Use of fvNAC073 in regulating strawberry fruit ripening or fruit development

Editing the FvNAC073 gene using a CRISPR-Cas9 vector to regulate strawberry fruit ripening and development addresses the shortcomings of existing technologies in strawberry fruit ripening regulation. This enables effective regulation of fruit coloring, softening, and size, providing new genetic resources for strawberry breeding.

CN119372211BActive Publication Date: 2026-03-03SHANGHAI JIAOTONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-02
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

There is a lack of effective means to regulate the ripening and development of strawberry fruits in the current technology, especially for in-depth research on non-climacteric fruits. The function of FvNAC037 has been partially revealed, but the role of FvNAC073 in the ripening and development of strawberry fruits is still unclear.

Method used

By designing sgRNA and constructing a CRISPR-Cas9 vector, FvNAC073 gene editing was performed to regulate the ripening or development of strawberry fruits. This included knocking out or overexpressing the FvNAC073 protein, transforming the vector into strawberries using Agrobacterium-mediated transformation, and obtaining mutants to regulate fruit ripening and development.

Benefits of technology

Successfully regulating the coloring, softening, anthocyanin content, and size of strawberry fruits provides the function of promoting or delaying fruit ripening, offering new genetic resources for strawberry breeding, and improving fruit quality and storage preservation time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005209238740000171
    Figure GDA0005209238740000171
  • Figure GDA0005209238740000181
    Figure GDA0005209238740000181
  • Figure HDA0005022413000000011
    Figure HDA0005022413000000011
Patent Text Reader

Abstract

The application belongs to the field of plant biotechnology, and discloses the use of FvNAC073 in regulating strawberry fruit ripening or fruit size. The application finds that FvNAC073 has important biological functions in strawberry ripening or fruit size, after knocking out FvNAC073, the anthocyanin content in strawberry fruit is reduced, fruit softening is delayed, the abscisic acid content in the fruit is reduced, the fruit longitudinal diameter and transverse diameter are reduced, and the single fruit weight is reduced; after overexpressing FvNAC073, the anthocyanin content in strawberry fruit is increased, fruit softening is advanced, the abscisic acid content in the fruit is increased, the fruit longitudinal diameter and transverse diameter are increased, and the single fruit weight is increased, so that the application can provide a new gene resource for researching the molecular breeding of strawberry fruit size and fruit ripening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, and specifically relates to the use of FvNAC073 in regulating strawberry fruit ripening or fruit development. Background Technology

[0002] Strawberries are one of the most popular fruit crops, prized for their unique flavor and aroma. Strawberry fruit development and ripening involves a series of structural and biochemical changes, including size changes, receptacle softening, and increases in sugar, anthocyanin, and volatile compound content. Existing research on the molecular mechanisms of fruit development and ripening primarily focuses on climacteric fruits. Climacteric fruit ripening is accompanied by a sharp increase in respiration and ethylene levels; typical climacteric fruits include strawberries, bananas, peaches, avocados, and mangoes. Non-climacteric fruits, on the other hand, do not exhibit a significant increase in respiration rate or a sharp rise in ethylene levels; these include strawberries, citrus fruits, and lemons. Strawberries are often used as a model plant for studying the ripening process of non-climacteric fruits. Identifying and elucidating the genes regulating strawberry fruit ripening and development can provide a strong theoretical foundation for breeding new varieties and holds great promise for future applications.

[0003] NAC transcription factors have been successively discovered in species such as Arabidopsis thaliana, rice, grape, wheat, soybean, cassava, tomato, and cucumber, and are one of the largest transcription factor families in plants. Many studies have shown that NAC transcription factors not only participate in the growth and development of plant roots, stems, leaves, and flowers, but also in the regulation of fruit ripening and hormone regulation. Due to the diversity of the NAC transcription factor family in terms of species and functions, their differential regulation of non-climacteric fruits warrants further investigation. The role of NAC transcription factors in non-climacteric fruits has been preliminarily demonstrated. Six NAC transcription factors related to fruit development and ripening were identified in pineapple strawberry: FaNAC006, FaNAC021, FaNAC022, FaNAC035, FaNAC042, and FaNAC09. Among them, FaNAC035 (FaRIF) increases ABA accumulation by inducing the expression of abscisic acid (ABA) synthesis-related genes FaNCED3 and FaZEP. FaNAC035 also participates in ABA signal transduction by regulating the expression patterns of FaHVA22, FaSnRK2.6, FaHY5, and FaBBX19. Although previous studies have identified six NAC transcription factors related to fruit development and maturation, only the function of FaNAC035 has been preliminarily studied, and the functions of the remaining NAC transcription factors are still unclear.

