Aptamer, fluorescent visual sensor based on aptamer combined with CRISPR-Cas12a and application of fluorescent visual sensor
By developing the fluorescent visual sensor combined with CRISPR-CAS12A, the existing virus detection methods are expensive and complex, and low-cost, fast, and reliable virus detection is achieved.
Patent Information
- Application Number
- CN202411593916.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-08
- Publication Date
- 2025-01-28
AI Technical Summary
Existing virus detection methods such as real-time fluorescence PCR have the problem that probes are expensive to purchase, rely on complex thermal circulation systems, cannot be used for immediate diagnosis, and insufficient fluorescence stability.
Develop a fluorescent sensor based on a proportion body and combined with CRISPR-CAS12A based on the adaptation body, using the binding of the proportion and THT dye to generate fluorescent signals, and determine the existence of viruses through CRISPR-CAS12A's cutting activity, to achieve fast and low low and low. Virus detection.
The rapid site diagnosis is achieved, the cost is low, the fluorescent signal is stable, and the diagnosis results are reliable, avoiding the dependence on the probe and equipment in existing technology.
Smart Images
Figure CN119372207A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering technology, and in particular to an aptamer, a fluorescent visual sensor based on an aptamer combined with CRISPR Cas12a, and applications thereof. Background Art
[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a clustered regularly spaced short palindromic repeat sequence. The full name of Cas is CRISPR associated, which is a gene adjacent to the CRISPR locus, encoding Cas protein and providing an enzymatic mechanism, referred to as the CRISPR-Cas system.
[0003] The Cas12 system in the CRISPR-Cas system, the Cas12 protein has trans-cutting activity. Under the guidance of crRNA, the protein specifically targets double-stranded DNA (dsDNA) and activates its trans-cutting activity, indiscriminately cutting non-specific single-stranded DNA (ssDNA). The Cas12 system recognizes double-stranded DNA, and trans-cutting recognizes single-stranded DNA. Studies have found that if 0.02% of the Cas12a system is activated, the shearing efficiency can reach 25-50%. Each targeted shearing will lead to more subsequent non-specific targeted shearing activity, amplifying the signal, and specifically enhanced fluorescent signals can be detected in a short time. Therefore, the Cas12 system has developed rapidly in the field of detection.
[0004] As new functional compounds, luminescent fluorescent dyes play a vital role in various biochemical processes such as DNA sequencing, cytological detection, drug-induced cytotoxicity detection, and clinical diagnosis. These luminescent dyes (such as triphenylmethane dyes, Hoechst derivatives, porphyrins, cyanine dyes, etc.) show excellent fluorescence behavior. Their autofluorescence is very low, but the fluorescence signal increases significantly when interacting with their aptamers. Due to this characteristic, organic luminescent dyes and inorganic metal complexes are used to develop label-free luminescent detection platforms.
[0005] Aptamers are single-stranded DNA or RNA that can bind to certain targets with high specificity and affinity. They can be selected and optimized in vitro by systematic evolution of ligands by exponential enrichment (SELEX). Since 1990, aptamers for various targets ranging from small molecules to whole cells have been optimized. Due to their unique advantages, nucleic acid aptamers have been widely used to construct biosensors.
[0006] For virus detection, the current rapid detection method is real-time fluorescence PCR, but the probe is expensive to purchase and requires a complex thermal cycle system to amplify nucleic acids, which makes it impossible to use it for point-of-care diagnosis (POCT). In addition, the fluorescence stability of the existing real-time fluorescence PCR method still needs to be improved. Summary of the invention
[0007] The object of the present invention is to provide an aptamer, a fluorescent visual sensor based on an aptamer combined with CRISPR Cas12a, and applications thereof, which can be used for timely diagnosis, have low cost, good fluorescence stability, and more reliable diagnostic results.
[0008] To achieve the above object, the present invention discloses an aptamer, which comprises at least one set of nucleotide sequences as shown in SEQ ID NO.1-16.
