A nanobody and its application

By developing nano-antibody with specific amino acid sequences, the complex and cost-effective AAV purification process is solved, and efficient and low-cost AAV purification and detection are achieved, which is suitable for industrial applications.

CN119371520BActive Publication Date: 2025-07-29CROWN MEDICAL TECH DALIAN CO LTD
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202411805936.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-10
Publication Date
2025-07-29
Estimated Expiration
2044-12-10

AI Technical Summary

Technical Problem

The existing AAV purification process is complex, high cost, and the affinity and stability of traditional antibody preparation are poor, making it difficult to achieve industrial application.

Method used

Develop nano-antibody with specific amino acid sequences, including complementary determining region CDR and framework region FR, specifically binds to AAV, and optimizes the purification process by preparing adsorbents for AAV affinity chromatography.

Benefits of technology

It realizes efficient and low-cost AAV purification, improves yield, simplifies process steps, is suitable for industrial applications, and can detect AAV and empty capsids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005179213580000061
    Figure BDA0005179213580000061
  • Figure BDA0005179213580000071
    Figure BDA0005179213580000071
  • Figure BDA0005179213580000081
    Figure BDA0005179213580000081
Patent Text Reader

Abstract

The present invention provides a nanobody and its applications. The variable region in the amino acid sequence of the nanobody includes complementarity-determining regions CDR and framework regions FR. The complementarity-determining regions CDR include complementarity-determining region CDR1, complementarity-determining region CDR2, and complementarity-determining region CDR3. Among them, CDR3 belongs to the RWPDXY family, and the binding sites to the AAV capsid are W99, D101, and Y103. The nanobody of the present invention has high affinity and activity, can specifically recognize and bind multiple serotypes of AAV, the adsorbent prepared by this nanobody has extremely strong adsorption ability for AAV, can be applied to AAV affinity chromatography, and is conducive to the industrial application of AAV affinity chromatography columns. In addition, it can also be applied to the field of AAV detection, and can detect both empty capsids and virus particles at the same time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a nanobody and its application. Background Art

[0002] Adeno-associated virus (AAV), belonging to the genus Dependovirus of the Parvoviridae family, has an icosahedral structure. It is a type of single-stranded DNA defective virus with the simplest structure currently discovered and requires a helper virus (usually adenovirus) to participate in replication. The diameter of the virus particle is between 20 and 26 nm, and it contains a linear single-stranded DNA genome with a size between 4.7 and 6 kb. AAV is not pathogenic to humans. Research shows that about 80% of the population is positive for AAV serum detection.

[0003] Recombinant adeno-associated virus (rAAV) is developed based on non-pathogenic wild AAV. Due to its good safety, wide host cell range (dividing and non-dividing cells), low immunogenicity, and long-term expression of foreign genes in vivo, it is regarded as one of the most promising gene transfer vectors and is widely used in gene therapy and vaccine research worldwide. It includes gene function research in in vivo and in vitro experiments, constructing disease models, gene knockout, gene therapy, and vaccine research, etc.

[0004] Since the upstream production of rAAV is completed in cells, its lysate contains nucleic acids, residual impurities in the culture medium, and host cell proteins (HCP). Although the residual DNA can be treated with nuclease, the removal of HCP is a complex process, usually involving multiple steps, and these steps may reduce the yield and delay the process development, bringing great challenges to the downstream purification process. Especially, AAV has multiple different serotypes (AAV1 - AAV10), which have different capsid protein spatial structures, sequences, and tissue specificities, different infection efficiencies for different tissues and cells, and recognize and bind to different cell surface receptors. Therefore, a general affinity chromatography scheme is difficult to achieve.

[0005] Traditional downstream processes require multiple different treatment steps, including cesium chloride or iodixanol gradient centrifugation and multiple chromatography steps. The effect of such processes is not ideal because when multiple steps are required, even if the single-step yield is very high, it will lead to a significant reduction in the final overall yield. And the main disadvantage of this method is that it is not suitable for directly purifying viruses from large-volume lysates and is only applicable to the research level.

[0006] To address this challenge, the latest affinity chromatography method reduces the number of steps required for purifying AAV, improves the yield, and shortens the process time. For example, heparin-affinity chromatography columns can be used to purify rAAV3 and rAAV6; mucin-affinity chromatography columns can be used to purify rAAV1, rAAV4, rAAV5, and rVVA6; antibody-affinity columns are used for detecting and purifying rAAV, such as monoclonal antibodies that recognize and bind to AAVXL32.1 (Patent Document 1), polyclonal antibodies that specifically recognize the AAV9 capsid protein (Patent Document 2), etc.

[0007] However, the high cost of traditional antibody preparation and defects such as low coupling amount on the vector due to the large size of the antibody limit its industrial application. Camelid nanobodies have high specificity and stability. AVBSepharose TM (GE Healthcare TM ) packing material and POROS TM CaptureSelectAAVX (Thermo Scientific TM ) packing material (Non-Patent Document 1) perform well during column chromatography, making the industrial application of AAV affinity chromatography columns possible. However, nanobodies with different sequences screened by different screening methods have significant differences in affinity, stability, and binding spectrum.

[0008] Patent Document 1: CN113583112B

[0009] Patent Document 2: CN114685651A

[0010] Non-Patent Document 1: Orjana Terova, et.al, Overcoming Downstream Purification Challenges for Viral Vector Manufacturing: Enabling Advancement of Gene Therapies in the Clinic, Cell Gene Therapy Insights 2018; 4(2), 101 - 111. Summary of the Invention

[0011] The object of the present invention is to provide nanobodies with amino acid sequences of specific structures and their applications to solve the problems of complex antibody preparation processes, high costs, and poor antibody affinity, stability, and binding spectrum in aspects such as AAV enrichment, purification, and detection. To achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0012] In a first aspect, the present invention provides a nanobody, wherein the variable region in the amino acid sequence of the nanobody comprises complementarity-determining regions (CDRs) and framework regions (FRs). The complementarity-determining regions (CDRs) include complementarity-determining region 1 (CDR1), complementarity-determining region 2 (CDR2), and complementarity-determining region 3 (CDR3). The nanobody can recognize and specifically bind to AAV. Among them, the complementarity-determining region 3 (CDR3) is of the ArgTrpProAspXaaTyr family, where Xaa is selected from Pro, Arg, or Gly, and the binding sites of the complementarity-determining region 3 (CDR3) to AAV are Trp99, Asp101, and Tyr103.

[0013] Preferably, the amino acid sequence of the complementarity-determining region 3 (CDR3) is selected from SEQ ID No:1, SEQ ID No:2, SEQ ID No:3, or SEQ ID No:4, and amino acid sequences having a homology of more than 75% with SEQ ID No:1, SEQ ID No:2, SEQ ID No:3, or SEQ ID No:4.

[0014] Preferably, the amino acid sequence of the complementarity-determining region 1 (CDR1) is selected from any one of the sequences from SEQ ID No:5 to SEQ ID No:16; the amino acid sequence of the complementarity-determining region 2 (CDR2) is selected from any one of the sequences from SEQ ID No:17 to SEQ ID No:27.

[0015] Preferably, the nanobody comprises CDR1 with an amino acid sequence as shown in SEQ ID No: 5, CDR2 with an amino acid sequence as shown in SEQ ID No: 17, and CDR3 with an amino acid sequence as shown in SEQ ID No: 1; or CDR1 with an amino acid sequence as shown in SEQ ID No: 5, CDR2 with an amino acid sequence as shown in SEQ ID No: 18, and CDR3 with an amino acid sequence as shown in SEQ ID No: 1; or CDR1 with an amino acid sequence as shown in SEQ ID No: 6, CDR2 with an amino acid sequence as shown in SEQ ID No: 17, and CDR3 with an amino acid sequence as shown in SEQ ID No: 1; or CDR1 with an amino acid sequence as shown in SEQ ID No: 6, CDR2 with an amino acid sequence as shown in SEQ ID No: 18, and CDR3 with an amino acid sequence as shown in SEQ ID No: 1; or CDR1 with an amino acid sequence as shown in SEQ ID No: 5, CDR2 with an amino acid sequence as shown in SEQ ID No: 19, and CDR3 with an amino acid sequence as shown in SEQ ID No: 1; or CDR1 with an amino acid sequence as shown in SEQ ID No: 6, CDR2 with an amino acid sequence as shown in SEQ ID No: 20, and CDR3 with an amino acid sequence as shown in SEQ ID No: 2; or CDR1 with an amino acid sequence as shown in SEQ ID No: 7, CDR2 with an amino acid sequence as shown in SEQ ID No: 19, and CDR3 with an amino acid sequence as shown in SEQ ID No: 2; or CDR1 with an amino acid sequence as shown in SEQ ID No: 8, CDR2 with an amino acid sequence as shown in SEQ ID No: 19, and CDR3 with an amino acid sequence as shown in SEQ ID No: 2; or CDR1 with an amino acid sequence as shown in SEQ ID No: 9, CDR2 with an amino acid sequence as shown in SEQ ID No: 20, and CDR3 with an amino acid sequence as shown in SEQ ID No: 2; or CDR1 with an amino acid sequence as shown in SEQ ID No: 10, CDR2 with an amino acid sequence as shown in SEQ ID No: 19, and CDR3 with an amino acid sequence as shown in SEQ ID No: 2; or CDR1 with an amino acid sequence as shown in SEQ ID No: 11, CDR2 with an amino acid sequence as shown in SEQ ID No: 21, and CDR3 with an amino acid sequence as shown in SEQ ID No: 3; or CDR1 with an amino acid sequence as shown in SEQ ID No: 11, CDR2 with an amino acid sequence as shown in SEQ ID No: 22, and CDR3 with an amino acid sequence as shown in SEQ ID No: 3; or CDR1 with an amino acid sequence as shown in SEQ ID No: 12, CDR2 with an amino acid sequence as shown in SEQ ID No: 21, and CDR3 with an amino acid sequence as shown in SEQ ID No: 3; or CDR1 with an amino acid sequence as shown in SEQ ID No: 12, CDR2 with an amino acid sequence as shown in SEQ ID No: 23, and CDR3 with an amino acid sequence as shown in SEQ ID No: 3;CDR1 with an amino acid sequence as shown in SEQ ID No: 13, CDR2 with an amino acid sequence as shown in SEQ ID No: 22, and CDR3 with an amino acid sequence as shown in SEQ ID No: 3; or CDR1 with an amino acid sequence as shown in SEQ ID No: 14, CDR2 with an amino acid sequence as shown in SEQ ID No: 24, and CDR3 with an amino acid sequence as shown in SEQ ID No: 4; or CDR1 with an amino acid sequence as shown in SEQ ID No: 14, CDR2 with an amino acid sequence as shown in SEQ ID No: 25, and CDR3 with an amino acid sequence as shown in SEQ ID No: 4; or CDR1 with an amino acid sequence as shown in SEQ ID No: 14, CDR2 with an amino acid sequence as shown in SEQ ID No: 26, and CDR3 with an amino acid sequence as shown in SEQ ID No: 4; or CDR1 with an amino acid sequence as shown in SEQ ID No: 15, CDR2 with an amino acid sequence as shown in SEQ ID No: 27, and CDR3 with an amino acid sequence as shown in SEQ ID No: 4; or CDR1 with an amino acid sequence as shown in SEQ ID No: 16, CDR2 with an amino acid sequence as shown in SEQ ID No: 26, and CDR3 with an amino acid sequence as shown in SEQ ID No: 4.

