Broad-spectrum nano antibody for resisting novel coronavirus SARS-CoV-2 and application thereof

Abstract

The invention discloses a broad-spectrum nano antibody for resisting novel coronavirus SARS-CoV-2 and application of the broad-spectrum nano antibody, and belongs to the technical field of biological pharmacy. The nano antibody provided by the invention can recognize S-ECD tripolymer proteins and S-RBD proteins of different variants of SARS-CoV-2, has a very strong binding effect with the S-ECD tripolymer proteins and the S-RBD proteins, and can be used as a broad-spectrum neutralizing antibody and a drug for resisting the SARS-CoV-2 variants.

Description

Technical Field

[0001] The present invention belongs to the technical field of biopharmaceuticals and relates to a nano antibody with a broad spectrum against the novel coronavirus SARS-CoV-2 and its application. Background Art

[0002] The acute respiratory infectious disease caused by the novel coronavirus (also referred to as the new coronavirus in this article) SARS-CoV-2 can rapidly develop into acute respiratory distress syndrome (ARDS), acute respiratory failure, and other serious complications. Therefore, it is imperative to accelerate the development of preventive vaccines and antiviral drugs.

[0003] Coronaviruses can cause multisystem infections in a variety of animals. Before COVID-19, there were six coronaviruses that could infect humans, mainly causing respiratory infections in humans, including two highly lethal coronaviruses, severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV) and Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV), and four coronaviruses that can cause mild upper respiratory tract diseases, namely HCoV-OC43, HCoV-229E, HCoV-NL63, and HCoV-HKU1. Like other coronaviruses such as SARS-CoV, the spike protein (S protein) located on the surface of SARS-CoV-2 mediates the invasion of the virus into target cells. The S1 subunit at its amino terminus contains a receptor binding domain (RBD) that can bind to the cell receptor ACE2, while the S2 subunit at its carboxyl terminus mainly mediates the membrane fusion process between the virus and the target cell. The molecular structure of the S protein and its RBD functional region of SARS-CoV-2 has been reported, revealing the mechanism by which the virus is highly transmissible through the high-affinity interaction between the S protein and ACE2. The coronavirus S protein not only mediates the invasion of the virus, but is also the main viral antigen that mediates the neutralizing antibody immune response. Therefore, it is widely studied as a vaccine and immunotherapy target. The S protein and its RBD functional region of SARS-CoV-2 contain multiple conformation-dependent neutralizing antibody epitopes, which can induce high-titer neutralizing antibodies in infected people and immune animals. More than 100 institutions around the world are scrambling to develop successful vaccines or are trying different drugs and therapies to effectively fight coronaviruses. Obtaining neutralizing antibodies (nAbs) against the new coronavirus SARS-CoV-2 is a potential prevention and treatment option, and is also one of the most promising antiviral therapies currently.

[0004] The continuous emergence of SARS-CoV-2 variants (from the original strain to the D614G mutant, and the subsequent Alpha, Beta, Gamma, Delta, Omicron, and the current Omicron BA.2 / BA.4 / BA.5 / BF.7 substrains) has weakened the effectiveness of the vaccine, and recovered patients are at risk of reinfection. In particular, Omicron's S protein has 32 mutations, and it also has important amino acid mutation sites of the S proteins of Alpha, Beta, Gamma, and Delta, showing stronger infectivity than previous variants. However, to date, no specific antiviral drugs for SARS-CoV-2 have been found. Therefore, there is an urgent need to explore drug targets against SARS-CoV-2 (especially its mutants) and develop effective clinical drugs. Summary of the invention

[0005] In response to one or more of the problems existing in the prior art, the first aspect of the present invention provides a broad-spectrum anti-novel coronavirus SARS-CoV-2S protein Nanobody, which comprises a CDR1 with an amino acid sequence as shown in SEQ ID NO:9, a CDR1 with an amino acid sequence as shown in SEQ ID NO:10, and a CDR3 with an amino acid sequence as shown in SEQ ID NO:11; or comprises a CDR1 with an amino acid sequence as shown in SEQ ID NO:13, a CDR1 with an amino acid sequence as shown in SEQ ID NO:14, and a CDR3 with an amino acid sequence as shown in SEQ ID NO:15.

[0006] In some embodiments, the Nanobody comprises or consists of the amino acid sequence shown in SEQ ID NO:8, or comprises or consists of the amino acid sequence shown in SEQ ID NO:12, or comprises both the amino acid sequences shown in SEQ ID NO:8 and SEQ ID NO:12.

[0007] In some embodiments, the Nanobody comprises the amino acid sequence shown in SEQ ID NO: 17, or consists of it.

[0008] In a second aspect, the present invention provides a fusion protein, which is formed by fusion of the Nanobody provided in the first aspect of the present invention with IgG1-Fc or IgA1-Fc.

[0009] In some embodiments, the amino acid sequence of the fusion protein is represented by the following general formula (I):

[0010] NB1—linker1—NB2—linke2—NB3—Fc(I)

[0011] In formula (I):

[0012] NB1, NB2 and NB3 are identical or different, and independently represent the amino acid sequence of the Nanobody of any one of claims 1 to 3;

[0013] Linker1 and linker2 are the same or different and are independently represented as linker sequences. Optionally, the amino acid sequences of linker1 and linker2 are both as shown in SEQ ID NO: 18;

[0014] Fc is selected from IgG1-Fc and IgA1-Fc;

[0015] And wherein NB1 and linker1 exist or do not exist at the same time, and NB2 and linke2 exist or do not exist at the same time.

[0016] In some embodiments, the fusion protein comprises, or consists of, the amino acid sequence shown in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 or SEQ ID NO:33.

[0017] In a third aspect, the present invention provides a nucleic acid encoding the Nanobody provided in the first aspect of the present invention, or encoding the fusion protein provided in the second aspect of the present invention.

[0018] In a fourth aspect, the present invention provides an expression vector comprising the nucleic acid provided in the third aspect of the present invention.

[0019] In a fifth aspect, the present invention provides a host cell, which contains the expression vector provided by the fourth aspect of the present invention, or contains the nucleic acid provided by the third aspect of the present invention, or contains the nanobody provided by the first aspect of the present invention, or contains the fusion protein provided by the second aspect of the present invention, or expresses the nanobody provided by the first aspect of the present invention, or expresses the fusion protein provided by the second aspect of the present invention.

