homogenizer to disrupt the cells;

[0149] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0150] (5) The supernatant was filtered through a 0.45 μm filter and then passed through an affinity chromatography column (GE Healthcare, US) for separation and purification of AAV nanobodies, wherein the filler of the affinity chromatography column was Ni Sepharose High Performance;

[0151] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method. The SDS-PAGE of the purified nanoantibodies was shown in Figure 1 In the present invention, the nano antibody bands are correct and the purity is high after one purification. Since the nano antibodies of the present invention belong to the same family, their molecular weights and charges are similar, so their electrophoretic band positions are also roughly the same. Figure 1 (Top), from left to right: A1-A3 before purification, marker, A4, A5, B1-B5 after purification; Figure 1 (Bottom), from left to right: maker, C1 to C5, D1 to D5.

[0152] Example 5

[0153] The SPR technique was used to analyze the binding ability of nanobodies to AAV. AAV was amino-coupled to a CM5 sensor chip at a density of 500-800 RU, and nanobodies were injected at 7 different concentrations ranging from 1 to 100 nM. The flow rate was 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K a , K d and K D . Figure 2 The middle curves are the response curves of the nanobody at 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM, and 1.5625 nM concentrations from top to bottom (limited by space, Figure 2 Only the kinetic sensorgrams of the nanobodies with sequence names C1, C2, C3, C4 and C5 are given, and the kinetic parameters shown in Table 2 are calculated by equation fitting. The nanobodies have high affinity for AAV2, AAV6, AAV8 and AAV9, and K D Range 10 -7 ~10 -9 (M).

[0154] Table 2 Affinity of nanobodies to different AAVs

[0155]

[0156]

[0157] Example 6: Calculation of key amino acids

[0158] Using sequence C1 and VP (Virus Particle, virus particle capsid protein) capsid as model proteins, molecular docking was performed to predict the antigen binding epitope of VHH (single domain antibody) on VP and the key amino acids in the interaction.

[0159] First, the VP monomer sequence and structure were separated from the VP protein assembly crystal structure. After combining the VP sequence and VHH antibody sequence, Alohafold2 mutimer v3 was used to predict and search the complex structure. After the complex structure was generated, Amber was used to perform Relax Process on the complex structure to optimize the side chain structure, ADT was used to check hydrogen atoms and calculate potentials, Ligplot+ was used to analyze the hydrogen bonds and hydrophobic interaction network between the amino acids in the CDR region of VHH and the VP binding interface, and the atomic contacts between the domains were checked. After checking that there were no atomic conflicts between the domains in multiple assembled VP monomer structures, a reasonable conformation that met the above conditions was selected as the structural model of the VHH antibody and VP protein complex.

[0160] Through molecular docking, it is predicted that the binding epitope of VHH in AAV is in the depression of the 3F structure responsible for cell receptor recognition, which is consistent with the characteristics of the binding epitope of nanoantibodies in general. The docking diagram is shown in Figure 3a , 3b and 3c, where Figure 3a This is a molecular docking diagram and a partial enlarged diagram of the nanobody and AAV capsid protein of Example 6, in order to further and more clearly show the relationship between each site and the docking, Figure 3b and Figure 3c The local magnified images of different angles of the molecular docking diagram are shown. It can be seen that the main amino acid residues involved in antigen recognition and binding on VHH (blue) are W99, D101, and Y103, which bind to R487, R490, K530, E533, T576, and E577 (pink side chains) on the AAV capsid (gray) through hydrophobic interactions, electrostatic interactions, and hydrogen bonding interactions. These six amino acid residues on the AAV capsid are conserved in different serotypes of AAV, which is consistent with the experimental evidence that VHH broadly binds to different serotypes (Table 2).

[0161] Example 7: FR2 replacement of Nanobodies

[0162] (1) Sequence construction. By comparing with a large number of publicly available nanoantibody sequences, it was found that the FR2 region of the nanoantibody of the present invention is quite different from the FR2 region of most nanoantibodies. Abnormal charge distribution and polarity distribution may affect the stability of the nanoantibody skeleton; and may increase the immunogenicity of the nanoantibody. When used for affinity purification filler ligands later, high immunogenicity may pose a safety risk. Generally speaking, FR2 does not participate in antigen recognition and only serves as a framework structure. Therefore, we replaced the FR2 of the nanoantibody of the present invention with the common general nanoantibody FR2 to reduce its immunogenicity. The constructed sequence was outsourced for synthesis, connected to the plasmid vector pET22b, and fused to the His6 tag on the expression vector for detection and purification.

[0163] The sequences are: A1-FR2 (SEQ ID No: 48), A2-FR2 (SEQ ID No: 49), A3-FR2 (SEQ ID No: 50), A4-FR2 (SEQ ID No: 51), A5-FR2 (SEQ ID No: 52), B1-FR2 (SEQ ID No: 53), B2-FR2 (SEQ ID No: 54), B3-FR2 (SEQ ID No:55), B4-FR2 (SEQ ID No:56), B5-FR2 (SEQ ID No:57), C1-FR2 (SEQ ID No:58), C2-FR2 (SEQ ID No:59), C3-FR2 (SEQ ID No:60), C4-FR2 (SEQ ID No:61), C5-FR2 (SEQ ID No: 62), D1-FR2 (SEQ ID No: 63), D2-FR2 (SEQ ID No: 64), D3-FR2 (SEQ ID No: 65), D4-FR2 (SEQ ID No: 66), D5-FR2 (SEQ ID No: 67).