[0016] Preferably, the nanobody framework region includes: framework region FR1, framework region FR2, framework region FR3, and framework region FR4, or an amino acid sequence having a homology of more than 50% with framework regions FR1, FR2, FR3, and FR4;

[0017] The framework region FR1 is of the following formula (I):

[0018] GlnLeuGlnGluSerGlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysXaa 11 AlaSerXaa 12 (I);

[0019] The framework region FR2 is of the following formula (II):

[0020] MetGlyTrpTyrArgValGlyLeuArgSerGlyArgXaa 21 LeuValAlaXaa 22 (II);

[0021] The complementary determining region FR3 is of the following formula (III):

[0022] TyrAlaAspSerValXaa 31 Xaa 32 ArgXaa 33 ThrXaa 34SerArgXaa 35 Xaa 36 AlaLysXaa 37 Xaa 38 ValTyrLeuGlnMet Xaa 39 SerLeuLysXaa 310 GluAspThrAlaValTyrTyrCys(III);

[0023] wherein, Xaa 11 is independently selected from Ala, Val; and / or, Xaa 12 is independently selected from Gly, Val; and / or, Xaa 21 is independently selected from Glu, Asp; and / or, Xaa 22 is independently selected from Thr, Ser, Ala; and / or, Xaa 31 is independently selected from Lys, Gln; and / or, Xaa 32 is independently selected from Asp, Gly; and / or, Xaa 33 is independently selected from Phe, Ser; and / or, Xaa 34 is independently selected from Ile, Val; and / or, Xaa 35 is independently selected from Asp, Asn; and / or, Xaa 36 is independently selected from Asp, Asn, Tyr; and / or, Xaa 37 is independently selected from Asp, Asn; and / or, Xaa 38 is independently selected from Ala, Thr; and / or, Xaa 39 is independently selected from Asn, Thr; and / or, Xaa 310 is independently selected from Leu, Pro;

[0024] The complementary determining region FR4 comprises: TrpGlyGlnGlyThrGlnValThrValSerSer.

[0025] Preferably, the amino acid sequence of the nanobody is selected from: SEQ ID No:28, SEQ ID No:29, SEQ ID No:30, SEQ ID No:31, SEQ ID No:32, SEQ ID No:33, SEQ ID No:34, SEQ ID No:35, SEQ ID No:36, SEQ ID No:37, SEQ ID No:38, SEQ ID No:39, SEQ ID No:40, SEQ ID No:41, SEQ ID No:42, SEQ ID No:43, SEQ ID No:44, SEQ ID No:45, SEQ ID No:46 or SEQ ID No:47.

[0026] The FR2 sequence of the framework region of the above-mentioned nanobody of the present invention can be replaced by a more common FR2 sequence (such as MetGlyTrpTyrArgGlnAlaProGlyLysGlnArgAspLeuValAlaSer, but not limited to this). Preferably, the FR2 replacement nanobody sequence is selected from: SEQ ID No:48, SEQ ID No:49, SEQ ID No:50, SEQ ID No:51, SEQ ID No:52, SEQ ID No:53, SEQ ID No:54, SEQ ID No:55, SEQ ID No:56, SEQ ID No:57, SEQ ID No:58, SEQ ID No:59, SEQ ID No:60, SEQ ID No:61, SEQ ID No:62, SEQ ID No:63, SEQ ID No:64, SEQ ID No:65, SEQ ID No:66 or SEQ ID No:67.

[0027] Preferably, the nanobody is a nanobody obtained by humanization. Preferably, the humanized nanobody is selected from: SEQ ID No:68, SEQ ID No:69, SEQ ID No:70, SEQ ID No:71, SEQ ID No:72, SEQ ID No:73, SEQ ID No:74, SEQ ID No:75, SEQ ID No:76, SEQ ID No:77, SEQ ID No:78, SEQ ID No:79, SEQ ID No:80, SEQ ID No:81, SEQ ID No:82, SEQ ID No:83, SEQ ID No:84, SEQ ID No:85, SEQ ID No:86, SEQ ID No:87, SEQ ID No:88, SEQ ID No:89, SEQ ID No:90, SEQ ID No:91, SEQ ID No:92, SEQ ID No:93, SEQ ID No:94, SEQ ID No:95, SEQ ID No:96, SEQ ID No:97, SEQ ID No:98, SEQ ID No:99, SEQ ID No:100, SEQ ID No:101, SEQ ID No:102, SEQ ID No:103, SEQ ID No:104, SEQ ID No:105, SEQ ID No:106, SEQ ID No:107, SEQ ID No:108, SEQ ID No:109, SEQ ID No:110, SEQ ID No:111, SEQ ID No:112, SEQ ID No:113, SEQ ID No:114, SEQ ID No:115, SEQ ID No:116, SEQ ID No:117, SEQ ID No:118, SEQ ID No:119, SEQ ID No:120, SEQ ID No:121, SEQ ID No:122, SEQ ID No:123, SEQ ID No:124, SEQ ID No:125, SEQ ID No:126, SEQ ID No:127, SEQ ID No:128, SEQ ID No:129, SEQ ID No:130, SEQ ID No:131, SEQ ID No:132, SEQ ID No:133, SEQ ID No:134, SEQ ID No:135, SEQ ID No:136, SEQ ID No:137, SEQ ID No:138, SEQ IDNo: 139, SEQ ID No: 140, SEQ ID No: 141, SEQ ID No: 142, SEQ ID No: 143, SEQ ID No: 144, SEQ ID No: 145, SEQ ID No: 146 or SEQ ID No: 147.

[0028] Preferably, the nanobody is a nanobody obtained by CDR transplantation between homologous nanobodies. Preferably, the CDR-transplanted nanobodies are selected from: SEQ ID No: 148, SEQ ID No: 149, SEQ ID No: 150, SEQ ID No: 151, SEQ ID No: 152, SEQ ID No: 153, SEQ ID No: 154, SEQ ID No: 155, SEQ ID No: 156, SEQ ID No: 157, SEQ ID No: 158, SEQ ID No: 159, SEQ ID No: 160, SEQ ID No: 161, SEQ ID No: 162, SEQ ID No: 163, SEQ ID No: 164, SEQ ID No: 165, SEQ ID No: 166 or SEQ ID No: 167.

[0029] In a second aspect, the present invention provides a nucleic acid encoding the above-mentioned nanobody.

[0030] In a third aspect, the present invention provides an expression vector comprising an expression cassette of the nucleic acid as claimed above.

[0031] In a fourth aspect, the present invention provides a host cell comprising the expression vector as claimed above.

[0032] In a fifth aspect, the present invention provides the use of the above-mentioned nanobody in immunoassay, enrichment and / or purification.

[0033] Preferably, the use of the nanobody in the preparation of virus adsorbents, virus purification kits, and virus detection kits; more preferably, the virus is AAV.

[0034] In a sixth aspect, the present invention provides a virus adsorbent comprising a carrier matrix and the above-mentioned nanobody.

[0035] In a seventh aspect, the present invention provides a virus purification kit comprising a carrier matrix and the above-mentioned nanobody.

[0036] In an eighth aspect, the present invention provides a virus detection kit comprising a carrier matrix and the above-mentioned nanobody.

[0037] In a ninth aspect, the present invention provides a method for detecting AAV for non-diagnostic purposes, which involves conjugating the vector matrix and the above-mentioned nanobody through HRP, and then detecting by direct enzyme-linked immunosorbent assay or sandwich enzyme-linked immunosorbent assay.

[0038] The nanobody of the present invention is a nanobody against AAV with a newly discovered amino acid sequence. This nanobody has high affinity and activity, can specifically recognize and bind to AAV. The adsorbent prepared by this nanobody has extremely strong adsorption ability for AAV, can be applied to AAV affinity chromatography, and is conducive to the industrial application of AAV affinity chromatography columns. In addition, it can also be applied to the field of AAV detection, and can detect both empty capsids and virus particles. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is the purified nanobody in Example 4 of the present invention.

[0040] Figure 2 It is the kinetic sensing diagram of the nano C1-C5 antibodies of the present invention.

[0041] Figure 3a 、 3b and 3c are the molecular docking diagrams of the nanobody and AAV capsid protein from different angles in Example 6 of the present invention.

[0042] Figure 4 It is the standard curve of direct ELISA detection in Example 12 of the present invention.

[0043] Figure 5 It is the standard curve of sandwich ELISA detection in Example 12 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0044] The above content and other aspects of the present invention will be further described clearly below, where:

[0045] (1) Unless otherwise specified, the term "sequence" as used herein (such as in terms like "antibody sequence", "variable region sequence", "V HH sequence" or "protein sequence") should generally be understood to include the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding the amino acid sequence, unless the context requires a more narrow interpretation.

[0046] (2) Unless otherwise specified, all methods, steps, techniques and operations not specifically described are known and well-known to those skilled in the art. For example, reference is still made to the comprehensive background art cited above and other references cited therein.

[0047] (3) The term "specificity" refers to the ability of a specific antigen-binding molecule (such as the nanobody of the present invention) to bind to different types of antigens or antigenic determinants. The specificity of an antigen-binding molecule can be determined according to its affinity and / or activity. Affinity is expressed as the dissociation equilibrium constant (K D ) of the antigen and the antigen-binding molecule, which is a measure of the binding strength between the antigen and the antigen-binding molecule. The smaller the K D value, the stronger the binding strength between the antigen and the antigen-binding molecule. Conversely, the larger the K D value, the weaker the binding strength between the antigen and the antigen-binding molecule. K a represents the binding constant. The larger the K a , the faster the binding. The smaller the K a , the slower the binding. K d represents the dissociation constant. The larger the K d , the faster the dissociation. The smaller the K d , the slower the dissociation. And K D = K d / K a . The binding ability of the nanobody of the present invention to AAV can also be characterized by the ELISA method. The data obtained are expressed as a percentage relative to the untreated sample. The closer the value is to 1.00, the closer the binding ability of the antibody under this treatment condition is to the untreated state, that is, the better the binding ability. The smaller the value, the more the binding ability of the antibody under this treatment condition decreases, that is, the worse the stability.