[0004] CN115960188B discloses the uses of FvNAC037, which records that overexpression of FvNAC037 can significantly promote the accumulation of sucrose in fruit, indicating that promoting FvNAC037 expression has the function of promoting sucrose synthesis and increasing sugar accumulation in strawberry fruit; silencing FvNAC037 can significantly reduce sucrose in strawberry fruit, indicating that the decrease in FvNAC037 expression has the function of inhibiting sucrose synthesis and reducing sugar accumulation in fruit. In summary, FvNAC037 can regulate the quality of strawberry fruit and can be used to breed new strawberry varieties.

[0005] However, no research has been found on the relationship between FvNAC037 and strawberry fruit ripening and fruit development. Summary of the Invention

[0006] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide the use of FvNAC073 in regulating strawberry fruit ripening or fruit development, thereby solving the problems in the prior art.

[0007] To achieve the above and other related objectives, the present invention is obtained through the following technical solution.

[0008] The first aspect of this invention protects the use of FvNAC073 as a target in screening products that regulate strawberry fruit ripening or fruit development.

[0009] The second aspect of the present invention protects the use of FvNAC073 or its regulator in at least one of A1)-A3): A1) regulating strawberry fruit ripening; A2) regulating strawberry fruit development; A3) cultivating strawberries.

[0010] A third aspect of the present invention protects a method for promoting the ripening or development of strawberry fruit, the method comprising one or both of the following steps: 1) introducing the FvNAC073 protein into strawberry to promote the ripening or development of strawberry fruit; 2) introducing biological materials related to the FvNAC073 protein into strawberry to promote the ripening or development of strawberry fruit.

[0011] A fourth aspect of the present invention protects a method for delaying the ripening of strawberry fruit or inhibiting the development of strawberry fruit, the method comprising the following steps: reducing the expression level of FvNAC073 protein in strawberry to inhibit the ripening of strawberry fruit or inhibit the development of strawberry fruit.

[0012] The fifth aspect of the present invention protects a method for cultivating strawberries, the method comprising one or more of the following steps: D1) introducing the FvNAC073 protein to cultivate early-maturing or larger-fruited strawberries; D2) introducing biological material associated with the FvNAC073 protein to cultivate early-maturing or larger-fruited strawberries; D3) reducing the expression level of the FvNAC073 protein in strawberries to cultivate late-maturing or smaller-fruited strawberries.

[0013] The present invention has the following beneficial effects:

[0014] 1) This invention designed an sgRNA targeting FvNAC073, constructed a CRISPR-Cas9 vector targeting FvNAC073, and transformed the CRISPR-Cas9 vector into *Strombocytocarpus spp.* (FvNAC073 knockout mutant) using Agrobacterium-mediated transformation, obtaining the FvNAC073 knockout mutant. Compared with wild-type Ruegen, FvNAC073 knockout delayed fruit coloring and softening; reduced anthocyanin content; and decreased transverse and longitudinal diameters of developing fruits. Overexpression of FvNAC073 in strawberries significantly promoted the development of transverse and longitudinal diameters, increased fruit weight, reduced fruit firmness, increased anthocyanin content, and advanced and deepened coloring. These findings indicate that FvNAC073 has the function of promoting strawberry fruit development and ripening, providing a new gene resource for molecular breeding to promote fruit development and ripening.

[0015] 2) This invention also analyzed the expression of genes related to anthocyanin synthesis. It was found that after knocking out FvNAC073, the expression of genes related to anthocyanin synthesis, such as FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, and FvUFGT, was significantly reduced, indicating that knocking out FvNAC073 inhibits anthocyanin synthesis and causes fruit to color late. On the other hand, after overexpressing FvNAC073, the expression of genes related to anthocyanin synthesis, such as FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, FvUFGT, and FvMYB10, was significantly increased, indicating that overexpressing FvNAC073 promotes anthocyanin synthesis and causes fruit to color early.