[0164] (2) Preparation of recombinant strains. The recombinant plasmid was transformed into the Escherichia coli BL21 (DE3) strain by chemical transformation, spread on a solid LB plate containing ampicillin, and cultured in an incubator at 37°C overnight. A single clone was picked and activated in LB medium containing ampicillin. After sequencing was correct, glycerol was added to a final concentration of 20% and the clone was frozen for bacterial preservation.

[0165] (3) Periplasmic expression and extraction. Add 1 mL of LB medium containing ampicillin to a 96-well deep-well plate, inoculate the frozen bacteria into the wells, and culture at 37°C with a shaker at 180 rpm for 4 hours. Add IPTG to a final concentration of 0.5 mM and continue to culture at 30°C for 16 hours. Centrifuge the deep-well plate at 3500 g for 10 min, discard the medium, add 300 μL of TES solution to resuspend, incubate at 4°C for 30 min, add 300 μL of ddH2O, mix, and continue to incubate at 4°C for 30 min. Centrifuge at 3500 g for 10 min to precipitate cell debris, transfer the supernatant to a new 96-well plate, add 60 μL of blocking agent, and use it for ELISA testing.

[0166] The ELISA results are shown in Table 3. All the nanobodies after FR2 replacement were positive. Note: The error and fluctuation range of the periplasmic extract ELISA are large, and it is only used as a preliminary qualitative characterization of the binding ability of the nanobody, and the numerical value has no comparative significance.

[0167] Table 3 Binding ability of nanobodies after FR2 replacement to different serotypes of AAV

[0168] sequence Negative control AAV2 AAV6 AAV8 AAV9 A1-FR2 0.071 0.636 0.297 1.237 0.585 A2-FR2 0.083 0.308 0.275 0.689 0.328 A3-FR2 0.069 0.571 0.264 0.833 0.786 A4-FR2 0.085 0.852 0.568 1.321 1.182 A5-FR2 0.068 0.315 0.247 0.458 0.342 B1-FR2 0.064 0.936 0.542 0.996 0.754 B2-FR2 0.085 1.658 1.185 1.928 1.586 B3-FR2 0.069 0.564 0.404 0.681 0.546 B4-FR2 0.070 0.921 0.783 1.555 0.951 B5-FR2 0.079 1.325 0.763 1.860 1.563 C1-FR2 0.072 1.260 1.270 1.889 1.745 C2-FR2 0.090 0.810 0.473 0.920 0.690 C3-FR2 0.084 1.320 1.323 1.907 1.523 C4-FR2 0.076 1.130 0.812 1.652 1.269 C5-FR2 0.076 0.647 0.539 1.080 0.616 D1-FR2 0.078 1.489 1.192 2.073 1.525 D2-FR2 0.077 0.549 0.397 0.889 0.762 D3-FR2 0.081 0.991 0.653 1.592 1.061 D4-FR2 0.074 1.274 0.641 1.787 1.564 D5-FR2 0.080 0.524 0.370 0.733 0.511

[0169] (4) Large-scale preparation of nanobodies

[0170] The preparation process was the same as that of the AAV nanobody in Example 4. After expression and purification, the SPR technology was used to analyze the binding ability of the nanobody to AAV2. AAV2 was amino-coupled to the CM5 sensor chip at a density of 500-800 RU, and the nanobody was injected at 7 different concentrations in the range of 1-100 nM. The flow rate was 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K a , K d and K D As shown in Table 4, the nanobody after FR2 replacement still has a high affinity for AAV2, which is roughly equivalent to the affinity of the nanobody before FR2 replacement.

[0171] Table 4 Affinity of Nanobodies after FR2 Replacement for AAV2

[0172]

[0173]

[0174] Example 8: Humanization of Nanobodies and Affinity Determination

[0175] In order to reduce the immunogenicity of nanobodies while maintaining or improving the stability and biological activity of nanobodies, the present invention performs CDR region transplantation based on commonly used humanized or highly stable nanobody frameworks to complete the humanization and stability modification of nanobodies.

[0176] (1) Sequence design

[0177] The present invention selects four nano antibody skeletons for modification, namely ah, FGLA, hs2dAb (hereinafter referred to as hs) and com skeletons.

[0178] The ah skeleton is a universal fully humanized skeleton taken from the literature (Chi, XJ et al. Humanized single domain antibodies neutralize SARS-CoV-2 by targeting the spike receptor binding domain. Nature Communications 11, doi: 10.1038 / s41467-020-18387-8 (2020).).

[0179] FGLA is a universal fully humanized scaffold taken from the literature (Vincke, C. et al. General Strategy to Humanize a Camelid Single-domain Antibody and Identification of a Universal Humanized Nanobody Scaffold. J. Biol. Chem. 284, 3273-3284, doi: 10.1074 / jbc.M806889200 (2009).).

[0180] hs is a highly stable, highly expressed, partially humanized skeleton from the literature (Moutel, S. et al. NaLi-H1: Audience synthetic library of humanized nanobodies providing highly functional antibodies and intrabodies. Elife 5, doi: 10.7554 / eLife.16228 (2016).).

[0181] com is a universal skeleton with high stability and high expression, which comes from the literature (Ferrari, D., Garrapa, V., Locatelli, M. & Bolchi, AA Novel Nanobody Scaffold Optimized for Bacterial Expression and Suitable for the Construction of Ribosome Display Libraries. Molecular Biotechnology 62, 43-55, doi: 10.1007 / s12033-019-00224-z (2020).).

[0182] The modified sequence names and serial numbers are shown in Table 5.

[0183] Table 5. Serial names and serial numbers after modification

[0184]

[0185]

[0186] (2) Vector construction: The humanized nanobody sequence was outsourced for full synthesis and constructed into the expression vector pET22b and expression strain.