[0020] In the sixth aspect, the use of the nanoantibody provided in the first aspect of the invention, and / or the fusion protein provided in the second aspect of the invention, and / or the nucleic acid provided in the third aspect of the invention, and / or the expression vector provided in the fourth aspect of the invention, and / or the host cell provided in the fifth aspect of the invention in the preparation of anti-SARS-CoV-2 drugs, or agents that block the binding of SARS-CoV-2S protein to ACE2 protein also belongs to the content of the present invention.

[0021] In some embodiments, the SARS-CoV-2 includes wild strains and mutant strains thereof, and optionally, the mutant strains include Alpha, Beta, Gamma, Delta, and Omicron mutant strains.

[0022] In a seventh aspect, the present invention provides an anti-SARS-CoV-2 drug, comprising the nanoantibody provided by the first aspect of the invention, and / or the fusion protein provided by the second aspect of the invention, and / or the nucleic acid provided by the third aspect of the invention, and / or the expression vector provided by the fourth aspect of the invention, and / or the host cell provided by the fifth aspect of the invention.

[0023] In an eighth aspect, the present invention also provides an agent for blocking the binding of SARS-CoV-2S protein to ACE2 protein, comprising the nanoantibody provided in the first aspect of the invention, and / or the fusion protein provided in the second aspect of the invention, and / or the nucleic acid provided in the third aspect of the invention, and / or the expression vector provided in the fourth aspect of the invention, and / or the host cell provided in the fifth aspect of the invention.

[0024] The present invention screened and identified two nanobodies that can broadly recognize and bind to the surface S protein (including S-ECD and S-RBD) of multiple variants of SARS-CoV-2 (SARS-CoV-2B.1.1.529 (Omicron) virus strain, SARS-CoV-2B.1.617.2 (Delta strain) virus strain and SARS-CoV-2BA.4.6 / BF.7, etc.), and based on these two nanobodies, bispecific nanobodies and fusion proteins fused with IgG1-Fc or IgA1-Fc are also designed. These nanobodies and fusion proteins can simultaneously recognize and bind to two highly conserved antigenic epitopes on the surface S protein of multiple variants of SARS-CoV-2, and based on the fused IgA1-Fc, the provided fusion protein can also effectively penetrate the neutralizing antibody into the virus infection site through receptor-mediated transport. In addition, in vitro neutralization experiments and pseudovirus neutralization experiments also show that the fusion protein fused with IgA1-Fc has stronger neutralizing activity than the fusion protein fused with IgG1-Fc. Therefore, the nanoantibodies and / or fusion proteins provided by the present invention, especially the fusion proteins fused with IgA1-Fc, can be used to produce drugs against SARS-CoV-2, especially drugs against a variety of variants of SARS-CoV-2 with a broad spectrum. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 These are the test results of the specific antibody titers of SARS-CoV-2S trimer protein (A) and S-RBD protein (B) in immune plasma.

[0026] Figure 2 ELISA was used to detect the specific binding ability of 7 recombinantly expressed nanobodies (i.e. 7 fusion proteins) to the S protein of SARS-CoV-2 variants (Omicron and Delta virus strains) (A) and the specific binding ability of 3 recombinantly expressed nanobodies (i.e. 3 fusion proteins) to the SARS-CoV2 Omicron subviral S protein.

[0027] Figure 3 Schematic diagram of the simulated variable region structure of nanobodies NB15 (A) and NB19 (B).

[0028] Figure 4 These are the affinity test results of fusion proteins NB15G and NB19G for SARS-CoV-2S-RBD.

[0029] Figure 5 These are the test results of two subtypes of nanoantibody NB15 competing to inhibit the binding of SARS-CoV-2S-RBD to ACE2 protein.

[0030] Figure 6 These are the test results of the neutralizing activity of two subtypes of nanoantibody NB15 against SARS-CoV-2 pseudovirus. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Unless otherwise expressly stated, throughout the specification and claims, the term "including" or its variations such as "including" or "containing" will be understood to include the stated elements or components, without excluding other elements or other components.

[0032] In addition, in order to better illustrate the present invention, numerous specific details are provided in the specific embodiments below. It should be understood by those skilled in the art that the present invention can also be implemented without certain specific details. In some embodiments, raw materials, elements, methods, means, etc. well known to those skilled in the art are not described in detail, so as to highlight the main purpose of the present invention.

[0033] As used in the present invention, the term "nanoantibody" refers to a "single-domain antibody", which contains only one heavy chain variable region (VHH, variable domain of heavy chain of heavy-chain antibody), and compared to other antibodies, the light chain is naturally missing. Specifically, nanoantibodies are special antibodies that naturally lack light chains in the peripheral blood of alpacas. This antibody is the smallest antigen-binding unit of natural origin known to date. It is composed only of the VHH heavy chain variable region and the CH2 and CH3 constant regions, and the VHH region alone has the same specific antigen-binding ability. In addition, it also has the advantages of small molecule drugs and antibodies, with the advantages of good solubility, low immunogenicity, strong penetration and simple humanization, and is suitable for a variety of expression systems. It is considered to be a very promising antibody drug.

[0034] In the context of the present invention, when referring to a ligand / receptor, antibody / antigen or other binding pair, "specific" binding refers to determining the presence or absence of a binding reaction of the protein, such as a Nanobody of the invention, to the SARS-CoV-2 S protein in a heterogeneous population of proteins and / or other biological agents. Thus, under the specified conditions, a specific ligand / antigen binds to a specific receptor / antibody and does not bind to other proteins present in the sample in significant amounts.

[0035] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0036] The methods for obtaining various biological materials described in the examples are only provided as a way of obtaining them in an experiment to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0037] Some synthetic biological materials involved in the following embodiments, such as primers, sequences and other materials that need to be artificially synthesized, can be synthesized using existing technologies.

[0038] The strains and plasmid vectors used in the examples of the present invention are:

[0039] Escherichia coli TG1 cells were purchased from Beijing Huayueyang Biological Co., Ltd. The genotype was: [F'traD36 proABlacIqZΔM15]supE thi-1Δ(lac-proAB)Δ(mcrB-hsdSM)5(rK-mK-).

[0040] M13K07 helper phage was purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0041] The pFUSE-hIgG1-Fc2 eukaryotic expression vector and the phage pMES4 vector were both preserved in this laboratory.

[0042] Example 1. Detection of plasma specific antibodies in alpacas immunized with SARS-CoV-2 S protein

[0043] This embodiment uses recombinant SARS-CoV-2S-ECD protein to immunize alpacas, and detects whether specific antibodies against SARS-CoV-2S protein are produced in the plasma of the immunized alpacas, which specifically includes the following operations.