[0048] (4) The amino acid residues of the single-domain antibody (i.e., nanobody) can be numbered according to the general numbering method of the V HH domain given by Kabat et al. in "Sequence of proteins of immunological interest [(Sequence of proteins for immunological purposes), US Public Health Services, Publication No. 91]". This numbering method is used for the V HH domain from the camel family in the articles of Riechmann and Muyldermans. According to this numbering method, FR1 of the single-domain antibody includes amino acid residues at positions 1 to 30, CDR1 of the single-domain antibody includes amino acid residues at positions 31 to 36, FR2 of the single-domain antibody includes amino acid residues at positions 37 to 49, CDR2 of the single-domain antibody includes amino acid residues at positions 50 to 65, FR3 of the single-domain antibody includes amino acid residues at positions 66 to 94, CDR3 of the single-domain antibody includes amino acid residues at positions 95 to 102, and FR4 of the single-domain antibody includes amino acid residues at positions 103 to 113. In this regard, it should be noted that as in the art regarding VHH Domains and what is known about the V HH domain - the total number of amino acid residues in each CDR can vary and may not correspond to the total number of amino acid residues indicated by the Kabat numbering system (i.e., one or more positions according to the Kabat numbering system may not be occupied in the actual sequence, or the actual sequence may contain more amino acid residues than the number allowed by the Kabat numbering system). This means that, generally according to the Kabat numbering system, the amino acid residues in the actual sequence may be the same or different from the actual numbering system. It can also be said that the Kabat numbering system does not consider the amino acid residue numbering of the CDR, but position 1 according to the Kabat numbering system corresponds to the start of FR1, and vice versa.

[0049] It is also possible to number according to the natural position of the amino acids of the single - domain antibody, such as sequential numbering; or to number by ignoring the placeholder in order to maintain the comparability between antibodies of the same family. For example, the 5th position of CDR1 of the nanobody of the present invention (the 29th position of the full - length sequence) is N, S, F in SEQ ID No:28 - SEQ ID No:42 respectively, and is vacant in the sequences SEQ ID No:43 - SEQ ID No:46. However, for the overall coordination and comparability, the vacant position is assigned as the 29th position of the full - length sequence.

[0050] (5) The term "immobilized" refers to binding the nanobody to a solid support.

[0051] (6) The term "same family" refers to a family of nanobody sequences that bind the same antigen, have the same number of amino acids in CDR3, and have an amino acid sequence identity greater than 75%.

[0052] (7) The term "homology" refers to the similarity, likeness or relatedness between two or more sequences. The "percent sequence homology" can be calculated by comparing two sequences to be aligned in a comparison window, determining the number of positions where the same nucleic acid bases (e.g., A, T, C, G, I) or the same amino acid residues (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) are present in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window (i.e., window size), and multiplying the result by 100 to yield the percent sequence homology. The alignment for determining the percent sequence homology can be achieved in a variety of ways known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve the maximum alignment within the full-length sequences being compared or within the target sequence region. The homology can also be determined by the following methods: FASTA and BLAST. A description of the FASTA algorithm can be found in "Improved Tools for Biological Sequence Comparison" by W.R. Pearson and D.J. Lipman, Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci.), 85: 2444-2448, 1988; and "Rapid and Sensitive Protein Similarity Searches" by D.J. Lipman and W.R. Pearson, Science, 227: 1435-1441, 1989. A description of the BLAST algorithm can be found in "Basic Local Alignment Search Tool" by S. Altschul, W. Gish, W. Miller, E.W. Myers and D. Lipman, Journal of Molecular Biology, 215: 403-410, 1990.

[0053] (8) Amino acid substitutions can generally be described as where an amino acid residue can be replaced by an amino acid with a similar chemical structure or by an amino acid with a dissimilar chemical structure, provided that there is little or no effect on the function, activity or other biological properties of its polypeptide. Preferably, the amino acid residue can be replaced by an amino acid with a similar chemical structure.

[0054] For the above substitution methods, the situations disclosed in the documents WO04 / 037999, WO 98 / 49185, WO 00 / 46383 and WO 01 / 09300 can be cited, but are not limited thereto. In addition, the (preferred) types and / or combinations of the substitutions selected based on the relevant information of other references cited in WO 04 / 037999 and WO 06 / 122786 can also be cited.

[0055] (9) The term "framework region amino acid substitution" refers to the replacement of one or more amino acid residues in the framework region (FR) of an antibody to optimize various properties of the antibody, such as stability, expression level, affinity and immunogenicity, while maintaining its specific recognition ability for antigens.

[0056] (10) The term "scaffold replacement" refers to the replacement of the amino acid sequence in the framework region (FR) of one antibody with the amino acid sequence in the framework region of another antibody to improve the stability, expression level, affinity of the antibody or reduce its immunogenicity, while maintaining its specific recognition ability for antigens.

[0057] (11) The term "humanization" refers to the genetic engineering modification of murine or other non-human monoclonal antibodies to reduce their immunogenicity and retain or improve their specificity and affinity for antigens.

[0058] (12) The term "interspecies nanobody CDR transplantation" refers to the mutual replacement and transplantation of CDR1 and CDR2 between species. This transplantation retains the antigen-binding properties of the original CDR, while taking advantage of the stability and solubility provided by the framework region of the new host. The resulting new CDR-transplanted nanobody has the same or similar properties as the original antibody, but may have different forms of expression and application potential.

[0059] (13) The ArgTrpProAspXaaTyr family or RWPDXY family described in the present invention refers to a class of antibodies with a specific amino acid sequence in the CDR3 region, where "Xaa" represents any one of proline, arginine, and glycine. Antibodies with this sequence are characterized by their invariant Arg, Trp, Pro, Asp, and Tyr residues, and thus retain the broad recognition ability for different AAV antigens.

[0060] The main amino acid residues on the nanobody of the present invention participating in antigen recognition and binding are W99, D101, and Y103, which bind to R487, R490, K530, E533, T576, and E577 on the AAV capsid (gray) through hydrophobic interaction, electrostatic interaction, and hydrogen bond interaction.

[0061] In one embodiment of the present invention, the amino acid sequences of the complementarity determining region CDR3 may be exemplified by SEQ ID No:1, SEQ ID No:2, SEQ ID No:3 or SEQ ID No:4, and amino acid sequences having a homology of more than 75% with SEQ ID No:1, SEQ ID No:2, SEQ ID No:3 or SEQ ID No:4, but not limited thereto.

[0062] In one embodiment of the present invention, the amino acid sequences of the complementarity determining region CDR1 may be exemplified by SEQ ID No:5, SEQ ID No:6, SEQ ID No:7, SEQ ID No:8, SEQ ID No:9, SEQ ID No:10, SEQ ID No:11, SEQ ID No:12, SEQ ID No:13, SEQ ID No:14, SEQ ID No:15 or SEQ ID No:16, but not limited thereto.

[0063] In one embodiment of the present invention, the amino acid sequences of the complementarity determining region CDR2 may be exemplified by SEQ ID No:17, SEQ ID No:18, SEQ ID No:19, SEQ ID No:20, SEQ ID No:21, SEQ ID No:22, SEQ ID No:23, SEQ ID No:24, SEQ ID No:25, SEQ ID No:26 or SEQ ID No:27, but not limited thereto.

[0064] In one embodiment of the present invention, the nanobody includes the amino acid sequences CDR1, CDR2 and CDR3, which may be listed as follows:

[0065]

[0066]

[0067] For the framework region, it is more conserved compared to the complementarity determining region. Those skilled in the art will reasonably screen the sequence structure of the framework region according to the actual use and function of the nanobody. As the amino acid sequence of the framework region, an amino acid sequence having a homology of more than 50% is preferred, and further preferably an amino acid sequence having a homology of more than 70%, and further preferably an amino acid sequence having a homology of more than 95%.

[0068] The framework region FR1 includes the following formula (I):

[0069] GlnLeuGlnGluSerGlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysXaa 11 AlaSerXaa 12 (I);

[0070] The framework region FR2 is the following formula (II):

[0071] MetGlyTrpTyrArgValGlyLeuArgSerGlyArgXaa 21 LeuValAlaXaa 22 (II);

[0072] The complementary determining region FR3 is the following formula (III):

[0073] TyrAlaAspSerValXaa 31 Xaa 32 ArgXaa 33 ThrXaa 34 SerArgXaa 35 Xaa 36 AlaLysXaa 37 Xaa 38 ValTyrLeuGlnMet Xaa 39 SerLeuLysXaa 310 GluAspThrAlaValTyrTyrCys(III);

[0074] Wherein, Xaa 11 is independently selected from Ala, Val; and / or, Xaa 12 is independently selected from Gly, Val; and / or, Xaa 21 is independently selected from Glu, Asp; and / or, Xaa 22 is independently selected from Thr, Ser, Ala; and / or, Xaa 31 is independently selected from Lys, Gln; and / or, Xaa 32 is independently selected from Asp, Gly; and / or, Xaa 33 is independently selected from Phe, Ser; and / or, Xaa 34 is independently selected from Ile, Val; and / or, Xaa 35 is independently selected from Asp, Asn; and / or, Xaa 36 is independently selected from Asp, Asn, Tyr; and / or, Xaa 37 is independently selected from Asp, Asn; and / or, Xaa 38Independently selected from Ala, Thr; and / or, Xaa 39 Independently selected from Asn, Thr; and / or, Xaa 310 Independently selected from Leu, Pro

[0075] The complementary determining region FR4 includes: TrpGlyGlnGlyThrGlnValThrValSerSer

[0076] As the amino acid sequence of the above-mentioned nanobody, the following can be listed

[0077]

[0078] However, it is not limited to the above examples, as long as it has little or no impact on the function, activity or other biological properties of the polypeptide

[0079] In addition, the total number of residues of the nanobody can be in the range of 110 - 120. However, the parts, fragments or analogs of the nanobody are not particularly limited by their length and / or size, as long as such parts, fragments or analogs meet the further requirements listed below and are also suitable for the purposes described herein

[0080] The nanobodies in the present invention belong to homologous nanobodies, with the same length of the CDR3 amino acid sequence, and the lengths of each framework region FR and antigen-binding region CDR being the same or similar (differing by no more than 1 amino acid) and having a high sequence identity, similar structures, and substantially equivalent antigen-binding capabilities

[0081] As a method for preparing a "nanobody", in its broadest sense, it is not limited to a specific biological resource or a specific preparation method. For example, the nanobodies of the present invention can be obtained by the following methods: (1) isolating the VHH domain from a naturally occurring heavy-chain antibody; (2) expressing the nucleotide sequence encoding these natural VHH domains; (3) humanizing the isolated VHH domain, or expressing the nucleotide sequence encoding the humanized VHH domain; optionally performing FR2 backbone replacement or CDR grafting to further optimize the antibody characteristics; (4) using synthetic or semi-synthetic techniques to prepare the required protein, polypeptide or other amino acid sequences; (5) preparing the nucleic acid encoding the nanobody by nucleic acid synthesis techniques and then expressing it; and / or (6) combining any one or more of the above methods to obtain the required nanobody

[0082] The framework region has a relatively limited effect on affinity, so amino acid substitution in the framework region usually does not affect the affinity of the nanobody. As long as the nanobody can exist in a soluble form, the amino acids in the framework region can also adopt the above substitution strategy

[0083] A variant of the nanobody based on the present invention further includes a nanobody obtained by replacing the FR2 framework. Generally, FR2 does not participate in antigen recognition but exists as a supporting structure. Therefore, we replace the FR2 of the nanobody of the present invention with the FR2 sequence of a common general nanobody, aiming to reduce its immunogenicity, and obtain a nanobody with an amino acid sequence corresponding to the naturally occurring VHH domain but having been humanized.