[0187] (3) Preparation of recombinant strains. The recombinant plasmid was transformed into the Escherichia coli BL21 (DE3) strain by chemical transformation, spread on a solid LB plate containing ampicillin, and cultured in an incubator at 37°C overnight. A single clone was picked and activated in LB medium containing ampicillin. After sequencing was correct, glycerol was added to a final concentration of 20% and the clone was frozen for bacterial preservation.

[0188] (3) Periplasmic expression and extraction. Add 1 mL of LB medium containing ampicillin to a 96-well deep-well plate, inoculate the frozen bacteria into the wells, and culture at 37°C with a shaker at 180 rpm for 4 hours. Add IPTG to a final concentration of 0.5 mM and continue to culture at 30°C for 16 hours. Centrifuge the deep-well plate at 3500 g for 10 min, discard the medium, add 300 μL of TES solution to resuspend, incubate at 4°C for 30 min, add 300 μL of ddH2O, mix, and continue to incubate at 4°C for 30 min. Centrifuge at 3500 g for 10 min to precipitate cell debris, transfer the supernatant to a new 96-well plate, add 60 μL of blocking agent, and use it for ELISA testing.

[0189] The ELISA results are shown in Table 6. The humanized nanobodies were positive for all four AAVs, proving that all the modified nanobodies have the ability to bind to AAV.

[0190] Table 6 Binding ability of humanized nanobodies to different serotypes of AAV

[0191]

[0192]

[0193]

[0194] The preparation process of Nanobodies is as described in Example 7, and the affinity characterization of Nanobodies is as described in Example 5. The binding curves obtained at different Nanobodies concentrations were used to calculate the kinetic parameter K a , K d and K D Table 7 is obtained.

[0195] Table 7 Affinity of Nanobodies C1-C5 and Humanized Nanobodies

[0196]

[0197]

[0198] Compared with the original sequence, the affinity of the humanized nanobody to the antigen AAV has not been significantly reduced, and the affinity to the relevant antigen remains at the same order of magnitude. For example, the affinity of C1 to AAV2, AAV6, AAV8, and AAV9 is 1.78×10 -8 ,7.43×10 -8 4.30×10 -9 ,8.13×10 -9 M, the affinity ranking of its four humanized sequences C1-ah, C1-FLAG, C1-com and C1-hs for the above four antigens is still 10 -8 , 10 -8 , 10 -9 , 10 -9 The affinities of the humanized forms of M. C2-C5 are also roughly equivalent to those of the original sequences and are in the same order of magnitude.

[0199] Example 9: CDR replacement between nanobodies of the same family

[0200] The nanobodies of the present invention belong to the same family of nanobodies, with CDR1 of roughly the same length and similar properties, and CDR2 of the same length and similar properties, so CDR1 and CDR2 within the same family can be replaced and transplanted with each other, and the resulting new CDR-transplanted nanobodies have the same or similar properties to the original antibodies.

[0201] The sequence modification method is as follows:

[0202] The CDR1 of A1 (SEQ ID No: 28) was replaced by CDR1-1 (SEQ ID No: 5) to CDR1-2 (SEQ ID No: 6), and the CDR2 was replaced by CDR2-1 (SEQ ID No: 17) to CDR2-5 (SEQ ID No: 21), to obtain a new sequence SEQ ID No: 148;

[0203] The CDR1 of A2 (SEQ ID No: 29) was replaced by CDR1-1 (SEQ ID No: 5) to CDR1-3 (SEQ ID No: 7), and the CDR3 was replaced by CDR2-2 (SEQ ID No: 18) to CDR2-6 (SEQ ID No: 22), to obtain a new sequence SEQ ID No: 149;

[0204] The CDR1 of A3 (SEQ ID No: 30) was replaced by CDR1-2 (SEQ ID No: 6) to CDR1-4 (SEQ ID No: 8), and the CDR4 was replaced by CDR2-1 (SEQ ID No: 17) to CDR2-5 (SEQ ID No: 21), to obtain a new sequence SEQ ID No: 150;

[0205] The CDR1 of A4 (SEQ ID No: 31) was replaced by CDR1-2 (SEQ ID No: 6) to CDR1-5 (SEQ ID No: 9), and the CDR5 was replaced by CDR2-2 (SEQ ID No: 18) to CDR2-7 (SEQ ID No: 23), to obtain a new sequence SEQ ID No: 151;

[0206] The CDR1 of A5 (SEQ ID No: 32) was replaced by CDR1-1 (SEQ ID No: 5) to CDR1-6 (SEQ ID No: 10), and the CDR6 was replaced by CDR2-3 (SEQ ID No: 19) to CDR2-6 (SEQ ID No: 22), to obtain a new sequence SEQ ID No: 152;

[0207] The CDR1 of B1 (SEQ ID No: 33) was replaced by CDR1-2 (SEQ ID No: 6) to CDR1-7 (SEQ ID No: 11), and the CDR7 was replaced by CDR2-4 (SEQ ID No: 20) to CDR2-8 (SEQ ID No: 24), to obtain a new sequence SEQ ID No: 153;

[0208] The CDR1 of B2 (SEQ ID No: 34) was replaced by CDR1-3 (SEQ ID No: 7) to CDR1-7 (SEQ ID No: 11), and the CDR8 was replaced by CDR2-3 (SEQ ID No: 19) to CDR2-9 (SEQ ID No: 25), to obtain a new sequence SEQ ID No: 154;

[0209] The CDR1 of B3 (SEQ ID No: 35) was replaced by CDR1-4 (SEQ ID No: 8) to CDR1-8 (SEQ ID No: 12), and the CDR9 was replaced by CDR2-3 (SEQ ID No: 19) to CDR2-10 (SEQ ID No: 26), to obtain a new sequence SEQ ID No: 155;