[0009] Preferably, the aptamer comprises one or more of the nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.13 and SEQ ID NO.15.
[0010] The present invention also discloses a fluorescent visual sensor based on an aptamer combined with CRISPR / Cas12a, which adopts the above-mentioned aptamer.
[0011] Preferably, thioflavin ThT is also included.
[0012] Preferably, it also includes crRNA, whose sequence is UAAUUUCUACUAAGUGUAGAUUUAUAGCAUCAGCAUCAGAAUCU.
[0013] Preferably, an RNase enzyme inhibitor is also included.
[0014] Preferably, a reaction buffer is also included.
[0015] Preferably, the reaction buffer comprises 20 mM HEPES and 10 mM MgCl2, and the pH of the reaction buffer is 7.9.
[0016] In addition, the present invention also discloses the application of the above aptamer or the above fluorescent visual sensor in pathogen or non-pathogen detection.
[0017] Preferably, the fluorescent visual sensor is used in combination with RAA amplification technology.
[0018] Preferably, the fluorescent visual sensor includes thioflavin ThT. During detection, thioflavin ThT is added after the pathogen or non-pathogen, aptamer and CRISPR-Cas12a are evenly mixed.
[0019] The present invention has the following beneficial effects: 1. The nucleotide sequences (SEQ ID NO.1-16) of the aptamer (DuW) of the present invention can all bind to the ThT dye, and the ThT dye emits fluorescence under the excitation light of 425 nm. According to this feature, the aptamer of the present invention is combined with the CRSPR-Cas12 system to establish the CRSPR-Cas12a-DuW detection method. At the same time, in order to improve the sensitivity of the detection, the RAA amplification technology is combined with the CRSPR-Cas12a-DuW to establish the RAA-Cas12a-DuW detection method. By observing the luminescence of the ThT dye, it is inferred whether the aptamer DuW is cut, and then it is judged whether there is a detection object. The present invention can realize rapid on-site diagnosis (POCT), and the color development method is low-cost. Fluorescence can be observed under blue light, and the fluorescence is more stable than FAM fluorescence, and no advanced equipment or professional training is required.
[0020] 2. The aptamers DuW-9 (SEQ ID NO.9), DuW-13 (SEQ ID NO.13), and DuW-15 (SEQ ID NO.15) of the present invention can combine with the dye ThT to emit a strong fluorescent signal, and are also beneficial to the trans-cleavage activity of Cas12a protein to cut it, so the detection effect is better and more conducive to rapid on-site diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Schematic diagram for screening the best aptamer for fluorescent visual sensor combined with CRISPR / Cas12a.
[0022] Figure 2 This is the result diagram of aptamer screening.
[0023] Figure 3 This is one of the results of the preliminary establishment of the fluorescence visualization method for aptamer combined with CRISPR-Cas12a.
[0024] Figure 4 The second figure shows the preliminary results of the fluorescence visualization method for establishing the aptamer combined with CRISPR-Cas12a.
[0025] Figure 5 This is the result of the binding between aptamer DuW and ThT dye.
[0026] Figure 6 This is a graph showing the results of evaluating the cleavage activity of Cas12a on the aptamer DuW.
[0027] Figure 7 This is the false positive detection rate result graph of RAA-Cas12a-DuW. DETAILED DESCRIPTION
[0028] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments.
[0029] The present invention discloses a fluorescence visualization method based on aptamers combined with CRISPR-Cas12a, which can be used for pathogen detection or non-pathogen detection. The design principle is as follows: The dye (ThT) itself has no fluorescent signal output. When the complete aptamer binds to the dye, the dye will have a fluorescent signal output; when the aptamer is cut and does not bind to the dye, the dye will have no fluorescent signal output. Whether the aptamer is complete can be determined by whether the dye has a fluorescent signal output, and thus whether the test sample is positive, that is: When the object to be detected is present, the para-cleavage activity of Cas12a is activated, and the aptamer is non-specifically cleaved. Since the integrity of the aptamer is destroyed, it binds to thioflavin ThT to produce weak fluorescence or no fluorescence; When the object to be detected does not exist, the para-cleavage activity of Cas12a is not activated, and the aptamer cannot be non-specifically cut. The complete aptamer binds to thioflavin ThT to produce fluorescence.