[0044] 1.1) A 3.5-year-old male alpaca (purchased from a farm in Inner Mongolia) was immunized with recombinant SARS-CoV-2S-ECD protein (purchased from Beijing Sino Biological Technology Co., Ltd., catalog number 40589-V08B4) for the first immunization and three booster immunizations. For the first immunization, 0.5 mg of recombinant SARS-CoV-2S-ECD protein was mixed with complete Freund's adjuvant in a 1:1 ratio and fully emulsified, and the alpaca was immunized by subcutaneous injection; then, 0.25 mg of recombinant SARS-CoV-2S-ECD protein was mixed with incomplete Freund's adjuvant in a 1:1 ratio and three booster immunizations were performed; a total of 4 immunizations were performed, with a single interval of two weeks.

[0045] 1.2) After immunization, 100 ml of alpaca whole blood was collected intravenously, and the whole blood was centrifuged to obtain the upper plasma to detect the production of recombinant SARS-CoV-2S-ECD protein-specific antibodies (hereinafter also referred to as SARS-CoV-2S protein-specific antibodies). Specifically, the upper plasma (initial dilution was 1:500) was diluted according to a doubling dilution ratio to obtain 12 concentrations of test samples, and the ELISA method was used to detect the titer of SARS-CoV-2S protein-specific antibodies in these samples (described in detail below); the lower whole blood cells were diluted with 1640 culture medium, and PBMC (peripheral blood mononuclear cells) were separated to establish the VHH library in subsequent examples.

[0046] The titer detection of SARS-CoV-2S protein-specific antibodies in alpaca plasma (based on the ELISA principle) mainly includes the following operations.

[0047] (1) SARS-CoV-2 S-ECD protein (catalog number: 40589-V08B4) and SARS-CoV-2 S-RBD protein (purchased from Beijing Sino Biological Technology Co., Ltd., catalog number: 40592-V08H) were respectively treated with 0.1 mol / L NaHCO at pH 9.6. 3 The coating buffer was diluted and added to a 96-well microplate, 100 μL per well, and coated overnight at 4°C.

[0048] (2) Wash twice with 0.1% TBST, add 300 μL of TBST blocking solution containing 3% BSA, and incubate at 37°C for 2 h.

[0049] (3) Add the above-mentioned diluted alpaca plasma, set up 2 replica wells for each dilution, and incubate the reaction at 37°C for 2 h.

[0050] (4) Washing and adding enzyme-labeled secondary antibody: HRP-labeled anti-alpaca antibody (Abcam, catalog number: ab112786) was diluted 1:8000, 100 μL / well, and incubated at 37°C for 1 h.

[0051] (5) Add 100 μL / well TMB colorimetric solution, incubate at 37°C for 5 min, and add 100 μL / well 2 mol / L H 2 SO 4 The color development reaction was terminated with the stop solution, and the absorbance was measured using an enzyme reader with an absorption wavelength of 450 nm and a correction wavelength of 630 nm.

[0052] The results are as follows Figure 1 As shown in the figure, Pre-plasma is the alpaca plasma before immunization as a negative control. It can be seen that the immunized alpaca plasma produced high-titer antibodies against SARS-CoV-2 S-ECD (S-tri) and S-RBD proteins, and as the dilution of plasma increases (for example, the dilution is greater than 10 4 ), the reaction value decreased, which was dose-dependent. The results suggest that the alpacas, which have been immunized four times, have indeed produced high-titer specific antibodies against the SARS-CoV-2S protein, which can be used for VHH library establishment and nanoantibody screening.

[0053] Example 2: Selection of phage-displayed nanobodies capable of binding to the S-RBD of SARS-CoV-2 strains

[0054] This embodiment first performs alpaca immunization and antibody library construction, and then uses phage display technology to screen nanoantibodies capable of binding to the S-RBD protein of the SARS-CoV-2 virus strain from PBMCs in the whole blood cells of alpacas immunized with the SARS-CoV-2S protein, specifically including the following operations.

[0055] 2.1) Construction of alpaca immune antibody library

[0056] 2.1.1) Collect PBMCs separated from the whole blood cells in the lower layer in 1.1) of Example 1, use TRIZOL reagent to isolate total RNA, and use SuperScript TM II reverse transcriptase and oligo-dT primer to obtain its cDNA.

[0057] 2.1.2) The cDNA obtained above was used as a template, and the first PCR amplification was performed using the CALL001 primer, CALL002 primer and Phusion Ultra-Fidelity PCR Master Mix shown in Table 1 below. The reaction system was 20 μL, incubated at 98°C for 30 seconds to denature the cDNA and activate the polymerase, and then 30 PCR cycles were performed, each cycle including 98°C-30 seconds, 57°C-30 seconds and 72°C-20 seconds. After the last PCR cycle, a final DNA extension step was performed at 72°C for 7 minutes. The first PCR product was then subjected to agarose electrophoresis, and the band at 700 bp was recovered and merged and used as a template for the second PCR (nested PCR); the second PCR amplification was then performed using the VHH-BACK primer and PMCF primer shown in Table 1 below. The reaction system was the same as the first PCR amplification. The DNA template was denatured and the polymerase was activated by incubating at 98°C for 30s, and then 25 PCR cycles were performed, each cycle including 98°C-30s, 57°C-30s and 72°C-20s. After the last PCR cycle, a DNA extension step was performed at 72°C for 7min. The obtained PCR product was then subjected to agarose electrophoresis, and the estimated bands of <500 bp were collected and purified. After two rounds of PCR amplification and purification, the heavy chain variable region (VHH) fragment of the antibody naturally lacking light chains in the peripheral blood of the alpaca was obtained.

