Recombinant DNA polymerase and application thereof in cell-free protein synthesis

Abstract

The invention relates to a recombinant DNA polymerase. A secretory protein signal peptide is introduced into a DNA polymerase structure. Through gene directed modification and activity determination, it is verified for the first time that the protein synthesis capacity of an in-vitro cell-free protein synthesis system can be improved through the recombinant DNA polymerase.

Description

Technical Field

[0001] The present application belongs to the field of biotechnology, and in particular relates to the recombinant DNA polymerase and its application in cell-free protein synthesis. Background Art

[0002] Cell-free protein synthesis (CFPS) is a technology that uses enzymes, amino acid substrates and energy to synthesize proteins in vitro using exogenous mRNA or DNA as templates. Compared with traditional in vivo recombinant expression systems, in vitro cell-free synthesis systems have many advantages, such as the ability to directly use PCR products as templates to simultaneously synthesize multiple proteins in parallel, and to carry out high-throughput peptide or protein drug screening. In addition, in vitro cell-free synthesis systems also have unique advantages in the expression of peptides or proteins that are toxic to cells. Cell-free protein expression systems are an important supplement to cell-based protein expression systems.

[0003] The existing cell-free protein synthesis systems can be mainly divided into two categories: one is to combine and compound the ribosomes, enzymes, tRNA, etc. required for the synthesis of purified proteins in a certain proportion to obtain the ability to express proteins in vitro, that is, the purified cell-free protein expression system (PURE). This system has clear component information and can easily and customizedly adjust the formula to obtain different protein expression characteristics, but the disadvantage is that the preparation process is complicated and costly; the other is to obtain the main active substances from the extracts of living cells with protein expression activity, and appropriately add the required enzymes, substrates, energy substances and other components to obtain the ability to express proteins in vitro, that is, the cell-free protein expression system based on cell extracts. Compared with the PURE system, the latter has the advantages of simple operation process, short cycle and low cost, but the latter also has the disadvantages of complex components and many uncontrollable factors in the system, so it has higher requirements for the characteristics of the source cells of the cell extract. Our company has been committed to the construction of cell-free protein expression platform technology based on cell extracts for many years, but there is still huge room for optimization of the supporting technical process and background strains of the system. Summary of the invention

[0004] The technical problem to be solved by the present invention is: to solve the shortcomings of the cell-free protein expression performance in the prior art, thereby providing a recombinant DNA polymerase, which can significantly improve the expression level of the cell-free protein.

[0005] The first aspect of the present invention provides a recombinant DNA polymerase, characterized in that a secretory protein signal peptide is introduced into the DNA polymerase structure.

[0006] Further preferably, a tag protein is also introduced into the DNA polymerase structure.

[0007] Further preferably, a secretory protein signal peptide and / or a tag protein is introduced between the core regions of the recombinant DNA polymerase.

[0008] Further preferably, the secretory protein signal peptide is at the N-terminus of the core region.

[0009] Further preferably, the tag protein is at the C-terminus of the core region.

[0010] Further preferably, the signal peptide of the secretory protein is preferably the MFA1 signal peptide.

[0011] Further preferably, a strong promoter is introduced into the ORF region encoding the recombinant DNA polymerase.

[0012] Further preferably, a terminator is introduced into the ORF region encoding the recombinant DNA polymerase.

[0013] Further preferably, the strong promoter is selected from: one or more of TEF1, T7 promoter, T3 promoter, SP6 promoter, CMV, EF1A, CAG, CBh or SFFV.

[0014] Further preferably, the terminator is selected from: Tsynth27 terminator; the sequence of the Tsynth27 terminator is SEQ ID NO:6.

[0015] Further preferably, the terminator is a nucleotide having ≥85% homology (preferably, ≥90% homology; preferably ≥95% homology; most preferably, ≥97% homology, such as 98% or more, 99% or more) with the nucleotide sequence shown in SEQ ID NO:6 and having the same activity as the SEQ ID NO:6 sequence.

[0016] Further preferably, the DNA polymerase is selected from phi29 DNA polymerase.

[0017] Further preferably, the core region comprises the sequence shown in SEQ ID NO:3 or an active fragment thereof, or a polypeptide having ≥85% homology (preferably, ≥90% homology; preferably ≥95% homology; most preferably, ≥97% homology, such as above 98%, above 99%) with the amino acid sequence shown in SEQ ID NO:3 and having the same activity as the sequence of SEQ ID NO:3.

[0018] Further preferably, the tag protein is selected from any one of the following tags or variants thereof: CBP tag, histidine tag, CMyc tag, FLAG tag, Spot tag, C tag, Avi tag, Streg tag, MBP tag and a combination thereof.