[0210] The CDR1 of B4 (SEQ ID No: 36) was replaced by CDR1-5 (SEQ ID No: 9) to CDR1-8 (SEQ ID No: 12), and the CDR10 was replaced by CDR2-4 (SEQ ID No: 20) to CDR2-11 (SEQ ID No: 27), to obtain a new sequence SEQ ID No: 156;

[0211] The CDR1 of B5 (SEQ ID No: 37) was replaced from CDR1-6 (SEQ ID No: 10) to CDR1-9 (SEQ ID No: 13), and the CDR11 was replaced from CDR2-3 (SEQ ID No: 19) to CDR2-10 (SEQ ID No: 26), to obtain a new sequence SEQ ID No: 157;

[0212] The CDR1 of C1 (SEQ ID No: 38) was replaced by CDR1-7 (SEQ ID No: 11) to CDR1-10 (SEQ ID No: 14), and the CDR12 was replaced by CDR2-5 (SEQ ID No: 21) to CDR2-1 (SEQ ID No: 17), to obtain a new sequence SEQ ID No: 158;

[0213] The CDR1 of C2 (SEQ ID No: 39) was replaced by CDR1-7 (SEQ ID No: 11) to CDR1-10 (SEQ ID No: 14), and the CDR13 was replaced by CDR2-6 (SEQ ID No: 22) to CDR2-2 (SEQ ID No: 18), to obtain a new sequence SEQ ID No: 159;

[0214] The CDR1 of C3 (SEQ ID No: 40) was replaced by CDR1-8 (SEQ ID No: 12) to CDR1-10 (SEQ ID No: 14), and the CDR14 was replaced by CDR2-5 (SEQ ID No: 21) to CDR2-1 (SEQ ID No: 17), to obtain a new sequence SEQ ID No: 160;

[0215] The CDR1 of C4 (SEQ ID No: 41) was replaced by CDR1-8 (SEQ ID No: 12) to CDR1-11 (SEQ ID No: 15), and the CDR15 was replaced by CDR2-7 (SEQ ID No: 23) to CDR2-2 (SEQ ID No: 18), to obtain a new sequence SEQ ID No: 161;

[0216] The CDR1 of C5 (SEQ ID No: 42) was replaced by CDR1-9 (SEQ ID No: 13) to CDR1-12 (SEQ ID No: 16), and the CDR16 was replaced by CDR2-6 (SEQ ID No: 22) to CDR2-3 (SEQ ID No: 19), to obtain a new sequence SEQ ID No: 162;

[0217] The CDR1 of D1 (SEQ ID No: 43) was replaced by CDR1-10 (SEQ ID No: 14) to CDR1-1 (SEQ ID No: 5), and the CDR17 was replaced by CDR2-8 (SEQ ID No: 24) to CDR2-1 (SEQ ID No: 17), to obtain a new sequence SEQ ID No: 163;

[0218] The CDR1 of D2 (SEQ ID No: 44) was replaced by CDR1-10 (SEQ ID No: 14) to CDR1-1 (SEQ ID No: 5), and the CDR18 was replaced by CDR2-9 (SEQ ID No: 25) to CDR2-2 (SEQ ID No: 18), to obtain a new sequence SEQ ID No: 164;

[0219] The CDR1 of D3 (SEQ ID No: 45) was replaced by CDR1-10 (SEQ ID No: 14) to CDR1-2 (SEQ ID No: 6), and the CDR19 was replaced by CDR2-10 (SEQ ID No: 26) to CDR2-2 (SEQ ID No: 18), to obtain a new sequence SEQ ID No: 165;

[0220] The CDR1 of D4 (SEQ ID No: 46) was replaced by CDR1-11 (SEQ ID No: 15) to CDR1-1 (SEQ ID No: 5), and the CDR20 was replaced by CDR2-11 (SEQ ID No: 27) to CDR2-1 (SEQ ID No: 17), to obtain a new sequence SEQ ID No: 166;

[0221] The CDR1 of D5 (SEQ ID No: 47) was replaced by CDR1-12 (SEQ ID No: 16) to CDR1-1 (SEQ ID No: 5), and the CDR21 was replaced by CDR2-10 (SEQ ID No: 26) to CDR2-1 (SEQ ID No: 17), to obtain a new sequence SEQ ID No: 167.

[0222] The above sequence was outsourced for synthesis, and vector preparation, genetic engineering bacteria preparation, periplasmic expression, large-scale preparation and expression purification as well as affinity determination were carried out in the manner described in Example 7.

[0223] The binding ability of the CDR-replaced nanobody to AAV was characterized by ELISA experiment. The experimental process was as described in Example 7. The experimental results are shown in Table 8. The ELISA results show that the CDR-replaced nanobody has the ability to bind to multiple AAVs.

[0224] Table 8 Binding ability of nanobodies to AAV after CDR replacement

[0225]

[0226]

[0227] The affinity characterization of the CDR-substituted Nanobodies was as described in Example 5. The binding curves obtained at different Nanobody concentrations were used to calculate the kinetic parameter K a , K d and K D Table 9 is obtained.

[0228] Table 9 Affinity of Nanobodies after CDR Replacement

[0229]

[0230] Compared with the original sequence, the affinity of the humanized nanobody to the antigen AAV was not significantly reduced. For example, the affinity of C4 to AAV2, AAV6, AAV8, and AAV9 was 4.21×10 -8 ,8.38×10 -8 ,4.39×10 -9 , 2.45×10 -8 M, the affinity level of its CDR-transplanted sequence C4-CDR for AAV2, AAV6, and AAV8 antigens is still 10 -8 , 10 -8 , 10 -9 The affinity of C4-CDR for AAV9 antigen was slightly increased to 10 -9 M. The affinities of the CDR-grafted forms of C1, C2, C3, and C5 were also roughly equivalent to the affinities of the original sequences, with fluctuations of no more than one order of magnitude, which were within the range of comparable affinities.