[0058] Table 1: Primers used for construction of alpaca phage VHH display library

[0059]

[0060] 2.1.3) The purified nested PCR product (400 bp amplification band) and the phage pMES4 vector were digested with Pst I, Not I and XbaI, and the digested products were ligated in the presence of T4 ligase at a molar ratio of 3:1 at 16°C and then electroporated into E. coli TG1 competent cells. The electroporated bacterial solution was cultured in LB liquid medium at 37°C on a shaker for 1 hour, and 1 μl was taken to dilute 10 3 , 10 6 , 10 9After the PCR reaction, the surface of the Amp-resistant LB solid culture dish was coated for library capacity determination, and the remaining bacterial solution was coated on the surface of the LB solid culture dish and cultured in a 37°C incubator overnight. The next day, all colonies were collected as the VHH antibody library. The colony PCR method was used to identify the positive cloning efficiency of the VHH fragment (i.e., the VHH fragment insertion rate), wherein the primers used in the colony PCR were: MP57: TTATGCTTCCGGCTCGTATG (SEQ ID NO: 5); GIII: CCACAGACAGCCCTCATAG (SEQ ID NO: 6). According to the PCR positive cloning rate, the following formula was used: library capacity = number of clones on the test culture dish × dilution times × PCR identification positive cloning rate × bacterial volume (unit: microliters) to estimate the library capacity of the alpaca phage VHH display library to be 2.76*109CFU, and the insertion accuracy was 98%.

[0061] 2.2) M13K07-assisted phage amplification and titer detection

[0062] Pick the original strain of E. coli TG1, streak inoculate and culture on a 2YT plate, and culture overnight at 37°C and 200rpm. Pick a single colony of E. coli TG1, inoculate it in 5mL 2YT liquid culture medium, and culture it on a shaker at 37°C and 200rpm. Add M13K07 helper phage at a multiplicity of infection of 20:1, let it stand for 30min, add 50μg / ml kana antibiotic and continue to shake and culture for 8h. Heat shock the shaking culture at 65°C for 15min, centrifuge for 3min, and transfer the supernatant to a new EP tube, which is the amplified M13K07 helper phage. Dilute the M13K07 helper phage in a 1:100 gradient with sterile PBS. The TG1 bacterial solution in the logarithmic growth phase was divided into 200μL / tube, and 100μL of a diluted concentration of M13K07 helper phage was added to each tube, and it was allowed to stand for 15min at 37°C. Melt the top agarose gel in a microwave oven and dispense it into test tubes, 3 mL per tube, and maintain at 45°C for later use. Use one culture tube for each dilution of the phage. Add the mixture of M13K07 helper phage and TG1 cells of various concentrations to the test tubes containing the top agarose gel, shake quickly to mix, and immediately pour the mixture in each tube into the preheated 2YT plate, gently swirl the plate to ensure that the top gel is evenly distributed. The operation should be quick so that the top gel is evenly distributed throughout the agar plate before it solidifies. Cover the plate and place it at room temperature for 5 minutes to allow the agar to solidify. Flip it over and place it at 37°C for static culture. After 8 to 12 hours, the number of plaques is about 10 2 Count the plaques on the plate. Calculate the titer: number of plaques × dilution factor = titer of 100 μL M13K07 helper phage stock solution.

[0063] 2.3) Amplification of VHH library phage

[0064] The TG1 cells transformed with the VHH library phage (obtained in step 2.1) were inoculated into 10 ml of 2xYT-Amp-GLU medium and cultured at 37°C, 200 rpm for 3 h until they were in the early logarithmic phase and the abundance reached 8×10 8 cells / mL, add M13K07 helper phage at a multiplicity of infection of 20-30. Infect at 37°C for 30 minutes. Centrifuge TG1 cells at room temperature and centrifuge at 2800×g for 10 minutes. Resuspend the TG1 cell pellet in 50ml 2xYT-Amp medium, add 100μg / ml Amp antibiotic and 50μg / ml kana antibiotic, and culture at 37°C, 200rpm with shaking for 8h. Transfer the overnight culture to a 50mL centrifuge tube and centrifuge at 4°C, 3200×g for 15min. Transfer the supernatant to another centrifuge tube and centrifuge again at 4°C, 3200×g for 15min. Take 80% of the supernatant at the top of the centrifuge tube, transfer it to a new centrifuge tube, add 1 / 5 volume of PEG6000 / 2.5mol / L NaCl, and precipitate at 4°C overnight. Centrifuge at 4°C, 3200×g for 15min, discard the supernatant, centrifuge again for 30s, remove the residual liquid, and the phage precipitate should be the size of a finger on the side of the tube. Resuspend the precipitate with 1mL PBS and transfer it to a microcentrifuge tube, centrifuge at 4°C, 20,000×g for 1min. Transfer the supernatant to a new centrifuge tube, precipitate the phage again with 1 / 5 volume of PEG6000 / 2.5mol / L NaCl, and ice bath for 60min. Centrifuge at 4°C, 20,000×g for 15min, discard the supernatant, centrifuge again for 30s, and remove the residual liquid. Resuspend the precipitate in 500μL PBS, centrifuge for 1min, and transfer the supernatant to a new EP tube, which is the amplified VHH phage library. Titer it, it can be stored at 4°C for 4 weeks. For long-term storage, add an equal volume of sterile glycerol and store at -80°C.

[0065] 2.4) Enrichment and screening of S-RBD protein-specific nanoantibody phage

[0066] 2.4.1) Use the SARS-CoV-2 virus strain S-RBD protein (Cat. No.: 40592-V08H) to select specific binding nanoantibodies. Dilute the S-RBD protein with coating buffer to a final concentration of 10 μg / mL and add it to a 96-well plate, 150 μL per well, and set up two replicate wells. Place the 96-well plate in a wet box and incubate overnight at 4°C. Discard the coating solution in the 96-well plate, face the reaction well down, tap vigorously on a clean filter paper to remove the residual liquid, and wash quickly 3 times with 0.1% TBST (TBS+0.1% Tween 20). Add 300 μL of blocking solution to each well and block at 4°C for at least 2 hours. Discard the liquid and wash quickly 6 times with TBST. Replace the filter paper and shake off the residual night each time you wash, 300 μL per well, as fast as possible to prevent the plate from drying out. Take 10 μL of phage library stock solution (about 1×10 11 pfu phage), add 100μL TBST to mix, and add to the reaction wells bound to the S-RBD protein, 100μL / well, and shake gently at room temperature for 30min. Wash quickly 12 times with TBST, and add 100μL of acidic eluent to each well for non-specific elution, and shake gently at room temperature for no more than 10min. Collect the eluate in a 1.5mL EP tube, and add neutralizing solution at a ratio of 10μL per 100μL of washing solution. Take 1μL of eluate for phage titer determination, and the rest is amplified and precipitated for the next round of enrichment screening. After 4 rounds of "adsorption-elution-amplification", a phage library enriched with antigen-positive antibodies is screened. The above screening process only changes the phage library to the phage suspension after the previous round of screening and amplification. The amount added is calculated according to the titer, that is, the amount added each time is as close to 10 as possible. 11 pfu or more. Generally, the first round of titer is 10 13-14 If the titer of the phage after amplification is low, the amount of phage added during panning should not be less than 10 9 In addition, the washing solution TBST was changed to 0.3% Tween 20 in the second round and 0.5% Tween 20 in the third round. The phages specifically enriched in the last round were directly used for plating and picking clones.