[0019] Further preferably, the number of amino acids in the tag protein is n, wherein 2≤n≤20, preferably 2≤n≤10.

[0020] Further preferably, n is selected from any value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, or a combination of any values; particularly preferably, n=8.

[0021] More preferably, the tag protein is a histidine tag.

[0022] More preferably, the ORF of the recombinant DNA polymerase is transcribed into mRNA under the control of a high expression promoter and an artificial terminator.

[0023] The second aspect of the present invention provides a polynucleotide, which is used to encode the recombinant DNA polymerase provided by the first aspect of the present invention.

[0024] The third aspect of the present invention provides a vector, wherein the vector contains the polynucleotide provided by the second aspect of the present invention.

[0025] Further preferably, the vector is selected from bacterial plasmid, bacteriophage, yeast plasmid, animal cell vector, and shuttle vector.

[0026] The fourth aspect of the present invention provides a genetically engineered cell, wherein the genetically engineered cell contains the vector provided by the third aspect of the present invention or the polynucleotide provided by the second aspect of the present invention is integrated into its genome.

[0027] Further preferably, the genetically engineered cells are selected from prokaryotic cells and eukaryotic cells; preferably eukaryotic cells.

[0028] Further preferably, the eukaryotic cell is selected from mammalian cells, plant cells, yeast cells, insect cells or any combination thereof.

[0029] Further preferably, the eukaryotic cell is selected from the group consisting of: Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia akoclamae, Pichia membranaefaciens, Pichia minuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia alictaria, Pichia g uercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia asp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugar cane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

[0030] Further preferably, the Kluyveromyces further includes: Kluyveromyces lactis (Kluyveromyces, K.lactis), Kluyveromyces marxianus, Kluyveromyces marxianusvar.lactis, Kluyveromyces marxianus var.marxianus, Kluyveromyces marxianusvar.vanudenii, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus polysporus), Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof.

[0031] The fifth aspect of the present invention provides a cell extract, which is obtained from the genetically engineered cell provided by the fourth aspect of the present invention, and the cell extract contains the recombinant DNA polymerase provided by the first aspect of the present invention.

[0032] The sixth aspect of the present invention provides a cell-free protein synthesis system, which comprises at least the cell extract provided by the fifth aspect of the present invention.

[0033] The seventh aspect of the present invention provides a use of the DNA polymerase provided by the first aspect of the present invention, the genetically engineered cell provided by the fourth aspect of the present invention, or the cell extract provided by the fifth aspect of the present invention in synthesizing foreign proteins.

[0034] An eighth aspect of the present invention provides a method for synthesizing exogenous protein, comprising:

[0035] Step 1, providing the cell-free protein synthesis system according to the sixth aspect of the present invention;

[0036] Step 2, adding a DNA molecule encoding an exogenous protein to the synthesis system of step 1, incubating the reaction for a period of time under certain temperature conditions to synthesize the exogenous protein.

[0037] Further preferably, the synthesis time is less than or equal to 12 h; even more preferably, the synthesis time is less than or equal to 11 h, 10 h, 9 h, 8 h, 7 h, 6 h, 5 h, 4 h, 3 h, 2 h or 1 h; particularly preferably, the synthesis time is less than or equal to 3 h.

[0038] The ninth aspect of the present invention provides a kit, characterized in that the kit comprises a container and the cell-free protein synthesis system provided in the sixth aspect.

[0039] The beneficial effects of the present invention are:

[0040] (1) The present invention verifies for the first time that the protein synthesis capacity of an in vitro cell-free protein synthesis system can be improved by recombinant phi29 DNA polymerase through gene-directed modification and activity assay, especially the protein synthesis capacity in the early stage, thereby reducing the amount of exogenous polymer added in the early stage, thereby reducing the cost of in vitro synthesis;

[0041] (2) The present invention uses CRISPR-Cas9 gene editing technology to reorganize phi29 DNA polymerase for secretory expression to change the in vitro protein synthesis capacity;

[0042] (3) The effect of recombinant phi29 DNA polymerase on protein expression was verified through an in vitro cell-free protein synthesis system, and relying on the advantages of low cost and experimental convenience of the cell-free protein system, an experimental research platform was provided for gene-directed modification.

[0043] (4) The formed in vitro cell-free protein synthesis system can further achieve the purpose of reducing costs and simplifying operation.