[0030] The present invention focuses on the need to screen out suitable aptamers for the fluorescent visual sensor combined with CRISPR-Cas12a. The screening process is as follows: Figure 1 As shown, the following is the specific design process.
[0031] Example 1: Screening of aptamers In order to screen out suitable aptamers, according to literature reports, 18 aptamers (ThT-3, BCL-2, ThT-5, c-kit1, TG4, C9orf72, 27Kras, Tel22, ThT-6, VEGF, PS2.M, ThT-1, ThT-2, ThT-4, Insulin a2, VAV1, GP18, Dz-00) were found to bind to ThT dye, which can make ThT dye have fluorescence signal output under 425 nm excitation light, or green fluorescence can be observed under blue light. First, the 18 known aptamers were combined with ThT dye for comparison, and the reaction system was as follows: ①1 µM aptamer (any reported aptamer); ②5 mM ThT dye; Mix ① and ② in Cas12a reaction buffer (20 mM HEPES, and 10mM MgCl2, pH 7.9) with a reaction volume of 20µL. Mix well and place under blue light to observe the fluorescence signal. Place the full-wavelength multifunctional microplate reader Varioskan Flash, the solution is excited at 425 nm, the emission is monitored in the wavelength range of 450-650 nm, and the fluorescence emission intensity results at 470-490 nm are collected. Figure 2 All reactions were performed in triplicate.
[0032] Example 2: Preliminary establishment of a fluorescence visualization method for combining aptamers with CRISPR-Cas12a Principle of fluorescence visualization of aptamer combined with CRISPR-Cas12a: Target DNA is recognized by Cas12a-crRNA complex. When Cas12a is inactivated, ThT ssDNA aptamer binds to ThT dye and emits fluorescence; when Cas12a protein is activated, the activated Cas12a protein cuts ThT aptamer, resulting in fluorescence loss, which can be observed by Varioskan Flash or blue light.
[0033] Taking the detection of monkeypox virus as an example, the reaction system is as follows: ①100 nM purified LbCas12a; ②200 nM crRNA (UAAUUUCUACUAAGUGUAGAUUUAUAGCAUCAGCAUCAGAAUCU); ③1 µM ThT-3 aptamer; ④RNase inhibitor (1 U / μL); ⑤2 µL of plasmid DNA containing monkeypox virus fragments (100 ng / μL) was mixed in Cas12a reaction buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH7.9) in a reaction volume of 20 µL.
[0034] ①-⑤ After mixing evenly, react at 37 ℃ for 15 min. Then add 5 mM ThT dye and observe the color development under blue light; place the full-wavelength multifunctional microplate reader Varioskan Flash, the solution is excited at 425 nm, and the emission results are monitored in the wavelength range of 450-650 nm. Figure 3 (a) and (b). The average fluorescence emission intensity at 470-490 nm and the results under blue light were collected. Figure 3As shown in (c), all reactions were performed in triplicate. The results showed that the fluorescence visualization method of aptamers combined with CRISPR-Cas12a was initially established successfully.
[0035] 18 aptamers were added to the Cas12a detection system, and aptamers with better cutting effects were screened out to establish the RAA-Cas12a-DuW visualization detection method. The reaction system is as follows: ①100 nM purified LbCas12a; ②200 nM crRNA (UAAUUUCUACUAAGUGUAGAUUUAUAGCAUCAGCAUCAGAAUCU); ③1 µM aptamer (any reported aptamer); ④RNase inhibitor (1 U / μL); ⑤2 µL of plasmid DNA containing monkeypox virus fragments (100 ng / μL) was mixed in Cas12a reaction buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH7.9) in a reaction volume of 20 µL.