[0067] 2.4.2) Add 150mL of fresh 2xYT medium to a clean Erlenmeyer flask, then add 150μL of overnight cultured TG1 bacterial solution and mix well. Divide the above mixed solution into test tubes, 1mL per tube. Open the last round of phage clone screening plate (to minimize cross contamination, the plate is required to be stored at 4℃ for less than 3 days, the number of plaques on the plate used for plaque picking should not exceed 100, and the plaques that are well separated from the closest neighbors must be selected to ensure that each plaque contains a DNA sequence), pick up a single plaque of appropriate size with a pipette tip, and carefully put it into a test tube, one tube for each clone to be identified, and pick 100 clones. Shake the bacteria at 37℃, 200rpm for 4.5h. Transfer the bacterial solution to a new 1.5mL EP tube and centrifuge at 4℃, 20,000×g / min for 15min. Transfer the supernatant to a new tube and centrifuge for 30s. Pipette 80% of the supernatant into a new tube, which is the amplified phage stock solution for monoclonal phage identification.

[0068] 2.5) S-RBD protein binds to monoclonal phage (ELISA principle)

[0069] Dissolve S-RBD protein in coating solution at a concentration of 1 μg / mL, add 100 μL to each well of a 96-well microplate, and coat overnight at 4°C. Wash twice with 0.1% TBST. Add 300 μL of TBST blocking solution containing 5% skim milk powder, and use the uncoated S-RBD protein plate as a control. The blocking conditions are all incubated at 37°C for 2 hours. Wash 6 times with TBST, add the diluted phage to the plate coated with the target molecule, 100 μL per well, and add 100 μL to the uncoated well as a control, and incubate at 37°C for 2 hours. Wash 6 times with TBST. Add 100 μL of HRP-labeled anti-M13 monoclonal antibody (Cat. No.: 11973-MM05T-H) to each well, dilute 1:8000 with TBST, and incubate at 37°C for 1 hour. Wash 6 times with TBST. Add substrate colorimetric solution (TMB) for 20 min (100 μL / well), then add 2 mol / L H 2 SO 4 Stop the reaction (100 μL / well). Use a microplate reader to measure the absorbance value, the absorption wavelength is 450nm, and the correction wavelength is 630nm. The reading value is at least 5 times greater than the negative control and the OD value is greater than 1. It is considered a positive clone and sent to a sequencing company for sequencing to obtain the nucleotide sequence. In this embodiment, 7 different positive clones were screened out from 100 clones, numbered as 5, 6, 9, 15, 19, 21 and 34, and the nanoantibodies obtained from these positive clones were named as NB5, NB6, NB9, NB15, NB19, NB21 and NB34. Each positive monoclonal strain was PCR amplified and sequenced to obtain the specific nanoantibody expression sequence from each positive clone.

[0070] Example 3: Expression, purification and binding property detection of nanobody and Fc fusion protein

[0071] Most of the antibodies currently used in immunotherapy are of the IgG isotype, which work through the direct effect of the variable region binding to the target antigen and the indirect effect of the constant region interacting with the complement or effector cell Fc receptor. Therefore, in this embodiment, the present invention uses the nano antibodies derived from the 7 positive clones screened in Example 2 above to construct fusion proteins of nano antibodies and IgG1-Fc, and detects the binding properties of these fusion proteins with SARS-CoV-2S protein, specifically including the following operations.

[0072] 3.1) The expression sequences of nanoantibodies NB5, NB6, NB9, NB15, NB19, NB21 and NB34 obtained in Example 2 were cloned into the eukaryotic expression vector pFUSE-hIgG1-Fc2, thereby constructing a eukaryotic expression plasmid that can express a fusion protein of nanoantibody fused to IgG1-Fc (whose amino acid sequence is shown in SEQ ID NO: 7). The structure of the fusion protein is: nanoantibody-linker-nanoantibody-linker-nanoantibody-IgG1-Fc, and the fusion proteins obtained from nanoantibodies NB5, NB6, NB9, NB15, NB19, NB21 and NB34 were named: NB5G, NB6G, NB9G, NB15G, NB19G, NB21G and NB34G, respectively.

[0073] 3.2) Expression and purification of recombinant antibodies: HEK293T cells were digested, centrifuged, cells were collected, resuspended and counted, and 5×10 6 293T cells were transferred to T75 cell culture flasks and placed at 37°C in 5% CO 2 Culture in the incubator overnight, and the cells can be used for transfection when the confluence reaches 70%-80%. Replace the cell culture medium with serum-free medium 2h before transfection. Prepare the transfection plasmid and set up groups: HEK293T cell blank control group (transfected with blank vector pFUSE-hIgG1-Fc2) and plasmid transfection group (transfected with expression plasmid carrying the expression fusion protein gene). Specifically, use 750μl Opti-MEM (Gibco) to dilute each component plasmid and lipofectamine 2000 transfection reagent, pipette to mix, and let stand at room temperature for 5min. Mix the transfection reagent and plasmid DNA dilution, let stand at room temperature for 20min, and then add the transfection complex to the T75 culture flask. Place the culture flask at 37°C, 5% CO 2 Culture in an incubator for 6 hours, then replace with 293T serum-free CD medium and continue culturing. Aseptically collect the cell culture supernatant at 48 to 72 hours and use Advantage 25 purifier was used to purify the fusion protein of IgG1-Fc using protein A Trap Column. The equilibrium buffer was a PBS solution with pH 7.2, and the elution buffer was a glycine solution with pH 3. The loading and elution flow rates were set to 0.5 mL / min and 1 mL / min, respectively. The purified antibodies were collected to obtain fusion proteins NB5G, NB6G, NB9G, NB15G, NB19G, NB21G, and NB34G, respectively.