[0044] The technical solution of the present application is further described below in conjunction with the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 To design the scheme for Ampase recombination, the present invention selected the core region of the enzyme (aa13-575), and fused and expressed the ScMFA1 signal peptide and 8×His tag at the N-terminus and C-terminus of its protein sequence, respectively. To obtain the high-efficiency expression characteristics of the enzyme, all protein coding sequences were customized codon optimized, and the ORF of the enzyme was selected to be transcribed under the control of a highly expressed yeast promoter (ScTEF1) and an artificial synthetic terminator (Tsynth27) for mRNA.

[0046] Figure 2The figure shows the effect of different recombinant Ampase on the activity of in vitro protein synthesis. Ampi represents intracellular expression of Ampase; Ampi-8×His represents intracellular expression of Ampase with 8×His tag at the C-terminus; ScMFA1sp-Ampi represents secretory expression of Ampase; ScMFA1sp-Ampi-8×His represents secretory expression of Ampase with 8×His tag at the C-terminus; K.lactis represents the control strain. DETAILED DESCRIPTION

[0047] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application may be combined with each other.

[0048] The present invention is further described below in conjunction with specific embodiments and examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably followed or referred to the conditions indicated in the specific embodiments described above, and then can be followed according to conventional conditions or according to the conditions recommended by the manufacturer.

[0049] Unless otherwise specified, the percentages and parts mentioned in the present invention are percentages and parts by weight.

[0050] Unless otherwise specified, the materials and reagents used in the examples of the present invention are all commercially available products.

[0051] Unless otherwise specified, the temperature units in this application are all degrees Celsius (°C).

[0052] Nouns and terms

[0053] The following is an explanation or description of the meaning of some relevant "nouns" and "terms" used in the present invention, so as to better understand the present invention. The corresponding explanation or description applies to the full text of the present invention, both below and above. When the present invention involves references, the definitions of relevant terms, nouns, and phrases in the references are also quoted, but when they conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When the definitions in the references conflict with the definitions in the present invention, it does not affect the cited components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc., which shall be subject to the contents determined in the references.

[0054] In the present invention, preferred embodiments such as “preferred”, “better”, “more preferred”, “better”, “most preferred” and “further preferred” do not constitute any limitation on the scope of coverage and protection scope of the invention, and are not used to limit the scope and embodiments of the present invention, but are only used to provide some embodiments as examples.

[0055] In the description of the present invention, preferred modes such as "one of the preferred embodiments", "one of the preferred modes", "one of the preferred embodiments", "one of the preferred examples", "preferred examples", "in a preferred embodiment", "some preferred examples", "some preferred modes", "preferably", "preferably", "preferably", "more preferably", "more preferably", "further preferably", "most preferably", and illustrative enumeration modes such as "one of the embodiments", "one of the modes", "example", "specific example", "for example", "as an example", "for example", "such as", "such as", etc., do not constitute any limitation on the scope of coverage and protection scope of the invention, and the specific features described in each mode are included in at least one specific embodiment of the present invention. In the present invention, the specific features described in each mode may be combined in a suitable manner in any one or more specific embodiments. In the present invention, the technical features or technical solutions corresponding to each preferred mode may also be combined in any suitable manner.

[0056] In the present invention, "any combination thereof" means "greater than 1" in terms of quantity, and means a group consisting of the following situations in terms of coverage: "select any one of them, or select a group consisting of at least two of them".

[0057] In the present invention, the descriptions of "one or more", "one or more" and "one or more" have the same meaning as "at least one", "at least one", "a combination thereof", "or a combination thereof", "and combinations thereof", "or any combination thereof", "and any combination thereof", etc. and can be used interchangeably to indicate that the quantity is equal to "1" or "greater than 1".

[0058] In the present invention, "or / and" and "and / or" are used to represent "optionally one of them or optionally a combination of them", and also represent at least one of them.

[0059] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0060] Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0061] The prior art means described in the present invention in such ways as “usually”, “conventional”, “general”, “frequently” and “often” are also cited as references to the contents of the present invention. Unless otherwise specified, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation on the scope of coverage and protection scope of the invention.

[0062] All documents mentioned in the present invention and documents directly or indirectly cited by these documents are cited in this application as references, just as if each document was cited individually as a reference.

[0063] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to the embodiments) can be combined with each other to form a new or preferred technical solution, as long as it can be used to implement the present invention. Due to space limitations, they will not be described one by one.

[0064] In vitro protein synthesis reaction refers to the reaction of synthesizing protein in an in vitro cell-free synthesis system, including at least the translation process. Including but not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription and translation reaction), IVDTT reaction (in vitro replication transcription and translation reaction). In the present invention, IVTT reaction is preferred. IVTT reaction, corresponding to IVTT system, is the process of transcribing and translating DNA into protein (Protein) in vitro. Therefore, we also refer to this type of in vitro protein synthesis system as D2P system, D-to-P system, D_to_P system, DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called D2P method, D-to-P method, D_to_P method, DNA-to-Protein method.