[0036] ①-⑤ After mixing evenly, react at 37 ℃ for 15 min. Then add 5 mM ThT dye and observe the color development under blue light; place the full-wavelength multifunctional microplate reader Varioskan Flash, the solution is excited at 425 nm, and the emission is monitored in the wavelength range of 450-650nm. Collect the average fluorescence emission intensity results at 470-490nm Figure 4 As shown in (d), under blue light Figure 4 (e) All reactions were performed in triplicate.
[0037] Example 3: Design of ThT aptamer The results of Example 2 show that the fluorescence signal generated by the combination of ThT-3 aptamer and ThT dye is the strongest. After adding Cas12a to the reaction, ThT-3 aptamer is more conducive to trans-cutting by Cas12a. Therefore, in order to screen out better aptamers, screening is performed again and compared with the reaction results of ThT-3 aptamer. We designed 16 aptamers DuW based on the sequence of ThT-3 aptamer (CGAGGCTATTAGGAGGTGGGATGC) by adding or subtracting part of G. The specific sequence information is shown in Table 1.
[0038] Table 1
[0039] Example 4: Screening of the best fluorescent aptamer DuW ThT dye has no spontaneous fluorescence, but the fluorescence signal will increase significantly when interacting with its aptamer. According to the sequences given in Example 2, verification and screening of the best fluorescence were performed. The reaction system is as follows: ①1 μM aptamer DuW, whose sequence is any one of SEQ ID NO.1-16; ②5 mM ThT dye; Mix ① and ② in Cas12a reaction buffer (20 mM HEPES, and 10 mM MgCl2, pH 7.9) in a reaction volume of 20 µL. Mix well and place under blue light to observe the fluorescence signal. Place the full-wavelength multifunctional microplate reader Varioskan Flash, the solution is excited at 425 nm, the emission is monitored in the wavelength range of 450-650 nm, and the fluorescence emission intensity results at 470-490 nm are collected. Figure 5 As shown, all reactions were performed in triplicate.
[0040] Example 5: Preliminary establishment of CRISPR-Csa12a-DuW detection method According to the results of Example 4, we will carry out the next step of the experiment by combining the sequence that can bind to the ThT dye luminescent aptamer. In order to determine the most suitable ssDNA aptamer as the reporter gene of the Cas12a system, in addition to finding the best fluorescence, an aptamer that is easily cut by the Cas12a enzyme is also needed. Based on the detection of monkeypox virus, a fluorescence visualization method of the aptamer DuW combined with CRISPR-Cas12a is established. The reaction conditions of the established Cas12a-DuW detection system are as follows: ①100 nM purified LbCas12a; ②200 nM crRNA (UAAUUUCUACUAAGUGUAGAUUUAUAGCAUCAGCAUCAGAAUCU); ③1 μM aptamer DuW, whose sequence is any one of SEQ ID NO.1-16; ④RNase inhibitor (1 U / μL); ⑤ Monkeypox virus nucleic acid template (plasmid DNA containing monkeypox virus fragments (100 ng / μL); Mix ①-⑤ in Cas12a reaction buffer (20 mM HEPES, and 10 mM MgCl2, pH 7.9) with a reaction volume of 20 µL. Mix well and incubate at 37°C for 5 min. Then, add 5 mM ThT dye, mix well and place under blue light to observe the fluorescence signal. Place the full-wavelength multifunctional microplate reader Varioskan Flash, the solution is excited at 425 nm, the emission is monitored in the wavelength range of 450-650nm, and the fluorescence emission intensity results at 470-490 nm are collected. Figure 6 shown.
[0041] Example 6: Preliminary application of screening of luminescent fluorescent ThT aptamers According to Example 5, we found that DuW-9, DuW-13, and DuW-15 combined with dyes emit strong fluorescent signals, which are also conducive to the trans-cleavage activity of Cas12a protein to cut them. In order to further verify the feasibility of fluorescent visual sensing of aptamers combined with CRISPR / Cas12a, we conducted a false positive experiment. The plasmid containing the monkeypox virus fragment was gradiently diluted to 2 copies, and 2 μL of 2 copies of the plasmid was added to the RAA reaction system.