[0074] 3.3) The binding specificity of these fusion proteins to the S protein (RBD and ECD) of the currently popular SARS-CoV-2 major virus strains (Omicron strain and Delta strain) was detected by ELISA method, which specifically included the following operations: SARS-CoV-2B.1.1.529 (Omicron strain) virus strain S-ECD trimer protein (Cat. No.: 40589-V08H26), S-RBD protein (Cat. No.: 40592-V08H121) and SARS-CoV-2B.1.617.2 (Delta strain) virus strain S-ECD trimer protein (Cat. No.: 40589-V49B4), S-RBD protein (Cat. No.: 40592-V08H113) were diluted to a concentration of 1 μg / ml with coating buffer, added to a 96-well microplate, 100 μL / well, and coated overnight at 4°C. Wash twice with 0.1% TBST, add 300 μL of TBST blocking solution containing 3% BSA, and incubate at 37°C for 2 hours. Add the above-numbered fusion protein, set up 2 wells for each dilution, and incubate at 37°C for 2 hours. Dilute HRP-labeled anti-human IgG antibody 1:8000, 100 μL / well, and incubate at 37°C for 1 hour. Add 100 μL / well TMB colorimetric solution, incubate at 37°C for 5 minutes, and add 100 μL / well 2 mol / L H 2 SO 4 The color development reaction was terminated with the stop solution, and the absorbance was measured using an enzyme reader with an absorption wavelength of 450 nm and a correction wavelength of 630 nm.

[0075] The results are as follows Figure 2As shown in the middle A, where NC represents the negative control, it can be seen that among the seven fusion proteins, NB5G, NB6G, NB9G, NB21G and NB34G can bind to one or more of the S-ECD and S-RBD proteins of the Omicron virus strain (B.1.1.529) and the delta virus strain (B.1.617.2), but cannot bind to the above four SARS-CoV-2 S proteins at the same time. Compared with the above five fusion proteins, NB15G and NB19G can bind to the S-ECD and S-RBD proteins of the Omicron virus strain (B.1.1.529) and the delta virus strain (B.1.617.2) at the same time, and both have strong binding effects, showing the characteristics of broad-spectrum resistance to the S proteins of multiple SARS-CoV-2 virus strains.

[0076] In this embodiment, according to the above steps 3.1) and 3.2), a fusion protein of nanoantibody NB15 and NB19 in series (connected by a linker) and fused to IgG1-Fc was constructed (the structure of the fusion protein is: NB15-linker-NB19-IgG1-Fc), named NB15-19G, and the recognition and binding effect of fusion proteins NB15G, NB19G and NB15-19G on the surface of S-ECD and S-RBD proteins of different Omicron subvirus strains (SARS-CoV-2B.1.1.529 and SARS-CoV-2BA.4.6 / BF.7 (also referred to as BF.7)) was detected according to the method of the above step 3.3). The results are as follows Figure 2 As shown in panel B, NB15G, NB19G and NB15-19G can also bind to the S-ECD and S-RBD proteins of the Omicron subvirus strain, and all have strong binding effects.

[0077] In summary, the results show that nanobodies NB15, NB19 and NB15-19 (bispecific nanobodies obtained by connecting nanobodies NB15 and NB19 in series through a linker) are potential broad-spectrum neutralizing antibodies against SARS-CoV-2 variants. The fusion proteins of these nanobodies and IgG1-Fc show strong recognition and binding properties to the surface S protein of various variants of SARS-CoV-2. Figure 3As shown, schematic diagrams of the simulated structures of nano antibodies NB15 (A) and NB19 (B) are shown, and it can be seen that both are sequences containing only one heavy chain variable region (including three complementary determining regions CDR1, CDR2 and CDR3). After sequencing, the amino acid sequence of nano antibody NB15 is shown in SEQ ID NO: 8, wherein in the heavy chain variable region sequence shown in SEQ ID NO: 8, the amino acid sequences of its three complementary determining regions CDR1, CDR2 and CDR3 are shown in SEQ ID NO: 9-SEQ ID NO: 11, respectively. The amino acid sequence of nano antibody NB19 is shown in SEQ ID NO: 12, wherein in the heavy chain variable region sequence shown in SEQ ID NO: 12, the amino acid sequences of its three complementary determining regions CDR1, CDR2 and CDR3 are shown in SEQ ID NO: 13-SEQ ID NO: 15, respectively. The amino acid sequence of the linker used in the fusion protein can be as shown in SEQ ID NO:16, so the amino acid sequence of the bispecific nanoantibody NB15-19 can be as shown in SEQ ID NO:17, the amino acid sequence of the fusion protein NB15G can be as shown in SEQ ID NO:18, the amino acid sequence of the fusion protein NB19G can be as shown in SEQ ID NO:19, and the amino acid sequence of the fusion protein NB15-19G can be as shown in SEQ ID NO:20.

[0078] In another embodiment, the inventors also constructed, expressed and purified the following fusion proteins according to the above steps 3.1) and 3.2): NB15-IgG1-Fc (whose amino acid sequence is shown in SEQ ID NO:21), NB15-linker-NB15-IgG1-Fc (whose amino acid sequence is shown in SEQ ID NO:22), NB19-IgG1-Fc (whose amino acid sequence is shown in SEQ ID NO:23), NB19-linker-NB19-IgG1-Fc (whose amino acid sequence is shown in SEQ ID NO:24), NB19-linker-NB15-IgG1-Fc (whose amino acid sequence is shown in SEQ ID NO:25), and detected the binding properties of the above fusion proteins with the S-ECD and S-RBD proteins of the Omicron virus strain (B.1.1.529) and the delta virus strain (B.1.617.2) according to the above step 3.3). The results showed that all of the above fusion proteins can bind to the above four S proteins at the same time, exhibiting a broad-spectrum anti-SARS-CoV-2 effect.

[0079] Example 4: Binding kinetics detection of nanobodies and SARS-CoV-2 S protein

[0080] This example aims to verify the potential neutralizing activity of the fusion protein of nanoantibodies and Fc (taking NB15G and NB19G prepared in Example 3 as examples), that is, the binding kinetics of the fusion protein with SARS-CoV-2S protein (taking SARS-CoV-2B.1.1.529 (Omicron) virus strain S-RBD protein (Cat. No.: 40592-V08H121) as an example), specifically based on bio-layer interferometry technology (Bio-Layer Interferometry), using the built-in HIS sensor of Fortebio Octet, respectively detecting the affinity of NB15G and NB19G with the S-RBD protein of SARS-CoV-2B.1.1.529 (Omicron) virus strain. Specifically, the loading diluent is a PBST solution containing 0.02% Tween-20 and 0.1% BSA, and the equilibration / solidification buffer is consistent with the loading buffer. Prepare gradient dilutions (1.00E-07, 5.00E-08, 2.50E-08, 1.25E-08, 6.23E-09) of NB15G and NB19G, set 0 antibody concentration as background; program settings include three steps of solidification, binding, and dissociation, with time of 1min, 3min, and 3min respectively. Affinity judgment is based on the following: KD>10 -8 M has weak binding ability; 10 -9 M <KD<10 -8 M has strong binding ability; 10 - 11 M <KD<10 -9 M is strong in binding ability; KD<10 -11 M has strong combining ability.