[0065] "Cell-free system" refers to a method of in vitro protein synthesis that is not secretory expression through intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to promote the reaction, but the added cells are not primarily intended to secrete and express exogenous target proteins. In addition, in the intact cell-free D2P system constructed under the guidance of the present invention, a small amount of intact cells are intentionally added (for example, the protein content provided by them is not more than 30wt% compared to the protein content provided by the cell extract). Such a "circumvention" method is also included in the scope of protection of the present invention.

[0066] Target protein: The target expression product of the in vitro protein synthesis system of the present invention is not synthesized by host cell secretion, but is synthesized in vitro based on an exogenous nucleic acid template, and therefore can also be called an exogenous protein. The target protein can be a protein, a fusion protein, a mixture of protein molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after an in vitro protein synthesis reaction based on a nucleic acid template encoding the target protein can be a single substance or a combination of two or more substances. "Objective protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and can be used interchangeably in the present invention.

[0067] D2P, DNA-to-Protein, from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc.

[0068] "The expression system of the present invention", "the in vitro expression system of the present invention", "the in vitro cell-free expression system", and "the in vitro cell-free expression system" are used interchangeably, all referring to the in vitro protein expression system of the present invention, and other descriptions may also be used, such as: protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system) and other descriptions. According to the reaction mechanism, it may include an in vitro translation system (which may be abbreviated as an IVT system, a mR2P system), an in vitro transcription translation system (which may be abbreviated as an IVTT system, a D2P system), an in vitro replication transcription translation system (which may be abbreviated as an IVDTT system, a D2P system), and the like. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as a "protein synthesis factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). The in vitro protein synthesis system provided by the present invention adopts an open description method for its components. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as a nucleic acid template for protein synthesis, and achieves in vitro synthesis of the target protein by artificially controlling the addition of substrates and transcription, translation-related protein factors and other substances required for protein synthesis.

[0069] In the present invention, "protein" and "protein" have the same meaning, are both translated as protein, and can be used interchangeably.

[0070] In the present invention, "system" and "system" are both translated as system and can be used interchangeably.

[0071] In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably.

[0072] In the present invention, cell extract, cell extract, cell lysate, cell disruption product and cell lysate have the same meaning and can be used interchangeably. In English, cell extract, cell lysate and the like can be used.

[0073] In the present invention, energy system, energy system, and energy supply system have the same meaning and can be used interchangeably. Energy regeneration system and energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system.

[0074] Furthermore, the present invention provides a cell-free protein synthesis system, which at least includes a cell extract or a cell lysate.

[0075] Further preferably, the cell-free protein synthesis system further comprises one or more components selected from the following group: a substrate for synthesizing RNA, a substrate for synthesizing protein, polyethylene glycol or its analogues, magnesium ions, potassium ions, a buffer, RNA polymerase, an energy regeneration system, dithiothreitol, and an optional aqueous solvent.

[0076] Further preferably, the substrate for synthesizing RNA includes: nucleoside monophosphate, nucleoside triphosphate or a combination thereof.

[0077] Further preferably, the substrate for synthesizing protein includes: 20 natural amino acids and unnatural amino acids.

[0078] Further preferably, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following group: magnesium acetate, magnesium glutamate, or a combination thereof.

[0079] Further preferably, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the following group: potassium acetate, potassium glutamate, or a combination thereof.

[0080] Further preferably, the energy regeneration system is selected from the following group: one or a combination of creatine phosphate / creatine phosphate enzyme system, glycolysis pathway and its intermediate energy system.

[0081] Further preferably, the energy regeneration system comprises a glucose / phosphate system, and the phosphate is selected from the following group: tripotassium phosphate, triammonium phosphate, trisodium phosphate, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, ammonium dihydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0082] Further preferably, the buffer is selected from the following group: 4-hydroxyethylpiperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane, or a combination thereof.

[0083] Further preferably, the in vitro protein synthesis system contains polyethylene glycol (PEG) or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEG is selected from the following group: one of PEG3000, PEG3350, PEG6000, PEG8000 or a combination thereof.

[0084] Further preferably, the polyethylene glycol includes polyethylene glycol with a molecular weight (Da) of 200-10000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc., preferably, polyethylene glycol with a molecular weight of 3000-10000.

[0085] In the present invention, the RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases, and a typical RNA polymerase is T7 RNA polymerase.

[0086] An optional scheme is that the in vitro protein synthesis system provided by the present invention includes: cell extract, 4-hydroxyethylpiperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytosine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphate kinase, and RNA polymerase.