[0084] FR2 replacement is a typical example of amino acid substitution in the framework region. It can be exemplified that SEQ ID No: 48 to SEQ ID No: 67 in the present invention are FR2 replacement forms of SEQ ID No: 28 to SEQ ID No: 47, and none of them affect the affinity of the original sequence.

[0085] A variant of the nanobody based on the present invention further includes a nanobody having an amino acid sequence corresponding to the naturally occurring V HH domain but having been humanized. Humanization means replacing one or more amino acid residues in the naturally occurring V H domain sequence with one or more amino acid residues present at the corresponding positions in the V HH domain of a conventional 4-chain antibody from humans.

[0086] A variant of the nanobody based on the present invention further includes a nanobody obtained by humanization. It can be exemplified that SEQ ID No: 68 to SEQ ID No: 147 in the present invention are 4 humanized forms of SEQ ID No: 28 to SEQ ID No: 47, and none of them affect the affinity of the original sequence.

[0087] A variant of the nanobody based on the present invention further includes a nanobody obtained by CDR transplantation between homologous nanobodies. The nanobodies of the present invention belong to homologous nanobodies. The lengths of CDR1 are roughly the same and their properties are similar, and the lengths of CDR2 are all the same and their properties are similar. Therefore, CDR1 and CDR2 between homologs can be replaced and transplanted with each other, and the new CDR-transplanted nanobody obtained has the same or similar properties as the original antibody. It can be exemplified that SEQ ID No: 148 to SEQ ID No: 167 in the present invention are CDR transplantation forms of SEQ ID No: 28 to SEQ ID No: 47, and none of them affect the affinity of the original sequence.

[0088] In addition, the dissociation equilibrium constant (K D ) of the nanobody of the present invention binding to AAV is 10 -7 to 10 -9 mol / L (M). The dissociation equilibrium constant of the present invention is measured by surface plasmon resonance technology.

[0089] The specific binding between the above-mentioned antigen and the antigen-binding molecule can be determined by any suitable method known in the art, including Scatchard Analysis and / or competitive binding assays such as radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA), as well as other new methods known in the art, such as surface plasmon resonance (SPR) and / or biolayer interferometry (BLI) techniques. And those skilled in the art should know that the affinity parameters measured by different methods vary greatly, even by 2-3 orders of magnitude.

[0090] The nanobody structure of the present invention can be determined by any suitable method known in the art, including Alohafold2mutimer v3 (a protein structure prediction tool for predicting the three-dimensional structure of protein complexes, which can help researchers understand how different proteins interact with each other to form complexes), Amber (a widely used molecular dynamics simulation software package that can be used to simulate the behavior of proteins and other biomolecules. In structural biology, Amber is often used to perform energy minimization, side-chain optimization, and molecular dynamics simulations), Relax Process (in molecular dynamics simulations, the Relax Process usually refers to the process of energy minimization of protein structures to optimize the geometric configuration of side chains, reduce internal conflicts and unfavorable geometric configurations of molecules), ADT (AutoDock Tools, a software toolset for molecular docking and molecular dynamics simulations that can help researchers predict the binding mode and affinity between ligands and receptors), and / or Ligplot+ (a tool for analyzing the protein-ligand complex interface that can identify and visualize hydrogen bonds, hydrophobic interactions, and other non-covalent interactions).

[0091] The nanobody of the present invention and the nucleic acid encoding it can be prepared in a known manner, which will be clear to those skilled in the art from the further description herein. A particularly useful method for preparing the nanobody and nucleic acid generally includes the following steps:

[0092] (1) Express the nucleic acid encoding the nanobody of the present invention in a suitable host cell or host organism or in another suitable expression system, optionally followed by;

[0093] (2) Isolate and / or purify the nanobody of the present invention thus obtained.

[0094] Alternatively, other methods may include the following steps:

[0095] (3) Cultivate and / or maintain the host of the present invention under certain conditions so that the host of the present invention expresses and / or produces a nanobody of the present invention; optionally followed by;

[0096] (4) Isolate and / or purify the nanobody of the present invention thus obtained.

[0097] The nucleic acid of the present invention can be in the form of single-stranded or double-stranded DNA or RNA, and preferably in the form of double-stranded DNA. For example, the nucleic acid sequence of the present invention can be genomic DNA, cDNA or synthetic DNA (such as DNA with codon usage specifically adapted for expression in the host cell or host organism to be used, i.e., codon-optimized).

[0098] The nucleic acid of the present invention can be prepared or obtained by essentially known methods, based on the information of the amino acid sequence of the nanobody of the present invention given herein, and / or can be isolated from a suitable natural source. For example, site-directed mutagenesis of the nucleic acid sequence of a naturally occurring V HH domain is carried out to provide the nucleic acid of the present invention encoding said analog.

[0099] The nucleic acid of the present invention can also be in such a form that it is present in and / or is part of a genetic construct, which is well known to those skilled in the art. Such genetic constructs generally include at least one nucleic acid of the present invention and can be in the form of a vector, such as a plasmid, YAC, viral vector or transposon. In particular, the vector can be an expression vector, i.e., a vector that can provide in vitro and in vivo expression (such as in a suitable host cell, host organism and / or expression system).

[0100] The nucleic acid of the present invention and / or the genetic construct of the present invention can be used to transform a host cell or host organism, i.e., for expressing and / or producing the nanobody of the present invention. Suitable hosts or host cells are well known to those skilled in the art and can be, for example, any suitable fungal, prokaryotic or eukaryotic cell or organelle or organism, as well as all other hosts or host cells essentially known for expressing and producing antibodies and antibody fragments (including but not limited to single-domain antibodies and ScFv fragments), which are well known to those skilled in the art.

[0101] For production, the nanobody of the present invention can be produced in the milk of transgenic mammals, such as in the milk of rabbits, cows, goats or sheep, and can also be produced in plants or parts of plants, which include but are not limited to their leaves, flowers, fruits, roots or seeds.

[0102] As mentioned above, one advantage of applying nanobodies is that the polypeptides based thereon can be expressed and prepared in a prokaryotic system, and suitable prokaryotic expression systems, vectors, host cells, etc. are well known to those skilled in the art, as cited in the references above. However, it should be noted that the present invention is not limited to expression in a bacterial system in its broadest sense.

[0103] Preferably, in the present invention, the nanobody is produced in bacterial cells, particularly in bacterial cells suitable for large-scale drug production, as described above.

[0104] When the nanobody of the present invention is expressed in cells for production, the nanobody of the present invention can be produced intracellularly (e.g., in the cytoplasm or periplasmic space), then separated from the host cell, and optionally further purified; or can be produced extracellularly (i.e., secreted expression), then separated from the culture medium, and optionally further purified.

[0105] Some preferred but non-limiting vectors for use with these host cells include vectors for expression in mammalian cells - pMANneo (Clonetech), pUCTtag (ATCC37460), and pMClneo (Stratagene); vectors for expression in bacterial cells - pET vectors (Novagen) and pQE vectors (Qiagen); vectors for expression in yeast or other fungal cells - pYES2 (Invitrogen) and Pichia expression vectors (Invitrogen); vectors for expression in insect cells - pBlueBacⅡ (Invitrogen) and other baculovirus vectors; and so on.

[0106] The corresponding techniques for transforming the host or host cells of the present invention are well known to those skilled in the art.

[0107] After transformation, detection can be carried out and those hosts that have successfully been transformed with the nucleotide sequence / genetic construct of the present invention can be selected. The transformed host cells (which can be in the form of a stable cell line) or host organisms (which can be in the form of a stable mutant line or strain) form another aspect of the present invention.

[0108] Then the amino acid sequence of the present invention can be separated from the host cell / host organism and / or from the culture medium in which the host cell or host organism is cultured, by protein separation and / or purification techniques essentially known in the art, such as (preparative) chromatography and / or electrophoresis techniques, differential precipitation techniques, affinity techniques (e.g., using a specific / cleavable amino acid sequence fused to the amino acid sequence of the present invention) and / or preparative immunological techniques (i.e., using an antibody against the amino acid sequence to be separated).

[0109] The nanobody of the present invention can specifically bind to the antigen AAV, and thus a preferred but non-limiting application of the present invention is as an AAV adsorbent, and the aforementioned adsorbent includes a carrier matrix and the nanobody.

[0110] The aforementioned AAVs include AAV1 to AAV10 classified by serotype, and the nanobodies of the present invention have a broad-spectrum adsorption ability for AAVs of different serotypes.

[0111] The aforementioned carrier matrix can be a porous material, for example, agarose gel microspheres, cellulose spheres, magnetic beads, silica gel microspheres, activated carbon, or resin microspheres, etc.

[0112] The carrier for the aforementioned adsorbent can be obtained by commercial purchase. As specific example products, for example, agarose gel Sepharose CL-6B (GE Healthcare, US), resin microspheres Nanomicro series (Suzhou NanoMicro Technologies Co., Ltd.), but are not limited to these products.

[0113] When using the above carrier, preferably, the above carrier can be activated. The activation method can be, for example, but not limited to the following methods: First, perform epoxy activation, second, perform diaminopropyleimine (DADPA) activation, and finally, perform iodoacetic acid activation, etc.

[0114] The aforementioned adsorbent is obtained by conjugating the nanobody to the activated carrier. The specific method is not particularly limited. For example, it can be obtained by mixing the purified nanobody solution with the carrier, followed by centrifugation, and finally by washing / filtering the gel to obtain the final adsorbent.