[0042] RAA reaction system and conditions: ① Buffer V (produced by Qitian Gene): 25 μL; ② Primer F (10 μM) (TATGATCCTCTCTCATTGATTTTTCGC): 2 μL; ③ Primer R (10 μM) (CTCCTCCTCGTTGGTCTACGACAATGGAT): 2 μL; ④Magnesium acetate I: 5 μL; ⑤ Add 2 μL of template (2 copies) to 50 μL of water. Incubate at 39°C for 30 min.
[0043] After the RAA amplification reaction is completed, take 2 μL and add it to the RAA-Cas12a-DuW system.
[0044] The RAA-Cas12a-DuW reaction system is as follows: ①100 nM purified LbCas12a; ②200 nM crRNA (UAAUUUCUACUAAGUGUAGAUUUAUAGCAUCAGCAUCAGAAUCU); ③1 μM aptamer DuW, whose sequence is any one of SEQ ID NO.1-16; ④RNase inhibitor (1 U / μL); ⑤RAA amplification product 2 μL; ①-⑤ were mixed in Cas12a reaction buffer 20 mM HEPES, and 10 mM MgCl2, pH 7.9, with a reaction volume of 20 µL. After mixing well, incubate at 37 °C for 15 min. 5 mM ThT dye was added, mixed well, and placed under a blue light to observe the fluorescence signal. The full-wavelength multifunctional microplate reader Varioskan Flash was placed, the solution was excited at 425 nm, the emission was monitored in the wavelength range of 450-650 nm, and the fluorescence emission intensity results at 470-490 nm were collected. Figure 7 shown.
[0045] In summary, the aptamer-dye combination of the present invention can replace the probe method and is applied to the CRISPR-Cas12a detection method. The existing probe method ssDNA reporter gene is mixed in the CRISPR-Cas12a reaction, which is prone to fluorescence loss during incubation and false positive problems. However, the CRISPR-Cas12a detection method based on aptamer-dye combination established by the present invention only introduces the dye into the reaction and combines with the aptamer after the reaction is completed, effectively eliminating the risk of fluorescence loss during incubation. And the fluorescent signal generated by the aptamer-dye combination is more stable than the fluorescent signal of the probe method.
[0046] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.
Claims
1. An aptamer, characterized in that: It includes at least one set of nucleotide sequences shown as SEQ ID NO.1-16.
2. The aptamer according to claim 1, characterized in that: The aptamer includes one or more of the nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.13 and SEQ ID NO.
15.
3. A fluorescent visual sensor based on aptamer combined with CRISPR / Cas12a, characterized in that: The aptamer is as described in claim 1 or 2.
4. The fluorescent visual sensor according to claim 3, characterized in that: Also included is thioflavin ThT.
5. The fluorescent visual sensor according to claim 3, characterized in that: It also includes crRNA, whose sequence is UAAUUUCUACUAAGUGUAGAUUUAUAGCAUCAGCAUCAGAAUCU.
6. The fluorescent visual sensor according to claim 3, characterized in that: RNase enzyme inhibitors are also included.
7. The fluorescent visual sensor according to claim 3, characterized in that: Reaction buffer is also included.
8. The fluorescent visual sensor according to claim 7, characterized in that: The reaction buffer comprises 20 mM HEPES and 10 mM MgCl2, and the pH of the reaction buffer is 7.
9.
9. Use of the aptamer according to claim 1 or 2 or the fluorescent visual sensor according to any one of claims 3 to 8 in pathogen or non-pathogen detection.
10. The use according to claim 9, characterized in that: The fluorescent visual sensor is used in combination with RAA amplification technology.
11. The use according to claim 9 or 10, characterized in that: The fluorescent visual sensor includes thioflavin ThT. During detection, thioflavin ThT is added after the pathogen or non-pathogen, aptamer and CRISPR-Cas12a are evenly mixed.