[0087] In the present invention, the cell extract does not contain intact cells, and a typical cell extract includes ribosomes, transfer RNA, aminoacyl tRNA synthetase, initiation factors and elongation factors required for protein synthesis, and termination release factors for protein translation. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cell, especially soluble proteins.

[0088] In the present invention, the proportion of the cell extract in the in vitro cell-free protein synthesis system is not particularly limited. Usually, the cell extract accounts for 20-70% of the in vitro cell-free protein synthesis system, preferably 30-60%, and more preferably 40-50%.

[0089] In the present invention, the protein content of the cell extract is 20-100 mg / mL, preferably 50-100 mg / mL. The method for determining the protein content is the Coomassie Brilliant Blue determination method.

[0090] Vector, genetically engineered cells

[0091] The present invention also provides a vector or vector combination, wherein the vector contains the nucleic acid construct of the present invention. Preferably, the vector is selected from: bacterial plasmid, bacteriophage, yeast plasmid, animal cell vector, shuttle vector; the vector is a transposon vector. Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. As long as they can replicate and be stable in the host, any plasmid and vector can be used.

[0092] Those skilled in the art can use well-known methods to construct expression vectors containing the promoter and / or target gene sequence of the present invention, including in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc.

[0093] The present invention also provides a genetically engineered cell, wherein the genetically engineered cell contains the construct or vector or vector combination, or the genetically engineered cell chromosome is integrated with the construct or vector or vector combination. In another preferred embodiment, the genetically engineered cell further comprises a vector containing a transposase gene or the transposase gene is integrated into its chromosome.

[0094] Preferably, the genetically engineered cells are eukaryotic cells.

[0095] In another preferred embodiment, the eukaryotic cells include (but are not limited to): human cells, Chinese hamster ovary cells, insect cells, wheat germ cells, rabbit reticulocytes and other higher eukaryotic cells.

[0096] In another preferred embodiment, the eukaryotic cells include (but are not limited to) yeast cells.

[0097] Further preferably, the eukaryotic cells include (but are not limited to): Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia aminuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia alictaria, Pichia g uercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia asp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugar cane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

[0098] Further preferably, the Kluyveromyces further includes (but is not limited to): Kluyveromyces lactis (Kluyveromyces, K.lactis), Kluyveromyces marxianus, Kluyveromyces marxianus var.lactis, Kluyveromyces marxianus var.marxianus, Kluyveromyces marxianus var.vanudenii, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus polysporus), Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof.

[0099] The construct or vector of the present invention can be used to transform appropriate genetic engineering cells.

[0100] Template DNA

[0101] The template DNA is a nucleotide sequence encoding any target protein to be synthesized, which may be an original sequence, an artificially synthesized sequence, or an artificially modified sequence. The template DNA may be used to synthesize the corresponding RNA and / or protein.

[0102] In the present invention, the preparation method of the cell extract is not limited. A preferred preparation method is

[0103] The following steps are involved:

[0104] (i) providing cells;

[0105] (ii) washing the cells to obtain washed cells;

[0106] (iii) disrupting the washed cells to obtain a crude cell extract;

[0107] (iv) subjecting the crude cell extract to solid-liquid separation to obtain a liquid portion, namely the cell extract.

[0108] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0109] In a preferred embodiment, the centrifugation is performed in a liquid state.

[0110] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000 g, preferably 8000-30000 g.

[0111] In the present invention, the centrifugation time is not particularly limited, and a preferred centrifugation time is 0.5 min-2 h, preferably 20 min-50 min.

[0112] In the present invention, the centrifugation temperature is not particularly limited. Preferably, the centrifugation is performed at 1-10°C, more preferably, at 2-6°C.

[0113] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to use a washing liquid at a pH of 7-8 (preferably 7.4). The washing liquid is not particularly limited. Typically, the washing liquid is selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0114] In the present invention, the cell disruption treatment method is not particularly limited. A preferred cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen cryogenic) disruption.

[0115] The nucleoside triphosphate mixture in the in vitro cell-free protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate. In the present invention, the concentration of various mononucleotides is not particularly limited, and usually the concentration of each mononucleotide is 0.5-5mM, preferably 1.0-2.0mM.

[0116] The amino acid mixture in the in vitro cell-free protein synthesis system may include natural or non-natural amino acids, and may include D-type or L-type amino acids. Representative amino acids include (but are not limited to) 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine. The concentration of each amino acid is generally 0.01-0.5 mM, preferably 0.02-0.2 mM, such as 0.05, 0.06, 0.07, 0.08 mM.

[0117] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains polyethylene glycol or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the biosynthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000 and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).