[0115] The adsorbent of the present invention can be used to specifically recognize AAV.

[0116] The nanobody or adsorbent of the present invention can be used for purifying AAV and can also be used for preparing a kit for detecting AAV.

[0117] Example

[0118] Hereinafter, examples are given to illustrate the specific implementation manners of the present invention. However, the implementation manners of the present invention are not limited by these examples and can be arbitrarily selected and changed within the range not affecting the technical effects to be achieved by the present invention.

[0119] Example 1: Construction of anti-AAV nanobody library

[0120] The phage display library used in the present invention is an immune library with T7 phage as the carrier, and the establishment steps are as follows:

[0121] (1) Immunize alpacas (numbered 2309-1 and 2309-2) with AAV. After immunizing four times, collect jugular venous blood from the two alpacas, isolate peripheral blood lymphocytes, and extract total RNA (PuerLink TM RNAMini Kit, Life Technologies: 12183018A);

[0122] (3) Reverse transcribe total RNA into cDNA, and amplify the V gene using two rounds of nested PCR; HH gene;

[0123] For the first round of PCR, use cDNA as the template, and use UPprimer1 and DOWNprimer1 as the upstream and downstream primers respectively. After amplification, recover the band with a size of 650 - 750 bp, and use this as the template for the second round of PCR. The upstream and downstream primers are UPprimer2 and DOWN primer2 respectively, and recover the PCR product of 450 - 500 bp;

[0124] UPprimer1: CTTGGTGGTCCTGGCTGCTCT,

[0125] DOWNprimer1: GGTACGTGCTGTTGAACTGTTCC,

[0126] UPprimer2: TATCTAGTC GAATTC CGCCCAGGTGCAGCTC,

[0127] DOWNprimer2: AGCGACTAAGCTTTGAGGAGACGGTGAC;

[0128] (3) Double-digest the PCR product with EcoRΙ and HindⅢ, and perform agarose gel electrophoresis to recover the gene band of 350 - 500 bp, which is the V HH gene fragment;

[0129] (4) Use T4 ligase to ligate the T7 vector ( 10 - 3 Cloning Kit, Meterck Metillipore 70550 - 3) and the V HH gene fragment;

[0130] (5) Mix the ligation product with the packaging protein to form a complete T7 phage, and amplify the mixture to obtain the original phage library;

[0131] (6) After detection, the titer of this original library is 8.82×10 9 pfu / mL, and the diversity is 6.1×10 6 .

[0132] Example 2: Screening of nanobodies

[0133] First, dilute the antigen (AAV2) to 10 μg / mL with TBS. Take 100 μL and add it to a 96-well plate, then incubate at 4 °C for 12 h. Aspirate the antigen dilution in the wells, wash the plate 3 times with TBS, pat dry, add 1% protein-free blocking solution (purchased from Sangon Biotech Co., Ltd.), 300 μL per well, and incubate at room temperature for 2 h (alternate between 1% protein-free blocking solution and 1% BSA during screening). Aspirate the blocking agent in the wells, wash the plate 6 times with TBST, pat dry, add the amplified phage, 100 μL per well, and incubate at room temperature for 30 min. Wash the plate 10 times with TBST, add T7 elution buffer (1% SDS) to elute the phage, incubate at room temperature for 30 min, and amplify the eluate for the next round of screening.

[0134] Then dilute and coat the antigen (AAV6) in the same manner, incubate, pan-select, and amplify the above eluate again for the next round of screening.

[0135] Dilute and coat the antigen (AAV8) in the same manner, incubate, pan-select, and amplify the above eluate again for the next round of screening.

[0136] Dilute and coat the antigen (AAV9) in the same manner, incubate, pan-select, and amplify the above eluate again.

[0137] Example 3: Construction of genetically engineered bacteria

[0138] (1) After four rounds of screening, perform solid amplification on the screened eluate, pick phage plaques, use the phage plaque amplification solution as a template, and use UPprimer3 and DOWNprimer3 as upstream and downstream primers for PCR amplification;

[0139] UPprimer3: TTCCTTAA CATATG GCCCAGGTGCAGCTCGT,

[0140] DOWNprimer3: TTAAGGAA CTCGAG CACGGTGACCAGGGTC;

[0141] (2) Send a part of the PCR product for outsourcing sequencing to obtain the nanobody sequence information. According to the CDR region length and homology, it is found that 20 monoclonal antibodies belong to the same family. The naming and serial number information of the nanobodies are shown in Table 1.

[0142] (3) Perform double digestion on another part of the PCR product with NdeΙ and XhoΙ, and recover the digested product. At the same time, perform digestion and recovery of the vector in the same method, use T4 ligase to ligate the digested product and the vector, and transfer the ligation product into Escherichia coli to obtain a genetically engineered bacterium expressing AAV-specific nanobody.

[0143] Table 1 Comparison Table of Nanobody Naming and Serial Numbers

[0144]

[0145] Example 4: Preparation of AAV nanobodies

[0146] (1) The basal medium for the nanobody is TB medium. Inoculate at an inoculation amount of 5%, culture at 37 °C for 3 - 5 h, and add the inducer isopropyl-β-D-thiogalactopyranoside (IPTG) (final concentration 0.25 mM, the same below) for overnight induction;

[0147] (2) After the induction is completed, centrifuge at 4000 rpm for 20 min to obtain wet bacteria containing the nanobody;

[0148] (3) Add lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.4 0.02 M PB) to the obtained wet bacteria at a ratio of 1:10, and use a high-pressure homogenizer at 700 bar to disrupt the cells;

[0149] (4) Centrifuge at 4 °C and 10000 rpm for 20 min, and take the supernatant;

[0150] (5) Filter the supernatant through a 0.45 μm filter, and then separate and purify the AAV nanobody through an affinity chromatography column (GE Healthcare, US), where the packing material of the affinity chromatography column is Ni Sepharose High Perfomance;

[0151] (6) Perform SDS-PAGE electrophoresis on the nanobody after affinity chromatography purification to judge the purity, and select the protein solution with higher purity to measure the protein concentration using the BCA method. The SDS-PAGE of the purified nanobody shows that in Figure 1 , the nanobody bands are correct and the purity is relatively high after one purification. Since the nanobodies of the present invention belong to the same family, their molecular weights and charges are similar, so their electrophoresis band positions are also roughly the same. Figure 1 (upper), from left to right are: before purification, A1 - A3 after purification, marker, A4, A5, B1 - B5; Figure 1 (lower), from left to right are maker, C1 - C5, D1 - D5.

[0152] Example 5

[0153] The binding capacity of nanobodies to AAV was analyzed using SPR technology. AAV was amino-coupled to a CM5 sensor chip at a density of 500 to 800 RU. Nanobodies were injected at seven different concentrations ranging from 1 to 100 nM, with a flow rate of 45 μL / min in all experiments. Chip regeneration conditions were glycine-HCl pH 1.5. Binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K. a , K d and K D . Figure 2 The middle curves are the response curves of nanoantibodies at concentrations of 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM, and 1.5625 nM from top to bottom (due to space limitations, Figure 2 Only the kinetic sensorgrams of the nanobodies with sequence names C1, C2, C3, C4 and C5 are given. The kinetic parameters shown in Table 2 were calculated by equation fitting. The nanobodies have high affinity for AAV2, AAV6, AAV8 and AAV9, with K D Range 10 -7 ~10 -9 (M).

[0154] Table 2 Affinity of nanobodies to different AAVs

[0155]

[0156]

[0157] Example 6: Calculation of key amino acids

[0158] Using sequence C1 and VP (Virus Particle, viral particle capsid protein) capsid as model proteins, molecular docking was performed to predict the antigen binding epitope of VHH (single domain antibody) on VP and the key amino acids in the interaction.

[0159] First, the VP monomer sequence and structure were separated from the assembled crystal structure of the VP protein. After combining the VP sequence with the VHH antibody sequence, the complex structure was predicted and searched using Alohafold2 mutimer v3. After generating the complex structure, the side chain structure was optimized using Amber's Relax Process. ADT was used to analyze hydrogen atoms and calculate potentials. Ligplot+ was used to analyze the hydrogen bonding and hydrophobic interaction networks between the amino acids in the VHH CDR region and the VP binding interface. Interdomain atomic contacts were also examined. After verifying the absence of interdomain atomic clashes in multiple assembled VP monomer structures, a plausible conformation that met these criteria was selected as the structural model for the VHH antibody-VP protein complex.

[0160] Through molecular docking, it is predicted that the binding epitope of VHH on AAV is in the depression of the 3F structure responsible for cell receptor recognition, which conforms to the characteristics of the binding epitope of nanobody in general understanding. The docking diagrams are as shown in Figure 3a and 3b and 3c. Among them, Figure 3a is the molecular docking diagram and local enlarged diagram of the nanobody in Example 6 and the AAV capsid protein. In order to more clearly show each site and docking relationship, Figure 3b and Figure 3c show the local enlarged diagrams of different angles of this molecular docking diagram. It can be seen that the main amino acid residues on VHH (blue) participating in antigen recognition and binding are W99, D101, and Y103, which bind to R487, R490, K530, E533, T576, and E577 (pink side chains) on the AAV capsid (gray) through hydrophobic interaction, electrostatic interaction, and hydrogen bond interaction. These 6 amino acid residues on the AAV capsid are conserved in different serotypes of AAV, which is consistent with the experimental evidence (Table 2) that VHH binds to different serotypes broadly.

[0161] Example 7: FR2 replacement of nanobodies

[0162] (1) Sequence construction. By aligning with a large number of publicly available nanobody sequences, it is found that the FR2 region of the nanobody of the present invention is quite different from that of most nanobodies. The abnormal charge distribution and polarity distribution may affect the stability of the nanobody backbone; and may increase the immunogenicity of the nanobody. When used as a ligand for affinity purification packing in the future, a higher immunogenicity may pose a safety risk. Generally speaking, FR2 does not participate in antigen recognition and only serves as a framework structure. Therefore, we replace the FR2 of the nanobody of the present invention with the common general nanobody FR2 to reduce its immunogenicity. The constructed sequence is outsourced for synthesis and ligated into the plasmid vector pET22b, and the His6 tag on the fusion expression vector is used for detection and purification.

[0163] The sequences are: A1-FR2 (SEQ ID No:48), A2-FR2 (SEQ ID No:49), A3-FR2 (SEQ ID No:50), A4-FR2 (SEQ ID No:51), A5-FR2 (SEQ ID No:52), B1-FR2 (SEQ ID No:53), B2-FR2 (SEQ ID No:54), B3-FR2 (SEQ ID No:55), B4-FR2 (SEQ ID No:56), B5-FR2 (SEQ ID No:57), C1-FR2 (SEQ ID No:58), C2-FR2 (SEQ ID No:59), C3-FR2 (SEQ ID No:60), C4-FR2 (SEQ ID No:61), C5-FR2 (SEQ ID No:62), D1-FR2 (SEQ ID No:63), D2-FR2 (SEQ ID No:64), D3-FR2 (SEQ ID No:65), D4-FR2 (SEQ ID No:66), D5-FR2 (SEQ ID No:67).