[0231] Example 10 AAV preparation

[0232] HEK293T cells were cultured and replaced with antibiotic-free medium one day before transfection for 12-24 h to allow the cell density to reach 80%.

[0233] Prepare EZ-Trans-DNA complex. Tube A: pAAV-hrGFP, pAAV-RC, pHelper in a 1:1:1 molar ratio. The total amount of the three plasmids is 36μg / 15mL cells, which is supplemented with DMEM; Tube B: 108μL EZ Trans transfection reagent diluted with DMEM. Mix well. Let stand at room temperature for 10-15 minutes.

[0234] Transfect cells. Slowly drop the prepared transfection system into the culture dish, 3 mL / dish; slowly shake the culture dish to mix, and place it in the incubator for culture. After 24 hours of culture, replace the medium with new culture medium, and use a fluorescence microscope to observe the transfection efficiency.

[0235] Virus collection: 48-72 hours after transfection, the virus can be collected by scraping the cells with a cell scraper and collecting them in a 50mL centrifuge tube. Centrifuge at 200×g for 5 minutes to collect the cell pellet. Resuspend the cells with PBS and disrupt them by ultrasound.

[0236] Example 11 Preparation and effect evaluation of AAV adsorbent

[0237] Activation of agarose gel. Take 2g of agarose microspheres, add 2mol / LNaOH and 0.8mL of 1,4-butanediol diglycidyl ether, mix them in this proportion, and react for more than 60min. After the reaction is completed, wash the gel with a large amount of deionized water and filter it into a wet cake.

[0238] Immobilization of AAV nanobodies. Take the activated agarose gel carrier material, add 2 mL of nanobody solution (PBS is used to prepare the nanobody solution in this embodiment, and physiological saline or pure water can also be used), and react at 37°C and 250rpm for 24 hours. After the reaction is completed, add 3 times the volume of ethanolamine (6% by volume, pH 9.0) for overnight blocking to obtain an AAV adsorbent.

[0239] 1 mL of the prepared AAV adsorbent was loaded into a chromatographic column with a height of 2 cm. After loading, the column was first rinsed with the equilibration buffer; then the sample was loaded, and then the equilibration buffer was used to rinse again; then the elution was performed with the elution buffer. The total amount of AAV in the sample, flow-through, equilibration solution, and elution solution was determined, and the AAV yield was calculated. Among them, VP represents the number of viral capsid particles.

[0240] AAV yield = AAV elution amount (VP) ÷ AAV binding amount (VP) × 100%

[0241] Equilibration buffer: 10 mM Tris-300 mM NaCl, pH 7.6; elution buffer: 0.1 M NaAc, 0.5 M NaCl, pH 1.5.

[0242] Results: The adsorbents synthesized with original and modified nanoantibodies can effectively bind to different serotypes of AAV. During the synthesis of the adsorbent, the coupling density of the ligand on the adsorbent can be regulated by changing the protein solution concentration, epoxy density and glue ratio.

[0243] Increasing the double density can help obtain a higher AAV load and reduce the flow-through ratio. Without overloading, it can increase the titer of the sample and help obtain a higher yield.

[0244] ① The nano antibody is A1, the initial concentration is 8.8 mg / mL, the epoxy density on the gel is 5 μmol / g, the gel-water ratio is 1:7, the protein utilization rate is 33.6%, and the final nano antibody coupling amount is 20.7 mg / g adsorbent. The adsorbent has a binding capacity of 7.23E+14 for AAV9, a flow-through rate of 15.92%, an elution volume of 5.99E+14, and a yield of 82.82%.

[0245] ② The nano antibody is B1, the initial concentration is 7.0 mg / mL, the epoxy density on the gel is 5 μmol / g, the gel-water ratio is 1:3, the protein utilization rate is 36.7%, and the final nano antibody coupling amount is 7.7 mg / g adsorbent. The adsorbent has a binding capacity of 2.50E+14 for AAV2, a flow-through rate of 18.26%, an elution volume of 1.97E+14, and a yield of 78.94%.

[0246] ③ The nano antibody is C1, the initial concentration is 6.7 mg / mL, the epoxy density on the gel is 3 μmol / g, the gel-water ratio is 1:5, the protein utilization rate is 34.6%, and the final nano antibody coupling amount is 11.6 mg / g adsorbent. The adsorbent has a binding capacity of 6.29E+14 for AAV6, a flow-through rate of 16.08%, an elution volume of 4.98E+14, and a yield of 79.08%.

[0247] ④ The nano antibody is D1, the initial concentration is 5.7 mg / mL, the epoxy density on the gel is 3 μmol / g, the gel-water ratio is 1:3, the protein utilization rate is 46.4%, and the final nano antibody coupling amount is 7.9 mg / g adsorbent. The adsorbent has a binding capacity of 6.59E+14 for AAV8, a flow-through rate of 18.38%, an elution volume of 5.28E+14, and a yield of 80.04%.

[0248] ⑤ The nano antibody is A1-FR2, the initial concentration is 5.1 mg / mL, the epoxy density on the gel is 2 μmol / g, the gel-water ratio is 1:5, the protein utilization rate is 22.9%, and the final nano antibody coupling amount is 5.9 mg / g adsorbent. The adsorbent has a binding capacity of 6.24E+13 for AAV2, a flow-through rate of 17.09%, an elution volume of 4.84E+13, and a yield of 77.52%.