[0016] 3) This invention also analyzed the expression of cell wall-related genes and found that the expression of cell wall-related genes such as cell wall degradation genes, cell wall remodeling genes, and cell wall loosening genes was significantly reduced after FvNAC073 knockout. This indicates that FvNAC073 knockout can inhibit cell wall expansion and extension, while relaxing the cell wall, resulting in smaller fruit and delayed softening. On the other hand, the expression of cell wall-related genes such as cell wall degradation genes, cell wall remodeling genes, and cell wall loosening genes was significantly increased after FvNAC073 overexpression. This indicates that FvNAC073 overexpression can promote cell wall expansion and extension, while relaxing the cell wall, resulting in larger FvNAC073-OE fruit and earlier softening. Attached Figure Description

[0017] Figure 1 Shown is the CRISPR / Cas9-mediated FvNAC073 gene-editing line in Example 1 of this application. (A) Schematic diagram of sgRNA1 and sgRNA2 target sites in FvNAC073, with sequence alignment obtained after amplification, purification, and Sanger sequencing of the fragments surrounding the target sites in WT, fvnac073-6, and fvnac073-9. Blue letters represent sgRNA1 and sgRNA2, bold text represents PAM sequences, and red short horizontal lines represent base deletions. (B) Plant phenotypes of wild-type WT, mutant fvnac073-6, and mutant fvnac073-9.

[0018] Figure 2 The results show that fruit development was inhibited and fruit ripening time was delayed in the mutant fvnac073 of Example 2 of this application. (A) Fruit phenotypes of wild-type WT, mutant fvnac073-6, and mutant fvnac073-9 at different stages, monitored at 11, 16, 21, 22, 24, 25, and 28 days after flowering. (B) Percentage of fruits at different developmental / ripening stages at each time point. (C) Fruit weight of wild-type WT, mutant fvnac073-6, and mutant fvnac073-9 at 22 days after flowering. (D) Changes in transverse diameter of wild-type WT, mutant fvnac073-6, and mutant fvnac073-9 from 3 to 27 days. (E) Changes in longitudinal diameter of wild-type WT, mutant fvnac073-6, and mutant fvnac073-9 from 3 to 27 days.

[0019] Figure 3The results show that fruit enlargement was inhibited and fruit ripening time was delayed in the mutant fvnac073 of Example 2 of this application. (A) Changes in anthocyanin content in fruits of WT, fvnac073-6, and fvnac073-9 at 22 days after flowering and at maturity (25 days after flowering for WT, and 28 days after flowering for the fvnac073-6 and fvnac073-9 mutants). (B) Changes in fruit firmness in WT, fvnac073-6, and fvnac073-9 at 22 days after flowering and at maturity. (C) ABA content in fruits of WT, fvnac073-6, and fvnac073-9 at 22 days after flowering.

[0020] Figure 4 The images show the expression of fruit ripening-related genes in the fvnac073-9 mutant in Example 4 of this application. (A) Anthocyanin-related gene expression in the fruit of the fvnac073-9 mutant. (B) Expression of genes related to ABA synthesis, degradation, and signaling in the fruit of the fvnac073-9 mutant.

[0021] Figure 5 The image shows the expression of cell wall-related genes in the fruit of the fvnac073-9 mutant in Example 5 of this application.

[0022] Figure 6 The following is an illustration of how FvNAC073 overexpression promotes fruit enlargement and ripening in Example 6 of this application. (A) Phenotypic changes of EV-OE and FvNAC073-OE 1-8 days after injection. (B)(C) Changes in transverse and longitudinal diameters of EV-OE and FvNAC073-OE fruits after 5 and 7 days of injection. (D) Changes in fruit weight of EV-OE and FvNAC073-OE fruits after 5 and 7 days of injection. (E) Changes in fruit firmness of EV-OE and FvNAC073-OE fruits after 5 and 7 days of injection. (F) Changes in anthocyanin content of EV-OE and FvNAC073-OE fruits after 5 and 7 days of injection.