[0164] (2) Preparation of recombinant strains. The recombinant plasmid was transformed into Escherichia coli BL21(DE3) strain by chemical transformation method, spread on an LB solid plate containing ampicillin, cultured overnight at 37 °C in an inverted incubator, single colonies were picked, activated in an LB medium containing ampicillin, and after correct sequencing, glycerol with a final concentration of 20% was added and stored frozen as bacterial preservation.

[0165] (3) Periplasmic space expression and extraction. Add 1 mL of LB medium containing ampicillin to a 96-well deep-well plate, inoculate the frozen bacterial preservation into the wells, culture at 37 °C on a shaker at 180 rpm for 4 hours, add IPTG to a final concentration of 0.5 mM, and continue to culture at 30 °C for 16 hours. Centrifuge the deep-well plate at 3500 g for 10 min to discard the medium, add 300 μL of TES solution to resuspend, incubate at 4 °C for 30 min, then add 300 μL of ddH2O, mix and continue to incubate at 4 °C for 30 min. Centrifuge at 3500 g for 10 min to precipitate cell debris, transfer the supernatant to a new 96-well plate, add 60 μL of blocking agent and use it for ELISA test.

[0166] The ELISA results are shown in Table 3, and all the nanobodies after FR2 substitution were positive. Note: The ELISA error and fluctuation range of periplasmic extracts are very large, and it is only used as a preliminary qualitative characterization of the nanobody binding ability, and the values have no comparative significance.

[0167] Table 3 Binding ability of nanobodies after FR2 substitution to different serotypes of AAV

[0168] Sequence Negative control AAV2 AAV6 AAV8 AAV9 A1-FR2 0.071 0.636 0.297 1.237 0.585 A2-FR2 0.083 0.308 0.275 0.689 0.328 A3-FR2 0.069 0.571 0.264 0.833 0.786 A4-FR2 0.085 0.852 0.568 1.321 1.182 A5-FR2 0.068 0.315 0.247 0.458 0.342 B1-FR2 0.064 0.936 0.542 0.996 0.754 B2-FR2 0.085 1.658 1.185 1.928 1.586 B3-FR2 0.069 0.564 0.404 0.681 0.546 B4-FR2 0.070 0.921 0.783 1.555 0.951 B5-FR2 0.079 1.325 0.763 1.860 1.563 C1-FR2 0.072 1.260 1.270 1.889 1.745 C2-FR2 0.090 0.810 0.473 0.920 0.690 C3-FR2 0.084 1.320 1.323 1.907 1.523 C4-FR2 0.076 1.130 0.812 1.652 1.269 C5-FR2 0.076 0.647 0.539 1.080 0.616 D1-FR2 0.078 1.489 1.192 2.073 1.525 D2-FR2 0.077 0.549 0.397 0.889 0.762 D3-FR2 0.081 0.991 0.653 1.592 1.061 D4-FR2 0.074 1.274 0.641 1.787 1.564 D5-FR2 0.080 0.524 0.370 0.733 0.511

[0169] (4) Large-scale preparation of nanobodies

[0170] The preparation process is the same as that of the AAV nanobody in Example 4. After expression and purification, the binding ability of the nanobody to AAV2 was analyzed by SPR technology. AAV2 was amino-coupled to the CM5 sensor chip at a density of 500 - 800 RU, and the nanobody was injected at 7 different concentrations in the range of 1 - 100 nM. The flow rate was 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameters K a , K d and K D . The results are shown in Table 4. The nanobody after FR2 replacement still has a high affinity for AAV2, and its affinity is roughly equivalent to that of the nanobody before FR2 replacement.

[0171] Table 4 Affinity of the nanobody after FR2 replacement for AAV2

[0172]

[0173]

[0174] Example 8: Humanization modification and affinity determination of nanobodies

[0175] In order to reduce the immunogenicity of the nanobody and at the same time maintain or improve the stability and biological activity of the nanobody, the present invention performs CDR region transplantation based on common humanized or highly stable nanobody scaffolds to complete the humanization and stability modification of the nanobody.

[0176] (1) Sequence design

[0177] The present invention selects 4 nanobody scaffolds for modification, namely ah, FGLA, hs2dAb (hereinafter referred to as hs for short) and com scaffolds.

[0178] The ah scaffold is a universal fully humanized scaffold, taken from the literature (Chi, X.J. et al. Humanized single domain antibodies neutralize SARS-CoV-2 by targeting the spike receptor binding domain. Nature Communications 11, doi:10.1038 / s41467-020-18387-8 (2020).).

[0179] FGLA is a general-purpose fully humanized framework, taken from the literature (Vincke, C. et al. General Strategy to Humanize a Camelid Single-domain Antibody and Identification of a Universal Humanized Nanobody Scaffold. J. Biol. Chem. 284, 3273-3284, doi:10.1074 / jbc.M806889200 (2009).).

[0180] hs is a highly stable, highly expressed, partially humanized framework, from the literature (Moutel, S. et al. NaLi-H1: A universal synthetic library of humanized nanobodies providing highly functional antibodies and intrabodies. Elife 5, doi:10.7554 / eLife.16228 (2016).).

[0181] com is a highly stable, highly expressed general framework, from the literature (Ferrari, D., Garrapa, V., Locatelli, M. & Bolchi, A. A Novel Nanobody Scaffold Optimized for Bacterial Expression and Suitable for the Construction of Ribosome Display Libraries. Molecular Biotechnology 62, 43-55, doi:10.1007 / s12033-019-00224-z (2020).).

[0182] The modified sequence names and sequence numbers are shown in Table 5.

[0183] Table 5 Modified sequence names and sequence numbers

[0184]

[0185]

[0186] (2) Vector construction. The above humanized nanobody sequences were fully synthesized externally and constructed into the expression vector pET22b and the expression strain.

[0187] (3) Preparation of recombinant strain. The recombinant plasmid was transformed into Escherichia coli BL21(DE3) strain by chemical transformation method, coated on LB solid plate containing ampicillin, cultured overnight at 37 °C in an inverted incubator, single colonies were picked, activated in LB medium containing ampicillin, and after correct sequencing, glycerol with a final concentration of 20% was added and stored frozen as bacterial preservation.

[0188] (3) Periplasmic space expression and extraction. Add 1 mL of LB medium containing ampicillin into a 96-well deep well plate, inoculate the frozen bacterial preservation into the wells, culture at 37 °C in a shaker at 180 rpm for 4 hours, add IPTG to a final concentration of 0.5 mM, and continue to culture at 30 °C for 16 hours. Centrifuge the deep well plate at 3500 g for 10 min to discard the medium, add 300 μL of TES solution to resuspend, incubate at 4 °C for 30 min, then add 300 μL of ddH2O, mix and continue to incubate at 4 °C for 30 min. Centrifuge at 3500 g for 10 min to precipitate cell debris, transfer the supernatant to a new 96-well plate, add 60 μL of blocking agent and use it for ELISA test.

[0189] The ELISA results are shown in Table 6. The humanized nanobodies were positive for all 4 AAVs, indicating that all the modified nanobodies had the binding ability to AAV.

[0190] Table 6 Binding ability of humanized nanobodies to different serotypes of AAV

[0191]

[0192]

[0193]

[0194] The preparation process of nanobodies was as described in Example 7, and the affinity characterization of nanobodies was as described in Example 5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameters K a 、K d and K D to obtain Table 7.

[0195] Table 7 Affinity of nanobodies C1-C5 and humanized nanobodies

[0196]

[0197]

[0198] Compared with the original sequence, the affinity of the humanized nanobody for the antigen AAV has not decreased significantly, and its affinity for the relevant antigen still remains at the same order of magnitude. For example, the affinities of C1 for AAV2, AAV6, AAV8, and AAV9 are 1.78×10 -8 、7.43×10 -8 、4.30×10 -9 、8.13×10 -9 M respectively, and the affinity levels of its four humanized forms, C1-ah, C1-FLAG, C1-com, and C1-hs, for the above four antigens are still 10 -8 、10 -8 、10 -9 、10 -9 M. The affinities of the humanized forms of C2 to C5 are also roughly equivalent to those of the original sequences and are at the same order of magnitude.

[0199] Example 9: CDR replacement between homologous nanobodies

[0200] The nanobodies of the present invention belong to homologous nanobodies. The lengths of CDR1 are roughly the same and their properties are similar, and the lengths of CDR2 are all the same and their properties are similar. Therefore, CDR1 and CDR2 between homologs can be replaced and transplanted with each other, and the resulting new CDR-grafted nanobodies have the same or similar properties as the original antibodies.

[0201] The sequence modification method is as follows:

[0202] Replace the CDR1 of A1 (SEQ ID No: 28) with CDR1-2 (SEQ ID No: 6) and the CDR2 with CDR2-5 (SEQ ID No: 21) to obtain the new sequence SEQ ID No: 148;

[0203] Replace the CDR1 of A2 (SEQ ID No: 29) with CDR1-3 (SEQ ID No: 7) and the CDR3 with CDR2-6 (SEQ ID No: 22) to obtain the new sequence SEQ ID No: 149;

[0204] Replace the CDR1 of A3 (SEQ ID No: 30) with CDR1-4 (SEQ ID No: 8) instead of CDR1-2 (SEQ ID No: 6), and replace the CDR4 with CDR2-5 (SEQ ID No: 21) instead of CDR2-1 (SEQ ID No: 17) to obtain the new sequence SEQ ID No: 150;

[0205] Replace the CDR1 of A4 (SEQ ID No: 31) with CDR1-5 (SEQ ID No: 9) instead of CDR1-2 (SEQ ID No: 6), and replace the CDR5 with CDR2-7 (SEQ ID No: 23) instead of CDR2-2 (SEQ ID No: 18) to obtain the new sequence SEQ ID No: 151;

[0206] Replace the CDR1 of A5 (SEQ ID No: 32) with CDR1-6 (SEQ ID No: 10) instead of CDR1-1 (SEQ ID No: 5), and replace the CDR6 with CDR2-6 (SEQ ID No: 22) instead of CDR2-3 (SEQ ID No: 19) to obtain the new sequence SEQ ID No: 152;