[0118] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited, and generally, the concentration of sucrose is 0.03-40wt%, preferably 0.08-10wt%, and more preferably 0.1-5wt%, based on the total weight of the protein synthesis system.

[0119] A particularly preferred in vitro cell-free protein synthesis system contains the following components in addition to yeast cell extract: 22 mM 4-hydroxyethylpiperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphate kinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, and 0.027-0.054 mg / mL T7 RNA polymerase.

[0120] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only intended to illustrate the present invention.

[0121] It is not intended to limit the scope of the present invention. The experimental methods of the following examples without specifying specific conditions are usually according to conventional conditions, such as Sam Brook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts. The present invention is an embodiment with Kluyveromyces lactis (Kluyveromyces lactis, abbreviated as K. lactis or kl), but the same design and analysis, experimental methods are also applicable to eukaryotic cells such as other yeasts, animal cells, and prokaryotic cells.

[0122] The present invention uses Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis and experimental methods are also applicable to other yeasts and other lower eukaryotic cells and higher animal cells. The gene modification method in the present invention is CRISPR-Cas9 technology, but it is not limited thereto, and can be any known and existing gene modification method.

[0123] The in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, a reaction mixture system, or a reaction mixture, refers to a mixed system including an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it may be homogeneous or heterogeneous, and may be a liquid system such as a solution, an emulsion, or a suspension.

[0124] Preferably, the present invention recombines Ampase (phi29 DNA polymerase) in the genome of Kluyveromyces lactis (K. lactis) by means of CRISPR-Cas9-mediated gene editing.

[0125] The recombinant Ampase of the present invention is a temperature-sensitive mutant ts2 (24) of the DNA polymerase derived from Bacteriophage phi29. The enzyme has good DNA polymerase activity in an environment below 42°C and can complete the amplification of specific DNA sequences at room temperature. The present invention selects the core region (aa13-575) of the enzyme and fuses and expresses the ScMFA1 signal peptide and 8×His tag at the N-terminus and C-terminus of its protein sequence, respectively. In order to obtain the efficient expression characteristics of the enzyme, all protein coding sequences have been customized for codon optimization, and the ORF of the enzyme has been selected to be transcribed into mRNA under the control of a highly expressed yeast promoter (ScTEF1) and an artificial synthetic terminator (Tsynth27). The design scheme of Ampase recombinant is shown in the figure. Figure 1 The composition of the specific sequence is shown in Table 1.

[0126] Because KLLA0_20988g and KLLA0_21010g both have stable and high transcription levels in K. lactis, two gRNA targeting sequences were designed in the intergenic region between KLLA0_20988g and KLLA0_21010g. The specific sequence information is shown in Table 2. In order to obtain a higher integration expression efficiency, homology arm sequences of about 800 bp were designed upstream and downstream of the expression cassette, respectively. The specific sequence composition is shown in Table 1.

[0127] Table 1 Sequence composition in Ampase recombinant

[0128]

[0129]

[0130]

[0131] Table 2 gRNA list

[0132]

[0133]

[0134] Table 3 Primer list

[0135] Primers Sequence No. Sequence Length(bp) Ampi-p1 SEQ ID NO:11 acccgttaatagcaaccttaaccatg 26 Ampi-p2 SEQ ID NO:12 agcctttggctttggaactg 20 Ampi-vF1 SEQ ID NO:13 acccttgtatctaccatgggtgga 24 Ampi-vF2 SEQ ID NO:14 TCTCTTTCGATGACCTCCCATTGA 24 Ampi-vR3 SEQ ID NO:15 TGGAGCAGCCAAAGCAGAAGAA 22 Ampi-vF4 SEQ ID NO:16 TGGTGGTGAAATCGCTGACTTG 22 Ampi-vR4 SEQ ID NO:17 TAGGTCCACTTGTCGATGAAGTCC 24 Ampi-vF3 SEQ ID NO:18 AGCCAGTTCAAGTTCCAGGTG 21 Ampi-vR2 SEQ ID NO:19 ccaccggacatgtcatactacctc 24 Ampi-vR1 SEQ ID NO:20 gttcaaccatttgataccagcgaag 25

[0136] Example 1: Design of gRNA targeting sequence

[0137] The region (100-2000 bp) where the gRNA targeting sequence needs to be designed is selected, and the gRNA design is completed on the CRISPOR (tefor.net) (http: / / crispor.tefor.net / ) website, and the gRNA with a higher score is selected as the candidate sequence. In the present invention, two sequences with the highest comprehensive scores are selected as the final gRNA sequences, and the specific information is shown in Table 2. According to the designed gRNA targeting sequence, the corresponding 24-base primer pair is synthesized, that is, the 4-base sequence of AATC and AAAC is added to the 5'-end of the forward sequence and the reverse complementary sequence of each gRNA, and the final pair of 24-base primers constitutes a 24-base primer pair.