[0023] Figure 7 The figure shown is a graph illustrating the results of gene expression analysis related to ripening and cell wall in fruit after FvNAC073 overexpression in Example 7 of this application. Detailed Implementation

[0024] Fruit ripening is a crucial stage in the growth and development of a fruit. It is a highly coordinated, genetically programmed, and irreversible phenomenon involving a series of physiological, biochemical, and sensory changes that shape the unique flavor, texture, and color of the ripe fruit, resulting in its edible quality attributes. During fruit ripening, a series of physiological and biochemical changes typically occur, including softening of the fruit, reduction of organic acids, starch degradation, accumulation of soluble sugars, disappearance of tannins, synthesis of aromatic compounds, chlorophyll degradation, and accumulation of carotenoids or anthocyanins. Understanding the mechanisms regulating ripening not only provides a theoretical understanding of important stages in plant development but also offers a basis for improving fruit quality and extending storage and preservation time.

[0025] This invention found that knocking out FvNAC073 delayed coloring and softening of strawberry fruits, reduced anthocyanin content, and decreased fruit diameter (both transverse and longitudinal). Conversely, overexpression of FvNAC07 resulted in increased transverse and longitudinal diameters, increased fruit weight, decreased fruit firmness, increased anthocyanin content, earlier coloring time, and deeper color.

[0026] FvNAC073 plays an important biological role in strawberry ripening, fruit development, and strawberry breeding. This application provides a new gene resource for molecular breeding that promotes fruit development and ripening. Based on this, the present invention was completed.

[0027] The first aspect of the present invention provides the use of FvNAC073 as a target in screening products that regulate strawberry fruit ripening or fruit development.

[0028] In this invention, products targeting FvNAC073 for strawberry fruit ripening or development specifically refer to products that use the FvNAC073 gene or FvNAC073 protein as the target and screen products to find those that can promote or inhibit the expression level of the FvNAC073 gene or the expression or activity of the FvNAC073 protein as candidate products for strawberry fruit ripening or development.

[0029] In this invention, the product includes molecules that can specifically inhibit the transcription or translation of the FvNAC073 gene, or specifically inhibit the expression or activity of the FvNAC073 protein, thereby enabling the product to reduce the expression level of the FvNAC073 gene in strawberries, delay strawberry fruit softening, delay strawberry fruit coloring, and inhibit strawberry fruit development.

[0030] In this invention, the product includes molecules that can specifically promote the transcription or translation of the FvNAC073 gene, or can specifically promote the expression or activity of the FvNAC073 protein, thereby enabling the product to increase the expression level of the FvNAC073 gene in strawberries, promote strawberry softening, promote strawberry fruit coloring, and promote strawberry fruit development.

[0031] In this invention, the products include, but are not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemicals, antibody drugs, peptides, proteins, or interfering lentiviruses. The form of the products is not particularly limited and can be various physical forms such as solids, liquids, gels, semi-liquids, or aerosols.

[0032] In this invention, the nucleotide sequence of FvNAC073 includes the sequence shown in SEQ ID NO.1. The sequence shown in SEQ ID NO.1 is specifically as follows:

[0033] ATGACATGGCACTCAGATGAGGAAGAGGAAGAAGAGAGGGCAGCAGTTCAGTCAATAACTCCCTCCTCTGCAACATATCCTCAGCAATCTAAGAATAATAAGAACAATGAAATATCATCATGCCCGTCTTGTGGCCACCCTATAGATTTTCAAGACCAGGCTGGAATTCATGATTTGCCGGGACTACCAGCAGGGGTGAAATTTGATCCGACGGACCAGGAGATTCTTCAACATTTGGAGGCAAAAGTGCTCACTGATACCAGAAAGCTTCATCCACTCATTGATGAATTCATACCAACGCTTGATGGAGAGAATGGAATCTGCTCTACCCACCCAGAAAAGCTACCAGGAGTTAACAAAGAAGGACAGATCCGCCACTTTTTTCACCGACCCTCAAAGGCCTATACCACCGGAACCAGGAAGCGAAGGAAGGTTCACACCGAAGAAGATGGAAGCGAGACAAGATGGCACAAAACGGGCAAGACAAGGCCAGTCCTAGCCAATGGAGCAGTCAAGGGTTTCAAAAAGATCTTGGTCCTCTACACCAACTACGGCAGGCAAAGGAAGCCCGAGAAGACGAATTGGGTGATGCACCAGTACCACCTTGGCAACAATGAAGAAGAAAAAGATGGGGAGCTAGTGCTATCTAAGGTCTTTTACCAAACACAACCTAGGCAATGTGGTACTGGCACTCCAAGTATCAGAGATGGTGGTCCTCCATTGTTGAATCCATTTGATAGCCATCATTATAAAGGTCAAGTGAATATTCGTAGTGGCCAAGATGGGATTCCTCTTCCTCTTCCTCCAAAGAAGGCTGGTGTTATGGAGTATTACAATCATAATCATCCTGGTCCTTTTATGAACTATGAGCATCCTCATCTAATTCAAGGAGGCCAGAATAGGGAAATCCCAGCTCAACTAATTCCTAACATGGTTCTTCAAGGTGACGGGTCTTCGTTGTTTCGATACAATGCTGCAGATACAAGCAAAGGAAACTAA