[0207] Replace the CDR1 of B1 (SEQ ID No: 33) with CDR1-7 (SEQ ID No: 11) instead of CDR1-2 (SEQ ID No: 6), and replace the CDR7 with CDR2-8 (SEQ ID No: 24) instead of CDR2-4 (SEQ ID No: 20) to obtain the new sequence SEQ ID No: 153;

[0208] Replace the CDR1 of B2 (SEQ ID No: 34) with CDR1-7 (SEQ ID No: 11) instead of CDR1-3 (SEQ ID No: 7), and replace the CDR8 with CDR2-9 (SEQ ID No: 25) instead of CDR2-3 (SEQ ID No: 19) to obtain the new sequence SEQ ID No: 154;

[0209] Replace the CDR1 of B3 (SEQ ID No: 35) with CDR1-8 (SEQ ID No: 12) instead of CDR1-4 (SEQ ID No: 8), and replace the CDR9 with CDR2-10 (SEQ ID No: 26) instead of CDR2-3 (SEQ ID No: 19) to obtain the new sequence SEQ IDNo: 155;

[0210] Replace the CDR1 of B4 (SEQ ID No: 36) with CDR1-8 (SEQ ID No: 12) from CDR1-5 (SEQ ID No: 9), and replace CDR10 with CDR2-11 (SEQ ID No: 27) from CDR2-4 (SEQ ID No: 20) to obtain the new sequence SEQ ID No: 156;

[0211] Replace the CDR1 of B5 (SEQ ID No: 37) with CDR1-9 (SEQ ID No: 13) from CDR1-6 (SEQ ID No: 10), and replace CDR11 with CDR2-10 (SEQ ID No: 26) from CDR2-3 (SEQ ID No: 19) to obtain the new sequence SEQ ID No: 157;

[0212] Replace the CDR1 of C1 (SEQ ID No: 38) with CDR1-10 (SEQ ID No: 14) from CDR1-7 (SEQ ID No: 11), and replace CDR12 with CDR2-1 (SEQ ID No: 17) from CDR2-5 (SEQ ID No: 21) to obtain the new sequence SEQ ID No: 158;

[0213] Replace the CDR1 of C2 (SEQ ID No: 39) with CDR1-10 (SEQ ID No: 14) from CDR1-7 (SEQ ID No: 11), and replace CDR13 with CDR2-2 (SEQ ID No: 18) from CDR2-6 (SEQ ID No: 22) to obtain the new sequence SEQ ID No: 159;

[0214] Replace the CDR1 of C3 (SEQ ID No: 40) with CDR1-10 (SEQ ID No: 14) from CDR1-8 (SEQ ID No: 12), and replace CDR14 with CDR2-1 (SEQ ID No: 17) from CDR2-5 (SEQ ID No: 21) to obtain the new sequence SEQ ID No: 160;

[0215] Replace the CDR1 of C4 (SEQ ID No: 41) with CDR1-11 (SEQ ID No: 15) from CDR1-8 (SEQ ID No: 12), and replace CDR15 with CDR2-2 (SEQ ID No: 18) from CDR2-7 (SEQ ID No: 23) to obtain the new sequence SEQ ID No: 161;

[0216] Replace the CDR1 of C5 (SEQ ID No: 42) with CDR1-12 (SEQ ID No: 16) from CDR1-9 (SEQ ID No: 13), and replace CDR16 with CDR2-3 (SEQ ID No: 19) from CDR2-6 (SEQ ID No: 22) to obtain the new sequence SEQ ID No: 162;

[0217] Replace the CDR1 of D1 (SEQ ID No: 43) with CDR1-1 (SEQ ID No: 5) from CDR1-10 (SEQ ID No: 14), and replace CDR17 with CDR2-1 (SEQ ID No: 17) from CDR2-8 (SEQ ID No: 24) to obtain the new sequence SEQ ID No: 163;

[0218] Replace the CDR1 of D2 (SEQ ID No: 44) with CDR1-1 (SEQ ID No: 5) from CDR1-10 (SEQ ID No: 14), and replace CDR18 with CDR2-2 (SEQ ID No: 18) from CDR2-9 (SEQ ID No: 25) to obtain the new sequence SEQ ID No: 164;

[0219] Replace the CDR1 of D3 (SEQ ID No: 45) with CDR1-2 (SEQ ID No: 6) from CDR1-10 (SEQ ID No: 14), and replace CDR19 with CDR2-2 (SEQ ID No: 18) from CDR2-10 (SEQ ID No: 26) to obtain the new sequence SEQ ID No: 165;

[0220] Replace the CDR1 of D4 (SEQ ID No: 46) with CDR1-1 (SEQ ID No: 5) from CDR1-11 (SEQ ID No: 15), and replace CDR20 with CDR2-1 (SEQ ID No: 17) from CDR2-11 (SEQ ID No: 27) to obtain the new sequence SEQ ID No: 166;

[0221] Replace the CDR1 of D5 (SEQ ID No: 47) with CDR1-1 (SEQ ID No: 5) from CDR1-12 (SEQ ID No: 16), and replace CDR21 with CDR2-1 (SEQ ID No: 17) from CDR2-10 (SEQ ID No: 26) to obtain the new sequence SEQ ID No: 167.

[0222] The above sequence was outsourced for synthesis, and the carrier preparation, preparation of genetically engineered bacteria, periplasmic expression, large-scale preparation, expression purification, and affinity determination were carried out in the manner described in Example 7.

[0223] The binding ability of the nanobody after CDR replacement to AAV was characterized by ELISA experiment. The experimental procedure was as described in Example 7. The experimental results are shown in Table 8. The ELISA results indicate that the nanobody after CDR replacement has binding ability to various AAVs.

[0224] Table 8 Binding ability of the nanobody after CDR replacement to AAV

[0225]

[0226]

[0227] The affinity of the nanobody after CDR replacement was characterized as described in Example 5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameters K a 、K d and K D to obtain Table 9.

[0228] Table 9 Affinity of the nanobody after CDR replacement

[0229]

[0230] Compared with the original sequence, the affinity of the humanized nanobody to the antigen AAV was not significantly reduced. For example, the affinities of C4 to AAV2, AAV6, AAV8, and AAV9 were 4.21×10 -8 、8.38×10 -8 、4.39×10 -9 、2.45×10 -8 M respectively. The affinity levels of its sequence C4-CDR after CDR transplantation to AAV2, AAV6, and AAV8 antigens were still 10 -8 、10 -8 、10 -9 , and the affinity of C4-CDR to AAV9 antigen was slightly increased to 10 -9 M. The affinities of the CDR transplantation forms of C1, C2, C3, and C5 were generally equivalent to those of the original sequence, with a fluctuation of no more than one order of magnitude within the range of equivalent affinities.

[0231] Example 10 AAV preparation

[0232] HEK293T cells were cultured and changed to antibiotic-free medium one day before transfection, and cultured for 12 - 24 h to make the cell density reach 80%.

[0233] Prepare the EZ-Trans-DNA complex. Tube A: The molar ratio of pAAV-hrGFP, pAAV-RC, and pHelper is 1:1:1, and the total amount of the three plasmids is 36 μg / 15 mL of cells, supplemented with DMEM; Tube B: Dilute 108 μL of the EZ Trans transfection reagent with DMEM. Mix well. Let it stand at room temperature for 10 - 15 min.

[0234] Transfect the cells. Slowly add the prepared transfection system to the culture dish respectively, 3 mL / dish; Slowly shake the culture dish to mix well and place it in the incubator for culture. After culturing for 24 h, change the medium, replace it with a new medium, and observe the transfection efficiency using a fluorescence microscope at the same time.

[0235] Virus collection. The virus can be collected 48 - 72 h after transfection. Scrape the cells with a cell scraper and collect them in a 50 mL centrifuge tube. Centrifuge at 200×g for 5 min to collect the cell pellet. Resuspend the cells with PBS and ultrasonically disrupt them.

[0236] Example 11 AAV adsorbent preparation and effect evaluation

[0237] Activation of agarose gel. Take 2 g of agarose microspheres, add 2 mol / L NaOH and 0.8 mL of 1,4-butanediol diglycidyl ether. After mixing in this proportion, react for more than 60 min. After the reaction, wash the gel with a large amount of deionized water and then filter it into a wet cake by suction filtration.

[0238] Immobilization of AAV nanobody. Take the activated agarose gel carrier material, add 2 mL of the nanobody solution (in this example, PBS is used to prepare the nanobody solution, and normal saline or pure water can also be used), and couple at 37℃ and 250 rpm for 24 h. After the reaction, add 3 times the volume of ethanolamine (volume ratio 6%, pH 9.0) and seal overnight to obtain the AAV adsorbent.

[0239] Load 1 mL of the prepared AAV adsorbent into a chromatographic column with a column height of 2 cm. After loading the column, first rinse with the equilibration buffer; then load the sample, and rinse with the equilibration buffer again after loading; then elute with the elution buffer. Determine the total amount of AAV in the loaded sample, flow-through, equilibration solution, and elution solution, and calculate the AAV recovery rate. Among them, VP represents the number of virus capsid particles.

[0240] AAV recovery rate = AAV elution amount (VP) ÷ AAV binding amount (VP) × 100%

[0241] Equilibration buffer: 10 mM Tris - 300 mM NaCl, pH 7.6; Elution buffer: 0.1 M NaAc, 0.5 M NaCl, pH 1.5.

[0242] Results: Adsorbents synthesized with the original and modified nanobodies can effectively bind different serotypes of AAV. During the synthesis of the adsorbent, the coupling density of the ligand on the adsorbent can be regulated by changing the protein solution concentration, epoxy density, and glue ratio.

[0243] Increasing the coupling density helps to obtain a higher AAV loading and reduce the breakthrough ratio. On the premise of not overloading, increasing the titer of the sample loaded helps to obtain a higher recovery rate.

[0244] ① The nanobody is A1, the initial concentration is 8.8 mg / mL, the epoxy density on the gel is 5 μmol / g, the glue ratio is 1:7, the protein utilization rate is 33.6%, and the final nanobody coupling amount is 20.7 mg / g of adsorbent. The binding amount of this adsorbent to AAV9 is 7.23E+14, the breakthrough rate is 15.92%, the elution amount is 5.99E+14, and the recovery rate is 82.82%.

[0245] ② The nanobody is B1, the initial concentration is 7.0 mg / mL, the epoxy density on the gel is 5 μmol / g, the glue ratio is 1:3, the protein utilization rate is 36.7%, and the final nanobody coupling amount is 7.7 mg / g of adsorbent. The binding amount of this adsorbent to AAV2 is 2.50E+14, the breakthrough rate is 18.26%, the elution amount is 1.97E+14, and the recovery rate is 78.94%.