[0249] ⑥ The nano antibody is B1-com, the initial concentration is 3.8 mg / mL, the epoxy density on the gel is 2 μmol / g, the gel-water ratio is 1:3, the protein utilization rate is 26.8%, and the final nano antibody coupling amount is 3.1 mg / g adsorbent. The adsorbent has a binding capacity of 5.73E+13 for AAV6, a flow-through rate of 20.22%, an elution volume of 4.30E+13, and a yield of 75.06%.

[0250] ⑦ The nano antibody is C1-hs, the initial concentration is 8.9 mg / mL, the epoxy density on the gel is 3 μmol / g, the gel-water ratio is 1:5, the protein utilization rate is 36.1%, and the final nano antibody coupling amount is 16.1 mg / g adsorbent. The adsorbent has a binding capacity of 5.52E+13 for AAV8, a flow-through rate of 10.74%, an elution volume of 4.53E+13, and a yield of 82.02%.

[0251] ⑧ The nano antibody is D1-CDR, the initial concentration is 9.0 mg / mL, the epoxy density on the gel is 3 μmol / g, the gel-water ratio is 1:3, the protein utilization rate is 43.0%, and the final nano antibody coupling amount is 11.6 mg / g adsorbent. The adsorbent has a binding capacity of 7.29E+13 for AAV9, a flow-through rate of 12.84%, an elution volume of 5.81E+13, and a yield of 79.67%.

[0252] In summary, the AAV adsorbent prepared by the present invention has the ability to bind to AAVs of different serotypes with a high yield, and is a new broad-spectrum AAV adsorbent that can be used for the purification of AAVs of different serotypes.

[0253] Example 12 Preparation of AAV Detection Kit

[0254] Nanobody A1 was replaced with PBS (pH 7.4) to a concentration of about 10 mg / mL and conjugated using an HRP conjugation kit (abcam, ab102890) and dialyzed thoroughly.

[0255] Direct ELISA test method:

[0256] Add AAV standard or test sample to a highly hydrophobic 96-well plate, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; block with 1% to 3% skim milk powder and wash the plate with PBS; add HRP-coupled nanoantibody A1, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; add TMB working solution, incubate at room temperature in the dark for 30 minutes, add 2M sulfuric acid stop solution to terminate the reaction, and measure OD 450 . (OD 450It is the absorbance (Optical Density) measured at a wavelength of 450 nanometers (nm), which is used to quantitatively analyze the concentration of substances in a solution.

[0257] Sandwich ELISA test method:

[0258] The capture ligand was coated on a highly hydrophobic 96-well plate, incubated overnight at 4°C in the dark, and the plate was washed with PBS; 1% to 3% skim milk powder was used for blocking, and the plate was washed with PBS; AAV standard or the sample to be tested was added, incubated on a horizontal shaker for 2 hours, and the plate was washed with PBS; HRP-coupled nanoantibody A1 was added, incubated on a horizontal shaker for 2 hours, and the plate was washed with PBS; TMB working solution was added, incubated at room temperature in the dark for 30 minutes, 2M sulfuric acid stop solution was added to terminate the reaction, and the OD was measured. 450 .

[0259] The capture ligand can be nanobody A1 or other nanobodies in the present invention, or anti-AAV antibody, or other ligand molecules that can bind to AAV. The capture antibody used in this embodiment is C1-CDR.

[0260] The standard curve of AAV8 measured by the kit of the present invention is as follows Figure 4 and Figure 5 As shown, Figure 4 is the standard curve of direct ELISA detection, y=7.052E-11x-8.152E-02, R 2 =9.989E-01. Figure 5 is the standard curve of sandwich ELISA detection. The fitting curve used is a four-parameter logistic curve fitting. The fitting result is: y = (AD) / [1 + (x / C) ^ B] + D, where A = 3.52036, B = -2.07294, C = 355.92016, D = 0.11490, R 2 =0.99948. 2 All of them can reach above 0.99, indicating that the ELISA detection method established based on the nanobody of the present invention has strong reliability and high sensitivity.

[0261] The prior art uses real-time quantitative PCR detection technology to detect viral particles containing DNA, but cannot detect empty capsids. The present invention can detect empty capsids and viral particles together. The detection of empty capsids is very important because empty capsids are not beneficial for treatment and may even increase immunogenicity. Therefore, quantitative detection of empty capsids and control of their content are key links in AAV preparation.

[0262] Industrial Applicability

[0263] The nanobody of the present invention is an anti-AAV nanobody with a new amino acid sequence discovered by screening a phage library. The nanobody, its FR2-substituted nanobody, humanized nanobody and CDR-grafted nanobody have high affinity and activity, and can specifically recognize and bind to AAV. The prepared affinity chromatography column has a very strong adsorption capacity for AAV and can be used for AAV purification. The prepared detection kit can be used for detecting AAV and quantitative analysis.

[0264] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A nanobody, characterized in that The variable region in the amino acid sequence of the nanobody includes a complementary determining region CDR and a framework region FR, wherein the complementary determining region CDR includes a complementary determining region CDR1, a complementary determining region CDR2 and a complementary determining region CDR3, and the nanobody can recognize and specifically bind to AAV, wherein the complementary determining region CDR3 is of the ArgTrpProAspXaaTyr family, wherein the Xaa is selected from Pro, Arg or Gly, and the binding sites of the complementary determining region CDR3 and AAV are Trp99, Asp101 and Tyr103.