[0034] Another aspect of the present invention provides the use of FvNAC073 or its regulator in strawberry fruit ripening or fruit development or in strawberry cultivation.

[0035] In some implementations, overexpression of FvNAC073 promotes strawberry fruit ripening or development.

[0036] In other embodiments, knocking out FvNAC073 inhibits strawberry fruit ripening or inhibits strawberry fruit development.

[0037] In some embodiments, fruit ripening refers to fruit softening, fruit coloring, or an increase in abscisic acid content in the fruit.

[0038] Furthermore, the aforementioned fruit coloring refers to the increase in anthocyanin content in the fruit. During fruit ripening, chlorophyll degradation, the synthesis and accumulation of different types of anthocyanins in vacuoles, and the accumulation of carotenoids often occur, manifesting as fruit coloring in appearance. Fruit color is one of the key factors determining fruit quality. This application found that the mutant fvnac073-6, obtained by knocking out FvNAC073, showed a decrease in anthocyanin content of 24.04% to 98.44% in fruits compared to the WT (whole-weighted) mutant. Furthermore, transcriptome analysis revealed significantly reduced expression of enzymes related to anthocyanin synthesis in the mutant, such as phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone-3-hydroxylase (F3H), dihydroflavonol reductase (DFR), anthocyanin synthase (ANS), and flavonoid 3-O-glycosyltransferase (UFGT). Overexpression of FvNAC073, however, resulted in an increase in anthocyanin content of 25% to 300% in fruits compared to the WT mutant. In summary, inhibiting or reducing FvNAC073 expression can suppress anthocyanin synthesis and accumulation, and delay strawberry fruit coloring; overexpression of FvNAC073 can promote anthocyanin synthesis and accumulation, and advance the coloring time and deepen the color of strawberry fruit.

[0039] Furthermore, fruit ripening refers to fruit softening, and fruit softening refers to a decrease in fruit firmness. Fruit softening is one of the important characteristics of ripening, directly affecting postharvest logistics, shelf life, and marketability. This application found that knocking out FvNAC073 resulted in a firmness 4-6 times higher than WT at 22 days. Simultaneously, the expression of enzymes related to cell wall loosening, cell wall degradation, and cell wall remodeling, all associated with strawberry fruit firmness, was decreased in the mutant. Conversely, overexpression of FvNAC073 reduced firmness by at least 61.82% compared to WT, and the expression of these enzymes was significantly increased in the mutant. In summary, inhibiting or reducing FvNAC073 expression can suppress strawberry fruit softening; overexpression of FvNAC073 can promote strawberry fruit softening.

[0040] Furthermore, fruit ripening refers to an increase in abscisic acid (ABA) content in the fruit. This application found that knocking out FvNAC073 significantly reduced ABA content in the fruit. Simultaneously, it was found that the expression of enzymes related to ABA synthesis, such as 9-cis-epoxycarotenoid dioxygenase (FvNCED5), was significantly downregulated, while the expression of enzymes related to ABA degradation, such as FvCYP707A4b and FvCYP707A4a, was significantly increased. Overexpression of FvNAC073 significantly increased ABA content in the fruit. In summary, inhibiting or reducing FvNAC073 expression can suppress the increase in ABA content in strawberry fruit; overexpression of FvNAC073 expression can promote the increase in ABA content in the fruit.

[0041] Furthermore, fruit development refers to the transverse diameter, longitudinal diameter, or weight of the fruit. This application found that knocking out FvNAC073 significantly reduced the transverse diameter, longitudinal diameter, and weight of the fruit; while overexpression of FvNAC073 significantly increased these parameters. In summary, inhibiting or reducing FvNAC073 expression suppresses strawberry fruit development; overexpression of FvNAC073 promotes fruit development.