[0138] Example 2: Construction of gRNA_Cas9 expression vector

[0139] Dilute the paired 24-base primers to 10 μM, take 10 μL of each and add them to the PCR tube, mix them, and complete the annealing process on the PCR instrument according to the following program: 95℃, 3min; 72℃, 2min; 65℃, 2min; 60℃, 2min; 55℃, 2min; 50℃, 2min; 16℃, 2min. Take 0.5 μL of the annealed primers and 20 ng of the pCasMFR vector that has been treated with BsaI and purified, mix them in 10 μL of T4 ligase system, and react at 16℃ for 1h. All the ligation products were transformed into Escherichia coli DH5α competent cells and screened on LB plates containing 50 μg / mL kanamycin. Two single bacteria were randomly selected for sequencing verification, and the clones with correct sequencing were selected to extract plasmids for subsequent experiments.

[0140] Example 3: Construction of double-stranded DNA donor

[0141] The DNA donor sequence used in the present invention is obtained by PCR. The template sequence is a plasmid sequence that is fully synthesized and assembled and inserted into the pUC57 cloning vector. Ampi-p1 and Ampi-p2 are used as forward and reverse primers, respectively, and Phanta Super Fidelity DNA polymerase is used to perform PCR amplification to obtain the target band (3995 bp). The PCR product is precipitated with 70% ethanol and dissolved in 50 μL ddH2O and stored at -20°C for later use.

[0142] Example 4: Transformation and screening of yeast strains

[0143] The transformation of Kluyveromyces lactis strains was completed by electroporation. According to the requirements of the electroporation method, competent cells were prepared. Before electroporation, 40 μL of competent cell mixture was fully mixed with the corresponding 500 ng gRNA_Cas9 expression plasmid and 1-2 μg DNA Donor. The electroporation process was completed according to the standard operation procedure. The yeast cells after electroporation were screened on a YPD plate containing 250 μg / mL G418. Single colonies were picked for PCR verification. The verification primers are shown in Table 3. Paired primers were selected for verification. The positive PCR products were sent to the sequencing company for sequencing; the single colonies with correct sequencing were streaked on the plate, and single colonies were picked for the second round of PCR verification. Only strains with correct two rounds of verification will be prepared into glycerol cryovials and stored in a -80°C refrigerator.

[0144] Example 5: Lysate preparation and IVTT activity detection

[0145] After streaking the YPD plate, pick a single colony from the strain to be tested stored in a -80℃ refrigerator and inoculate it into a 250mL Erlenmeyer flask containing 100mL seed culture medium, and shake and culture it at 200rpm in a 30℃ shaker for 24h; take the seed solution and transfer it to a 1000mL Erlenmeyer flask containing 400mL fermentation culture medium, shake and culture it at 200rpm in a 30℃ shaker until the harvest period, collect the cells by high-speed centrifugation, and prepare cell lysate under liquid nitrogen protection for subsequent IVTT activity test. Take a certain amount of lysate prepared according to the standard process, and complete the detection and analysis of D2P expression activity of the lysate using mEGFP as the reporter protein according to the operating procedure, and judge the IVTT activity of the corresponding lysate according to the detected reporter fluorescence intensity (RFU value).

[0146] Example 6: Effect Verification

[0147] In addition, the IVTT activity of the lysate prepared by different methods to express Ampase on the basis of K. lactis strains and the mutant strains was tested. The experimental results are as follows: Figure 2As shown. It can be seen that the IVTT activity of the lysate prepared by the Ampase secretion expression strain at 3h was significantly increased by 19-51% compared with the control strain K. lactis, among which the IVTT activity of the lysate prepared by the secretion expression strain of Ampase with 8×His tag at the C-terminus was significantly improved the most; while the IVTT activity of the secretion expression strain of the Ampase control strain at 20h was slightly lower than that of the control strain. It is worth pointing out that the intracellular expression of Ampase, whether with or without C-terminal 8×His tag, led to a significant decrease in IVTT activity at 3h and 20h. It shows that the strain constructed by the secretion expression scheme of Ampase described in the invention is beneficial to improve the IVTT of the lysate prepared by the strain at 3h.

[0148] The experimental results show that the transformation method described in the present invention has the effect of significantly improving the IVTT activity of the strain lysate in a short period of time, and has no significant effect on its long-term IVTT activity. In addition, the design is also expected to reduce the addition of Ampase in the early stage of the IVTT reaction, thereby reducing the production cost of the D2P expression system. The method described in the present invention can also obtain the stable and active expression of Ampase in the cell.