[0246] ③ The nanobody is C1, the initial concentration is 6.7 mg / mL, the epoxy density on the gel is 3 μmol / g, the glue ratio is 1:5, the protein utilization rate is 34.6%, and the final nanobody coupling amount is 11.6 mg / g of adsorbent. The binding amount of this adsorbent to AAV6 is 6.29E+14, the breakthrough rate is 16.08%, the elution amount is 4.98E+14, and the recovery rate is 79.08%.

[0247] ④ The nanobody is D1, the initial concentration is 5.7 mg / mL, the epoxy density on the gel is 3 μmol / g, the glue ratio is 1:3, the protein utilization rate is 46.4%, and the final nanobody coupling amount is 7.9 mg / g of adsorbent. The binding amount of this adsorbent to AAV8 is 6.59E+14, the breakthrough rate is 18.38%, the elution amount is 5.28E+14, and the recovery rate is 80.04%.

[0248] ⑤ The nanobody is A1-FR2, the initial concentration is 5.1 mg / mL, the epoxy density on the gel is 2 μmol / g, the glue ratio is 1:5, the protein utilization rate is 22.9%, and the final nanobody coupling amount is 5.9 mg / g of adsorbent. The binding amount of this adsorbent to AAV2 is 6.24E+13, the breakthrough rate is 17.09%, the elution amount is 4.84E+13, and the recovery rate is 77.52%.

[0249] ⑥ The nanobody is B1-com, with an initial concentration of 3.8 mg / mL, an epoxy density on the gel of 2 μmol / g, a glue-to-substrate ratio of 1:3, a protein utilization rate of 26.8%, and a final nanobody coupling amount of 3.1 mg / g adsorbent. The binding amount of this adsorbent to AAV6 is 5.73E+13, the breakthrough rate is 20.22%, the elution amount is 4.30E+13, and the recovery rate is 75.06%.

[0250] ⑦ The nanobody is C1-hs, with an initial concentration of 8.9 mg / mL, an epoxy density on the gel of 3 μmol / g, a glue-to-substrate ratio of 1:5, a protein utilization rate of 36.1%, and a final nanobody coupling amount of 16.1 mg / g adsorbent. The binding amount of this adsorbent to AAV8 is 5.52E+13, the breakthrough rate is 10.74%, the elution amount is 4.53E+13, and the recovery rate is 82.02%.

[0251] ⑧ The nanobody is D1-CDR, with an initial concentration of 9.0 mg / mL, an epoxy density on the gel of 3 μmol / g, a glue-to-substrate ratio of 1:3, a protein utilization rate of 43.0%, and a final nanobody coupling amount of 11.6 mg / g adsorbent. The binding amount of this adsorbent to AAV9 is 7.29E+13, the breakthrough rate is 12.84%, the elution amount is 5.81E+13, and the recovery rate is 79.67%.

[0252] In summary, the AAV adsorbent prepared by the present invention has the binding ability to AAV of different serotypes and a high recovery rate. It is a novel broad-spectrum AAV adsorbent and can be used for the purification of AAV of different serotypes.

[0253] Example 12 AAV detection kit preparation

[0254] The nanobody A1 was exchanged into PBS (pH 7.4) at a concentration of approximately 10 mg / mL, and it was labeled using an HRP conjugation kit (abcam, ab102890), and then thoroughly dialyzed and exchanged with buffer.

[0255] Direct ELISA detection method:

[0256] Add the AAV standard or the sample to be tested to a high-hydrophobic 96-well plate, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; block with 1% - 3% skim milk powder and wash the plate with PBS; add the HRP-conjugated nanobody A1, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; add the TMB working solution, incubate at room temperature in the dark for 30 min, add 2M sulfuric acid termination solution to terminate the reaction, and measure the OD 450 . (OD 450is the absorbance (Optical Density) measured at a wavelength of 450 nanometers (nm), which is also the optical density and is used to quantitatively analyze the concentration of substances in a solution.)

[0257] Sandwich ELISA detection method:

[0258] Coat the capture ligand on a highly hydrophobic 96-well plate, incubate overnight at 4°C in the dark, and wash the plate with PBS; block with 1% - 3% skim milk powder and wash the plate with PBS; add the AAV standard or the sample to be tested, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; add the nanobody A1 conjugated with HRP, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; add the TMB working solution, incubate at room temperature in the dark for 30 min, add 2M sulfuric acid termination solution to terminate the reaction, and measure the OD 450 .

[0259] The capture ligand can be nanobody A1 or other nanobodies in the present invention, or an anti-AAV antibody, or other ligand molecules that can bind to AAV. The capture antibody used in this example is C1-CDR.)

[0260] The standard curve for detecting AAV8 by the kit of the present invention is as Figure 4 and Figure 5 shown, where Figure 4 is the standard curve detected by direct ELISA, y = 7.052E-11x - 8.152E-02, R 2 = 9.989E-01.) Figure 5 is the standard curve detected by sandwich ELISA. The fitting curve used is a four-parameter Logistic curve fitting, and the fitting result is: y = (A - D) / [1 + (x / C)^B] + D, where A = 3.52036, B = -2.07294, C = 355.92016, D = 0.11490, R 2 = 0.99948. The R values of both 2 can reach above 0.99, indicating that the ELISA detection method established based on the nanobodies of the present invention has strong reliability and high sensitivity.)

[0261] The prior art uses real-time quantitative PCR detection technology to detect virus particles containing DNA and cannot detect empty capsids. The present invention can detect both empty capsids and virus particles. The detection of empty capsids is very important because empty capsids are not beneficial for treatment and may even increase immunogenicity. Therefore, quantitatively detecting and controlling the content of empty capsids is a key step in AAV preparation.)

[0262] Industrial applicability

[0263] The nanobody of the present invention is an anti-AAV nanobody with a new amino acid sequence discovered through screening of a phage library. This nanobody, its FR2 replacement nanobody, humanized nanobody, and CDR grafted nanobody have high affinity and activity, can specifically recognize and bind to AAV. The prepared affinity chromatography column has extremely strong adsorption capacity for AAV and can be used for AAV purification. The prepared detection kit can be used to detect AAV and perform quantitative analysis.

[0264] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A nanobody, characterized in that, The variable region in the amino acid sequence of the nanobody includes complementarity-determining regions CDR and framework regions FR. The complementarity-determining regions CDR include complementarity-determining region CDR1, complementarity-determining region CDR2, and complementarity-determining region CDR3. The nanobody can recognize and specifically bind to AAV. Among them, the complementarity-determining region CDR3 is of the ArgTrpProAspXaaTyr family, where Xaa is selected from Pro, Arg, or Gly, and the binding sites of the complementarity-determining region CDR3 to AAV are Trp99, Asp101, and Tyr103. The nanobody sequence is selected from: SEQ ID No: 38, SEQ ID No: 39, SEQ ID No: 40, SEQ ID No: 41, SEQ ID No: 42, SEQ ID No: 43, SEQ ID No: 44, SEQ ID No: 45, SEQ ID No: 46, or SEQ ID No:

47.

2. The nanobody according to claim 1, wherein The nanobody is a nanobody obtained by FR2 framework replacement.

3. The nanobody according to claim 2, characterized in that, The FR2 framework replacement nanobody is selected from: SEQ ID No: 58, SEQ ID No: 59, SEQ ID No: 60, SEQ ID No: 61, SEQ ID No: 62, SEQ ID No: 63, SEQ ID No: 64, SEQ ID No: 65, SEQ ID No: 66, or SEQ ID No:

67.

4. The nanobody according to claim 1, characterized in that, The nanobody is a nanobody obtained by humanization.

5. The nanobody according to claim 4, characterized in that, The humanized nanobody is selected from: SEQ ID No: 78, SEQ ID No: 79, SEQ ID No: 80, SEQ ID No: 81, SEQ ID No: 82, SEQ ID No: 83, SEQ ID No: 84, SEQ ID No: 85, SEQ ID No: 86, SEQ ID No: 87, SEQ ID No: 98, SEQ ID No: 99, SEQ ID No: 100, SEQ ID No: 101, SEQ ID No: 102, SEQ ID No: 103, SEQ ID No: 104, SEQ ID No: 105, SEQ ID No: 106, SEQ ID No: 107, SEQ ID No: 118, SEQ ID No: 119, SEQ ID No: 120, SEQ ID No: 121, SEQ ID No: 122, SEQ ID No: 123, SEQ ID No: 124, SEQ ID No: 125, SEQ ID No: 126, SEQ ID No: 127, SEQ ID No: 138, SEQ ID No: 139, SEQ ID No: 140, SEQ ID No: 141, SEQ ID No: 142, SEQ ID No: 143, SEQ ID No: 144, SEQ ID No: 145, SEQ ID No: 146 or SEQ ID No:

147.

6. The nanobody according to claim 1, characterized in that, The nanobody is a nanobody obtained by CDR grafting, and the CDR-grafted nanobody is selected from: SEQ ID No: 158, SEQ ID No: 159, SEQ ID No: 160, SEQ ID No: 161, SEQ ID No: 162, SEQ ID No: 163, SEQ ID No: 164, SEQ ID No: 165, SEQ ID No: 166 or SEQ ID No:

167.

7. A nucleic acid, characterized in that, The nucleic acid encodes the nanobody according to any one of claims 1 to 6.

8. An expression vector, characterized in that, An expression cassette comprising the nucleic acid according to claim 7.

9. A host cell, characterized in that, An expression vector comprising the expression cassette according to claim 8.

10. Use of the nanobody according to any one of claims 1 to 6 in the preparation of a virus adsorbent, a virus purification kit, and a virus detection kit, wherein the virus is AAV.

11. A virus adsorbent, characterized in that, Comprising a vector matrix and the nanobody according to any one of claims 1 to 6.

12. A virus purification kit, characterized in that, Comprising a vector matrix and the nanobody according to any one of claims 1 to 6.

13. A virus detection kit, characterized in that, Comprising a vector matrix and the nanobody according to any one of claims 1 to 6.

14. A method for detecting AAV for non-diagnostic purposes, characterized in that, The nanobody described in any one of claims 1 to 6 is conjugated with HRP together with a carrier matrix, and then detected by direct enzyme-linked immunosorbent assay or sandwich enzyme-linked immunosorbent assay.

Citation Information

Patent Citations

  • AAV-specific antibodies and uses thereof

    CN113583112A

  • Polyclonal antibody for specifically recognizing AAV9 capsid protein and preparation method thereof

    CN114685651A

  • Lepidopteran GABA-gated chloride channels

    WO1998049185A1

  • Method of modulating metabolite biosynthesis in recombinant cells

    WO2000046383A2

  • Method for generating cgmmv resistant plants, genetic constructs, and obtained cgmmv-resistant plants

    WO2001009300A2