[0081] The results are as follows Figure 4 As shown in the figure, A represents the binding and dissociation curves of different concentration gradient fusion protein NB15G and S-RBD protein, and B represents the binding and dissociation curves of different concentration gradient fusion protein NB19G and S-RBD protein. It can be seen that both belong to the slow binding and slow dissociation modes, and the affinity constants KD (M) are 7.802×10 -11 mol / L and 1.99×10 -9 mol / L, belonging to strong binding antibody.

[0082] Example 5: Expression and purification of fusion protein of nanobody and IgA1-Fc

[0083] Immunoglobulin A (IgA) is the most abundant antibody isotype on the mucosal surface and ranks second in content in human serum. It can participate in the body's mucosal immunity, pass through the mucosal cell layer through co-transport receptor mediation, enrich in the virus-infected area to eliminate the virus, and cross-linking of IgA with its Fc receptor (FcαRI) can initiate biological processes such as antibody-dependent cell-mediated cytotoxicity (ADCC), phagocytosis, antigen presentation, and the release of cytokines and inflammatory mediators. Therefore, in this embodiment, the inventors also constructed, expressed and purified the fusion proteins of Nanobody NB15 and / or NB19 with IgA1-Fc according to the operations of steps 3.1) and 3.2) in Example 3. The structures of these fusion proteins are as follows: NB15—linker—NB15—linker—NB15—IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO: 26), NB15—linker—NB15—IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO: 27), NB15—IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO: 28), NB19—linker—NB19—linker—NB19—IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO: 29), NB19—linker—NB19—IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO: 30), NB19—IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO: 31), NO:31), NB15-linker-NB19-IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO:32), and NB19-linker-NB15-IgA1-Fc (whose amino acid sequence is shown in SEQ ID NO:33). NO:33), wherein when constructing a eukaryotic expression plasmid, the expression sequence of IgA1-Fc is used to replace the IgG1-Fc expression sequence in the eukaryotic expression vector pFUSE-hIgG1-Fc2, and when the plasmid is transfected, the expression plasmid containing IgA1-Fc and the plasmid containing the J chain are co-transfected to obtain a fusion protein of the above nanobody and a monomer (IgAm) of the IgA subtype (for example, the fusion protein NB15—linker—NB15—linker—NB15—IgAm is named NB15M), or a fusion protein of the above nanobody and a dimer (IgAd) of the IgA subtype (for example, the fusion protein NB15—linker—NB15—linker—NB15—IgAd is named NB15D), and the fusion protein fused with IgA1-Fc is purified using a Peptide M Trap Column during purification.In addition, the binding properties of the above fusion proteins with the S-ECD and S-RBD proteins of the Omicron virus strain (B.1.1.529) and the delta virus strain (B.1.617.2) were detected according to the operation of step 3.3) in Example 3. The results show that the above fusion proteins can bind to the above four S proteins at the same time, showing a broad-spectrum anti-SARS-CoV-2 effect.

[0084] Example 6: Nanobodies competitively inhibit SARS-CoV-2S-RBD and ACE2 protein

[0085] In order to clarify that the nanobody exerts neutralizing activity by blocking the binding of SARS-CoV-2S protein to ACE2, this example uses a competitive ELISA alternative virus neutralization test to determine the competitive blocking activity of the nanobody NB15 IgG type antibody (fusion protein NB15G), IgAm type antibody (fusion protein NB15M) and IgAd type antibody (fusion protein NB15D) against S-RBD-ACE2. Specifically, the following operations were performed: the diluted HRP-labeled SARS-CoV-2 B.1.1.529 (Omicron) virus strain S-RBD protein was mixed with a 3-fold gradient dilution (the starting maximum concentration was 30 μg / ml, and then 3-fold gradient dilution was performed in sequence) fusion protein (mixed thoroughly and incubated at 37°C for 30 min. The sample was then transferred to a microplate pre-coated with ACE2 protein and incubated at 37°C for 15 min. The reaction plate was washed 3 times with 0.1% TBST. The substrate colorimetric solution (TMB) was added for 10 min (100 μL / well), and 2 mol / L H 2 SO 4 The reaction was terminated (100 μL / well). The absorbance was measured using an ELISA reader with an absorption wavelength of 450 nm and a correction wavelength of 630 nm, and the inhibition rate was calculated and plotted.

[0086] The results are as follows Figure 5 As shown in the figure, it can be seen that both subtypes of nanoantibodies NB15 (i.e. the above three fusion proteins) can block the binding of S-RBD to ACE2 protein, indicating that nanoantibody NB15 exerts a neutralizing effect by blocking the binding of SARS-CoV-2S protein to ACE2. After calculation, the IC values ​​of IgG, IgAm and IgAd antibodies of nanoantibody NB15 are 50 They are 0.3285μg / ml, 0.3074μg / ml and 0.0914μg / ml respectively. It can also be seen that the blocking inhibitory effect of the IgAd type antibody of the nanobody NB15 is relatively better.

[0087] Example 7: Micro-neutralization of SARS-CoV-2 pseudovirus by nanoantibodies

[0088] SARS-CoV-2 pseudovirus is a replication-deficient lentiviral system that can replicate and infect susceptible cells in a single round to simulate the infection of the new coronavirus. This embodiment uses a pseudovirus system (SARS-CoV-2B.1.1.529 (Omicron)-LUC variant pseudovirus, purchased from Zhongji Dangkang (Beijing) Gene Technology Co., Ltd. (Cat. No.: PSC-L-07)) to detect the neutralizing activity of two subtypes of nanoantibodies NB15 (i.e., fusion proteins NB15G, NB15D, and NB15M). Specifically include the following operations.