2. The Nanobody according to claim 1, characterized in that The amino acid sequence of the complementary determining region CDR3 is selected from SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3 or SEQ ID No: 4, and an amino acid sequence with a homology of more than 75% with SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3 or SEQ ID No:

4.

3. The Nanobody according to claim 2, characterized in that The amino acid sequence of the complementary determining region CDR1 is selected from any one of SEQ ID No: 5 to SEQ ID No: 16; the amino acid sequence of the complementary determining region CDR2 is selected from any one of SEQ ID No: 17 to SEQ ID No:

27.

4. The Nanobody according to claim 3, comprising a CDR1 as shown in SEQ ID No: 5, a CDR2 as shown in SEQ ID No: 17, and a CDR3 as shown in SEQ ID No: 1; or The amino acid sequence is CDR1 as shown in SEQ ID No: 5, CDR2 as shown in SEQ ID No: 18, CDR3 as shown in SEQ ID No: 1; or The amino acid sequence is CDR1 as shown in SEQ ID No: 6, CDR2 as shown in SEQ ID No: 17, CDR3 as shown in SEQ ID No: 1; or The amino acid sequence is CDR1 as shown in SEQ ID No: 6, CDR2 as shown in SEQ ID No: 18, CDR3 as shown in SEQ ID No: 1; or The amino acid sequence is CDR1 as shown in SEQ ID No: 5, CDR2 as shown in SEQ ID No: 19, CDR3 as shown in SEQ ID No: 1; or The amino acid sequence is CDR1 as shown in SEQ ID No: 6, CDR2 as shown in SEQ ID No: 20, CDR3 as shown in SEQ ID No: 2; or The amino acid sequence is CDR1 as shown in SEQ ID No: 7, CDR2 as shown in SEQ ID No: 19, CDR3 as shown in SEQ ID No: 2; or The amino acid sequence is CDR1 as shown in SEQ ID No: 8, CDR2 as shown in SEQ ID No: 19, CDR3 as shown in SEQ ID No: 2; or The amino acid sequence is CDR1 shown in SEQ ID No: 9, CDR2 shown in SEQ ID No: 20, CDR3 shown in SEQ ID No: 2; or The amino acid sequence is CDR1 shown in SEQ ID No: 10, CDR2 shown in SEQ ID No: 19, CDR3 shown in SEQ ID No: 2; or The amino acid sequence is CDR1 shown in SEQ ID No: 11, CDR2 shown in SEQ ID No: 21, CDR3 shown in SEQ ID No: 3; or The amino acid sequence is CDR1 shown in SEQ ID No: 11, CDR2 shown in SEQ ID No: 22, CDR3 shown in SEQ ID No: 3; or The amino acid sequence is CDR1 shown in SEQ ID No: 12, CDR2 shown in SEQ ID No: 21, CDR3 shown in SEQ ID No: 3; or The amino acid sequence is CDR1 shown in SEQ ID No: 12, CDR2 shown in SEQ ID No: 23, CDR3 shown in SEQ ID No: 3; or The amino acid sequence is CDR1 shown in SEQ ID No: 13, CDR2 shown in SEQ ID No: 22, CDR3 shown in SEQ ID No: 3; or The amino acid sequence is CDR1 shown in SEQ ID No: 14, CDR2 shown in SEQ ID No: 24, CDR3 shown in SEQ ID No: 4; or The amino acid sequence is CDR1 shown in SEQ ID No: 14, CDR2 shown in SEQ ID No: 25, CDR3 shown in SEQ ID No: 4; or The amino acid sequence is CDR1 shown in SEQ ID No: 14, CDR2 shown in SEQ ID No: 26, CDR3 shown in SEQ ID No: 4; or The amino acid sequence is CDR1 shown in SEQ ID No: 15, CDR2 shown in SEQ ID No: 27, CDR3 shown in SEQ ID No: 4; or The amino acid sequence is CDR1 shown in SEQ ID No: 16, CDR2 shown in SEQ ID No: 26, and CDR3 shown in SEQ ID No:

4.

5. The Nanobody according to claim 4, characterized in that The nanobody framework region includes: framework region FR1, framework region FR2, framework region FR3 and framework region FR4, or an amino acid sequence with more than 50% homology to framework region FR1, framework region FR2, framework region FR3 and framework region FR4; The framework region FR1 is the following formula (I): GlnLeuGlnGluSerGlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysXaa 11 AlaSerXaa 12 (I); The framework region FR2 is the following formula (II): MetGlyTrpTyrArgValGlyLeuArgSerGlyArgXaa 21 LeuValAlaXaa 22 (II); The framework region FR3 is the following formula (III): TyrAlaAspSerValXaa 31 Yes 32 ArgXaa 33 ThrXaa 34 SerArgXaa 35 Yes 36 AlaLysXaa 37 Yes 38 ValTyrLeuGlnMet Xaa 39 SerLeuLysXaa 310 GluAspThrAlaValTyrTyrCys(III); in, XA 11 Independently selected from Ala, Val; and / or, XA 12 Independently selected from Gly, Val; and / or, XA 21 Independently selected from Glu, Asp; and / or, XA 22 independently selected from Thr, Ser, Ala; and / or, XA 31 Independently selected from Lys, Gln; and / or, XA 32 Independently selected from Asp, Gly; and / or, XA 33 Independently selected from Phe, Ser; and / or, XA 34 are independently selected from Ile, Val; and / or, XA 35 Independently selected from Asp, Asn; and / or, XA 36 independently selected from Asp, Asn, Tyr; and / or, XA 37 Independently selected from Asp, Asn; and / or, XA 38 are independently selected from Ala, Thr; and / or, XA 39 are independently selected from Asn, Thr; and / or, XA 310 are independently selected from Leu, Pro; The framework region FR4 is: TrpGlyGlnGlyThrGlnValThrValSerSer.