[0149] Based on the above ideal embodiments of this application, the relevant staff can make various changes and modifications without departing from the technical concept of this application through the above description. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A recombinant DNA polymerase, characterized in that A signal peptide of a secretory protein is introduced into the structure of the DNA polymerase to achieve secretory expression of the DNA polymerase.

2. A recombinant DNA polymerase according to claim 1, characterized in that A tag protein is also introduced into the DNA polymerase structure.

3. A recombinant DNA polymerase according to claim 1 or 2, characterized in that: A signal peptide and / or a tag protein for secretory protein is introduced between the core regions of the DNA polymerase.

4. A recombinant DNA polymerase according to claim 3, characterized in that: The secretory protein signal peptide is at the N-terminus of the core region, and / or the tag protein is at the C-terminus of the core region.

5. A recombinant DNA polymerase according to any one of claims 1 or 4, characterized in that: The signal peptide of the secretory protein is the MFA1 signal peptide.

6. A recombinant DNA polymerase according to any one of claims 1 to 5, characterized in that A strong promoter is introduced into the ORF region encoding the recombinant DNA polymerase; more preferably, a terminator is also introduced.

7. A recombinant DNA polymerase according to any one of claims 1 to 6, characterized in that: The DNA polymerase is selected from phi29 DNA polymerase.

8. A recombinant DNA polymerase according to any one of claims 2 to 7, characterized in that: The core region comprises the sequence shown in SEQ ID NO:3 or an active fragment thereof, or is a polypeptide having ≥85% homology (preferably, ≥90% homology; preferably ≥95% homology; most preferably, ≥97% homology, such as 98% or more, 99% or more) with the amino acid sequence shown in SEQ ID NO:3 and having the same activity as the sequence of SEQ ID NO:

3.

9. A recombinant DNA polymerase according to any one of claims 6 to 8, characterized in that: The strong promoter is selected from one or more of TEF1, T7 promoter, T3 promoter, SP6 promoter, CMV, EF1A, CAG, CBh or SFFV.

10. A recombinant DNA polymerase according to any one of claims 6 to 8, characterized in that: The terminator is selected from: Tsynth27 terminator, or a nucleotide having ≥85% homology (preferably, ≥90% homology; preferably ≥95% homology; most preferably, ≥97% homology, such as above 98%, above 99%) with the nucleotide sequence of Tsynth27 terminator and having the same activity as the Tsynth27 terminator.

11. A recombinant DNA polymerase according to any one of claims 1 to 10, characterized in that: The number of amino acids in the tag protein is n, wherein 2≤n≤20, preferably 2≤n≤10.

12. A recombinant DNA polymerase according to claim 11, characterized in that: The tag protein is a histidine tag.

13. A polynucleotide, characterized in that The polynucleotide encodes the recombinant DNA polymerase according to any one of claims 1-12.

14. A carrier, characterized in that The vector contains the polynucleotide according to claim 13.

15. A genetically engineered cell, characterized in that: The genetically engineered cell contains the vector of claim 14 or the polynucleotide of claim 13 is integrated into its genome. The genetically engineered cell according to claim 15 , wherein the cell is selected from eukaryotic cells. The genetically engineered cell according to claim 16 , wherein the eukaryotic cell is a mammalian cell, a plant cell, a yeast cell, an insect cell or any combination thereof.

18. The genetically engineered cell according to claim 17, wherein the yeast cell is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia aminuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia alictaria, Pichia g uercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia asp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugarcane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof; the Kluyveromyces further comprises: Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces marxianus var. lactis, Kluyveromyces marxianus var. marxianus, Kluyveromyces marxianus var. vanudenii, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus polysporus), Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof.

19. A cell extract obtained from the genetically engineered cell according to any one of claims 15 to 18, characterized in that: The cell extract contains the recombinant DNA polymerase according to any one of claims 1 to 12.

20. A cell-free protein synthesis system, the synthesis system comprising at least the cell extract according to claim 19.

21. Use of the recombinant DNA polymerase according to any one of claims 1 to 12, the genetically engineered cell according to any one of claims 15 to 18, or the cell extract according to claim 19 in synthesizing foreign proteins.

22. A method for synthesizing an exogenous protein, comprising: Step 1, providing the cell-free protein synthesis system according to claim 20; Step 2, adding a DNA molecule encoding an exogenous protein to the synthesis system of step 1, incubating the reaction for a period of time under certain temperature conditions to synthesize the exogenous protein.

23. A kit, characterized in that: The kit comprises the cell-free protein synthesis system according to claim 20.

Images