[0089] (1) 293T-ACE2 + Cells were seeded in 96-well plates at 2 × 10 4 cells, 37°C, 5% CO 2 Culture overnight for 16-24h to allow it to adhere;

[0090] (2) Pseudovirus with luciferase tag (>10 6 1000 copies / mL) were mixed with 3-fold dose gradient dilution (the starting maximum concentration was 30 μg / ml, followed by 3-fold gradient dilution) of nanoantibody NB15 (including IgG antibody (NB15G), IgAm antibody (NB15M) and IgAd antibody (NB15D)) and incubated at 37°C for 1 h;

[0091] (3) Adding the mixed incubated pseudovirus-nanoantibody mixture to the cell culture system of step (1) to infect 293T-ACE2 + The cells were infected at 37°C for 1 hour and then replaced with normal culture medium for 48 hours. After the culture, the cells were washed once with PBS, and the chemiluminescence was detected using a luciferase detection kit (Promega, Cat. No. E1500), and the neutralization rate of the pseudovirus in different groups was calculated accordingly.

[0092] The results are as follows Figure 6 As shown, NB15M, NB15D and NB15G represent the neutralization rate of SARS-CoV-2 pseudovirus after mixed incubation of IgAm, IgAd and IgG antibodies of nanoantibody NB15 with SARS-CoV-2 pseudovirus. It is obvious that at different dose concentrations, IgG, IgAm and IgAd antibodies of nanoantibody NB15 all show strong neutralization ability against pseudovirus. After pre-binding and neutralizing SARS-CoV-2 pseudovirus by nanoantibody NB15, susceptible cells can be protected from SARS-CoV-2 pseudovirus infection. The IC values ​​of IgAm, IgAd and IgG antibodies of nanoantibody NB15 are 50They are 0.035μg / ml, 0.032μg / ml and 0.23μg / ml respectively, which have a strong neutralizing effect. From this result, it can be seen that compared with the IgG antibody of nanoantibody NB15, the IgAm and IgAd antibodies of nanoantibody NB15 have stronger neutralizing effects on SARS-CoV-2 pseudovirus.

[0093] Example 8: Neutralization of SARS-CoV-2 virus strains by bispecific nanoantibody NB15-19

[0094] This embodiment also detects the neutralizing effect of the bispecific nanobody NB15-19 (using the fusion proteins NB15-linker-NB19-IgA1-Fc (named NB15-19-IgA) and NB15-linker-NB19-IgG1-Fc (named NB15-19-IgG)) on the isolated and cultured SARS-CoV-2BA.2.12.10 (Omicron) virus strain (the experiment was commissioned by the Institute of Medical Laboratory Animals, Chinese Academy of Medical Sciences). The results show that the IC values ​​of NB15-19-IgA and NB15-19-IgG against the SARS-CoV-2BA.2.12.10 (Omicron) virus strain are 50 The concentrations of NB15-19-IgA and NB15-19-IgG were 0.28 μg / ml and 1.56 μg / ml respectively, which had a strong neutralizing effect. It can also be seen that compared with NB15-19-IgG, NB15-19-IgA had a stronger neutralizing effect on the SARS-CoV-2 BA.2.12.10 (Omicron) virus strain.

[0095] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nanobody with a broad spectrum of resistance to the new coronavirus SARS-CoV-2 S protein, characterized in that: The Nanobody comprises a CDR1 with an amino acid sequence as shown in SEQ ID NO: 9, a CDR1 with an amino acid sequence as shown in SEQ ID NO: 10, and a CDR3 with an amino acid sequence as shown in SEQ ID NO: 11; or The Nanobody comprises a CDR1 with an amino acid sequence as shown in SEQ ID NO:13, a CDR2 with an amino acid sequence as shown in SEQ ID NO:14, and a CDR3 with an amino acid sequence as shown in SEQ ID NO:

15.

2. The Nanobody according to claim 1, characterized in that The Nanobody comprises or consists of the amino acid sequence shown in SEQ ID NO: 8, or comprises or consists of the amino acid sequence shown in SEQ ID NO: 12, or comprises both the amino acid sequences shown in SEQ ID NO: 8 and SEQ ID NO: 12; Optionally, the Nanobody comprises the amino acid sequence shown in SEQ ID NO: 17, or consists of it.

3. A fusion protein, characterized in that The fusion protein is formed by fusion of the nanobody according to claim 1 or 2 with IgG1-Fc or IgA1-Fc; Optionally, the amino acid sequence of the fusion protein is represented by the following general formula (I): NB1—linker1—NB2—linke2—NB3—Fc(I) In formula (I): NB1, NB2 and NB3 are identical or different, and independently represent the amino acid sequence of the Nanobody of any one of claims 1 to 3; Linker1 and linker2 are the same or different and are independently represented as linker sequences. Optionally, the amino acid sequences of linker1 and linker2 are both as shown in SEQ ID NO: 18; Fc is selected from IgG1-Fc and IgA1-Fc; and wherein NB1 and linker1 exist or do not exist at the same time, and NB2 and linke2 exist or do not exist at the same time; Further optionally, the fusion protein comprises the amino acid sequence shown in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 or SEQ ID NO:33, or consists of it.

4. A nucleic acid encoding the Nanobody according to claim 1 or 2, or encoding the fusion protein according to claim 3. An expression vector comprising the nucleic acid according to claim 4.

6. A host cell comprising the expression vector of claim 5, or comprising the nucleic acid of claim 4, or comprising the Nanobody of claim 1 or 2, or comprising the fusion protein of claim 3, or expressing the Nanobody of claim 1 or 2, or expressing the fusion protein of claim 3.

7. Use of the nanobody according to claim 1 or 2, and / or the fusion protein according to claim 3, and / or the nucleic acid according to claim 4, and / or the expression vector according to claim 5, and / or the host cell according to claim 6 in the preparation of an anti-SARS-CoV-2 drug, or an agent that blocks the binding of SARS-CoV-2S protein to ACE2 protein.

8. The use according to claim 7, wherein the SARS-CoV-2 includes wild strains and mutant strains thereof, and optionally, the mutant strains include Alpha, Beta, Gamma, Delta, and Omicron mutant strains.

9. An anti-SARS-CoV-2 drug comprising the nanobody of claim 1 or 2, and / or the fusion protein of claim 3, and / or the nucleic acid of claim 4, and / or the expression vector of claim 5, and / or the host cell of claim 6.

10. An agent for blocking the binding of SARS-CoV-2S protein to ACE2 protein, comprising the nanoantibody according to claim 1 or 2, and / or the fusion protein according to claim 3, and / or the nucleic acid according to claim 4, and / or the expression vector according to claim 5, and / or the host cell according to claim 6.

Images