6. The Nanobody according to any one of claims 1 to 5, characterized in that The nanobody sequence is selected from: SEQ ID No: 28, SEQ ID No: 29, SEQ ID No: 30, SEQ ID No: 31, SEQ ID No: 32, SEQ ID No: 33, SEQ ID No: 34, SEQ ID No: 35, SEQ ID No: 36, SEQ ID No: 37, SEQ ID No: 38, SEQ ID No: 39, SEQ ID No: 40, SEQ ID No: 41, SEQ ID No: 42, SEQ ID No: 43, SEQ ID No: 44, SEQ ID No: 45, SEQ ID No: 46 or SEQ ID No:

47.

7. The Nanobody according to any one of claims 1 to 6, characterized in that The Nanobody is a Nanobody obtained by replacing the FR2 backbone. Preferably, the FR2 backbone-replacement Nanobody is selected from the group consisting of: SEQ ID No:48, SEQ ID No:49, SEQ ID No:50, SEQ ID No:51, SEQ ID No:52, SEQ ID No:53, SEQ ID No:54, SEQ ID No:55, SEQ ID No:56, SEQ ID No:57, SEQ ID No:58, SEQ ID No:59, SEQ ID No:60, SEQ ID No:61, SEQ ID No:62, SEQ ID No:63, SEQ ID No:64, SEQ ID No:65, SEQ ID No:66 or SEQ ID No:

67.

8. The Nanobody according to any one of claims 1 to 7, characterized in that The nanobody is a nanobody obtained by humanization. Preferably, the humanized nanobody is selected from: SEQ ID No:68, SEQ ID No:69, SEQ ID No:70, SEQ ID No:71, SEQ ID No:72, SEQ ID No:73, SEQ ID No:74, SEQ ID No:75, SEQ ID No:76, SEQ ID No:77, SEQ ID No:78, SEQ ID No:79, SEQ ID No:80, SEQ ID No:81, SEQ ID No:82, SEQ ID No:83, SEQ ID No:84, SEQ ID No:85, SEQ ID No:86, SEQ ID No:87, SEQ ID No:88, SEQ ID No:89, SEQ ID No:90, SEQ ID No:91, SEQ ID No:92, SEQ ID No:93, SEQ ID No:94, SEQ ID No:95, SEQ ID No:96, SEQ ID No:97, SEQ ID No:98, SEQ ID No:99, SEQ ID No:100, SEQ ID No:101, SEQ ID No:102, SEQ ID No:103, SEQ ID No:104, SEQ ID No:105, SEQ ID No:106, SEQ ID No:107, SEQ ID No:108, SEQ ID No:109, SEQ ID No:110, SEQ ID No:111, SEQ ID No:112, SEQ ID No:113, SEQ ID No:114, SEQ ID No:115, SEQ ID No:116, SEQ ID No:117, SEQ ID No:118, SEQ ID No:119, SEQ ID No:120, SEQ ID No:121, SEQ ID No:122, SEQ ID No:123, SEQ ID No:124, SEQ ID No:125, SEQ ID No:126, SEQ ID No:127, SEQ ID No:128, SEQ ID No:129, SEQ ID No:130, SEQ ID No:131, SEQ ID No:132, SEQ ID No:133, SEQ ID No:134, SEQ ID No:135, SEQ ID No:136, SEQ ID No:137, SEQ ID No:138, SEQ IDNo: 139, SEQ ID No: 140, SEQ ID No: 141, SEQ ID No: 142, SEQ ID No: 143, SEQ ID No: 144, SEQ ID No: 145, SEQ ID No: 146 or SEQ ID No:

147.

9. The Nanobody according to any one of claims 1 to 8, characterized in that The nanobody is a nanobody obtained by CDR transplantation of nanobodies between the same family. Preferably, the CDR-grafted nanobody is selected from: SEQ ID No: 148, SEQ ID No: 149, SEQ ID No: 150, SEQ ID No: 151, SEQ ID No: 152, SEQ ID No: 153, SEQ ID No: 154, SEQ ID No: 155, SEQ ID No: 156, SEQ ID No: 157, SEQ ID No: 158, SEQ ID No: 159, SEQ ID No: 160, SEQ ID No: 161, SEQ ID No: 162, SEQ ID No: 163, SEQ ID No: 164, SEQ ID No: 165, SEQ ID No: 166 or SEQ ID No:

167.

10. A nucleic acid, characterized in that The nucleic acid encodes the Nanobody according to any one of claims 1 to 9.

11. An expression vector, characterized in that: An expression cassette comprising the nucleic acid of claim 10.

12. A host cell, characterized in that Comprising the expression vector according to claim 11.

13. Use of the nanobody according to any one of claims 1 to 9 in immunodetection, enrichment and / or purification.

14. The use according to claim 13, characterized in that The nano antibody is used in the preparation of a virus adsorbent, a virus purification kit, and a virus detection kit, wherein the virus is AAV.

15. A virus adsorbent, characterized in that: Comprising a carrier matrix and the nanobody according to any one of claims 1 to 9.

16. A virus purification kit, characterized in that: Comprising a carrier matrix and the nanobody according to any one of claims 1 to 9.

17. A virus detection kit, characterized in that: Comprising a carrier matrix and the nanobody according to any one of claims 1 to 9.

18. A method for detecting AAV for non-diagnostic purposes, characterized in that: The carrier matrix and the nanobody according to any one of claims 1 to 9 are coupled with HRP, and then detected by direct enzyme immunosorbent assay or sandwich enzyme immunosorbent assay.

Images