[0042] In some embodiments, the regulator comprises an FvNAC073 promoter and an FvNAC073 inhibitor. In some embodiments, the regulator comprises, but is not limited to, nucleic acid molecules, carbohydrates, lipids, small molecule chemicals, antibody drugs, peptides, proteins, or interfering lentiviruses.

[0043] In some specific embodiments, the FvNAC073 promoter refers to a substance that can promote the transcription or translation of the FvNAC073 gene, or can promote the expression or activity of the FvNAC073 protein.

[0044] Furthermore, the promoter comprises a protein encoded by the FvNAC073 gene or biological material associated with the FvNAC073 gene, wherein the biological material is selected from one or both of recombinant expression vectors and engineered bacteria. The recombinant expression vector is formed by ligating FvNAC073 to a vector, and the engineered bacteria are obtained by transfecting a host with the recombinant expression vector. In one specific embodiment, the recombinant expression vector is obtained by ligating FvNAC073 to the starting plasmid pHB-YFP.

[0045] In some specific embodiments, the FvNAC07 inhibitor inhibits or reduces FvNAC07 expression to regulate strawberry fruit ripening or fruit development or to cultivate strawberries. For example, FvNAC07 can be partially inhibited, i.e., reducing FvNAC07 expression and / or function; or it can be completely inhibited, i.e., substantially eliminating FvNAC073 expression and / or its function.

[0046] In some specific embodiments, the inhibition or reduction of FvNAC07 expression can be achieved through gene knockout, gene silencing, or homologous recombination. Gene knockout refers to the inactivation of a specific target gene through alterations to the DNA sequence. This knockout includes knocking out the FvNAC073 gene using DNA homologous recombination technology, Cre / LoxP technology, or a CRISPR / Cas9 editing system. Gene silencing refers to the phenomenon of a gene not being expressed or being expressed at low levels without damaging the original DNA. Gene silencing can occur at two levels: one is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects; the other is post-transcriptional gene silencing, which is gene inactivation at the post-transcriptional level through specific inhibition of target RNA, including antisense RNA, co-suppression, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0047] Furthermore, the FvNAC073 inhibitor is selected from one or more of nucleic acid molecules, nucleic acid constructs, lentiviruses, adeno-associated viruses, gene editing systems, and genetically engineered bacteria.

[0048] Furthermore, the FvNAC073 inhibitor is a nucleic acid molecule that targets the FvNAC073 gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA. Preferably, the nucleic acid molecule is a specific sgRNA or a DNA molecule expressing the specific sgRNA, and its target sequence is shown in SEQ ID No. 2 or SEQ ID No. 3.

[0049] In other embodiments, the FvNAC073 inhibitor is a nucleic acid construct containing a nucleic acid molecule targeting the FvNAC073 gene, the sequence of which can be inserted into a vector to form a recombinant vector. The vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors well-known in the art. In short, any plasmid and vector can be used as long as it can replicate and remain stable in the host. The expression vector in this invention is not limited to the CRISPR / Cas9 vector mentioned in the following embodiments. Preferably, the nucleic acid construct is JH4-FvNAC073. A recombinant vector containing sgRNA is constructed using the sequences shown in SEQ ID No. 4 and SEQ ID No. 5.

[0050] In other embodiments, the FvNAC073 inhibitor is a gene editing system selected from one or more of the Cre-Loxp system, Flp-FRT system, Dre-ROX system, vCre-vloxp system, sCre-sloxp system, CRISPR / Cas9 system, CRISPR / Cas12 system, and CRISPR / Cas-derived single-base editing systems. Preferably, the gene editing system is a CRISPR / Cas9 system, specifically JH19-FvNAC073.

[0051] In some other embodiments, the FvNAC073 inhibitor is a genetically engineered bacterium, which is obtained by transfecting host cells with the aforementioned nucleic acid construct. The host cell may specifically be yeast, bacteria, algae, or fungi. The bacteria may be Gram-positive or Gram-negative. The Gram-negative bacteria may be *Escherichia coli* or *Agrobacterium*. Specifically, *Agrobacterium* may be *Agrobacterium GV3101*, and *Escherichia coli* may be *Agrobacterium JM109*.

[0052] Another aspect of the present invention provides a method for promoting strawberry fruit ripening or promoting strawberry fruit development, the method comprising one or both of the following steps:

[0053] 1) The FvNAC073 protein was introduced into strawberries to promote strawberry fruit ripening or development.

[0054] 2) Introduce biomaterials related to the FvNAC073 protein into strawberries to promote strawberry fruit ripening or development.

[0055] Another aspect of the present invention provides a method for delaying the ripening of strawberry fruit or inhibiting the development of strawberry fruit, the method comprising the following steps: reducing the expression level of FvNAC073 protein in strawberry to inhibit the ripening of strawberry fruit or inhibit the development of strawberry fruit.

[0056] Another aspect of the present invention provides a method for cultivating strawberries, the method comprising one or more of the following steps:

[0057] D1) Introduce the FvNAC073 protein to cultivate early-maturing or fruit-developing strawberries;

[0058] D2) Introduce biological materials associated with the FvNAC073 protein to cultivate early-maturing or larger-fruited strawberries;

[0059] D3) Reduce the expression level of FvNAC073 protein in strawberries to cultivate late-maturing or smaller strawberries.

[0060] In this invention, the expression level and / or activity of FvNAC073 protein can be reduced by homologous recombination, RNAi silencing, or CRISPR.

[0061] In one specific embodiment of the present invention, the recombinant expression vector JH19-FvNAC073 is transformed into strawberry via Agrobacterium-mediated transformation to prepare a strawberry mutant with FvNAC073 knocked out. The process includes the following steps: 1) transforming the recombinant expression vector JH19-FvNAC073 into Agrobacterium GV3101 to obtain recombinant bacteria GV3101 / JH19-FvNAC073; 2) co-culturing recombinant bacteria GV3101 / JH19-FvNAC073 with strawberry callus tissue. The co-culture process includes the following steps: strawberry callus tissue is soaked in a bacterial solution of recombinant bacteria GV3101 / JH19-FvNAC073 for infection, then transferred to a co-culture medium, then to a selection medium, and finally to a proliferation medium to obtain transgenic positive plants; PCR amplification and identification confirm that the nucleotide sequence of the target sequence has been altered, and strawberries whose target sequence has been altered and causes premature termination of the protein encoded by the FvNAC073 gene are identified as mutant strawberries.

[0062] In summary, this application systematically analyzed the regulatory mechanism of FvNAC073 in strawberry fruit ripening and development. This is beneficial for understanding the molecular mechanisms of strawberry fruit ripening and development, and also provides theoretical support for improving strawberry fruit quality through transgenic technology in production.

[0063] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0064] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0065] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0066] Example 1: Construction of a CRISPR-Cas9 vector targeting FvNAC073

[0067] In Example 1, an sgRNA targeting FvNAC073 was designed, and a CRISPR-Cas9 vector for knocking out FvNAC073 was constructed. This includes the following:

[0068] 1.1 Design of sgRNA

[0069] Two sgRNAs were designed on the second and third exons of FvNAC073 using CRISPR (https: / / crispr.dbcls.jp / ). The sequence of sgRNA1 is GATTTGCCGGGACTACCAGC (SEQ ID No. 2), and the sequence of sgRNA2 is GGCACAAAACGGGCAAGACA (SEQ ID No. 3).

[0070] The editing efficiency of these two sgRNAs was predicted using (http: / / crispr.dfci.harvard.edu / SSC / ). Using JH4 (details of the JH4 plasmid can be found in the literature Zhou et al., Plant Biotechnology Journal. (2018) 16, 1868–1877.) as a template, forward and reverse primers for introducing the two sgRNAs were designed as follows:

[0071] Forward primer FvNAC073-JH4-FP:

[0072] CTAGAGTCGAAGTAGTGATT GATTTGCCGGGACTACCAGC GTTTTAGAGCTAGAAAT AGC(SEQ IDNo.4)

[0073] Reverse primer FvNAC073-JH4-RP:

[0074] GCTATTTCTAGCTCTAAAAC GGCACAAAACGGGCAAGACA GAgCTATACTGCAATGTTCT(SEQ IDNo.5)

[0075] Note: The underlined bases in the primer sequences FvNAC073-JH4-FP and FvNAC073-JH4-RP are sgRNA1 and sgRNA2, respectively.

[0076] The PCR reaction system consisted of: 12.5 μL PrimeSTAR Max Premix, 0.5 μL each of primers FvNAC073-JH4-FP and FvNAC073-JH4-RP, 0.1 μL of JH4 plasmid, and finally, sterile distilled water to bring the total volume to 25 μL.

[0077] PCR reaction procedure: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles from denaturation to extension; 72℃ extension for 10 min, and storage at 25℃.

[0078] 1.2 Obtaining Linear Vectors

[0079] The JH4 vector was linearized using the SpeI restriction endonuclease. Using the linearized JH4 vector as a template, the JH4 vector backbone was amplified using JH4-FP and JH4-RP primers. The primers are as follows:

[0080] JH4-FP:GTTTTAGAGCTAGAAATAGCAA(SEQ ID No.6)

[0081] JH4-RP:AATCACTACTTCGACTCTAG(SEQ ID No.7)

[0082] The enzyme digestion reaction system was as follows: 5 μL of 10×Cutsmart buffer; 3 μL of JH4 plasmid (500 ng - 1 μg); 2 μL of SpeI restriction endonuclease; and finally, the volume was brought up to 50 μL with sterile water.

[0083] The enzyme digestion reaction can be carried out in a 37°C water bath for 2 hours.

[0084] The enzyme digestion product was purified using Tiangen Biotech's DNA product recovery kit. The specific steps can be followed according to the kit's instructions.

[0085] 1.3 Connection

[0086] The two fragments obtained in steps 1.1 and 1.2 were ligated using a recombinase. The ligation reaction was performed according to the instructions of the Novozymes ClonExpress II One Step Cloning Kit to construct the intermediate vector JH4-FvNAC073.

[0087] The ligation reaction system consisted of 7 μL of target double-stranded DNA fragment, 1 μL of T4 DNA ligase, 1 μL of 10×T4 DNA ligase buffer, and 1 μL of linearized JH4 plasmid.

[0088] The ligation reaction was carried out at 37°C for 1 hour to obtain the ligation product.

[0089] 1.4. Transformation into competent E. coli cells

[0090] The intermediate vector JH4-FvNAC073 obtained in step 1.3 was transformed into E. coli competent cells JM109 (Shanghai Weidi Biotechnology Co., Ltd.), plated on LB agar plates (containing 50 mg / L kanamycin), and incubated overnight at 37°C. Positive clones were identified by PCR after overnight incubation. The positive clones were then cultured in a shaking medium, and plasmids were extracted and sequenced to verify the sequence accuracy.

[0091] 1.5 Obtaining the recombinant vector

[0092] The intermediate vectors JH4-FvNAC073 and JH19 (for details on the JH19 plasmid, see Zhou et al., Plant Biotechnology Journal. (2018) 16, 1868–1877.) were ligated using gateway LR cloning enzyme. The resulting JH19-FvNAC073 recombinant vector was transformed into Agrobacterium competent cells GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1001) according to the manufacturer's instructions.

[0093] Example 2: Agrobacterium-mediated transformation of recombinant vector JH19-FvNAC073 into Ruegen strawberry.

[0094] In this Example 2, Agrobacterium GV3101 containing the recombinant vector JH19-FvNAC073 from Example 1 was used to infect strawberries.

[0095] Including the following:

[0096] 2.1 Preparation of Agrobacterium-containing bacterial solution

[0097] Agrobacterium GV3101 containing the JH19-FvNAC073 recombinant vector obtained in step 1.5 was streaked onto a plate containing rifampicin (50 mg / L) and kanamycin (50 mg / L) and cultured at 28°C for two days. Single colonies were collected and inoculated into 1 mL of liquid culture medium containing rifampicin (50 mg / L) and kanamycin (50 mg / L) and cultured at 28°C with shaking at 200 rpm for 24 h to obtain Agrobacterium bacterial suspension.

[0098] Take 100 μL of Agrobacterium bacterial suspension and inoculate it into 100 mL of YEP liquid medium containing kanamycin (50 mg / L) and rifampin (50 mg / L). Incubate overnight at 28°C until OD (outcome limit) is reached. 600 The concentration was brought to 0.5. Afterward, the mixture was centrifuged at 4000 rpm for 10 minutes, and the supernatant was discarded. The precipitate was then resuspended in buffer (MS + 2% sucrose + 100 μM acetylsalicylic acid) to obtain a resuspended bacterial culture. After activation at room temperature for 1 hour, the culture was used for transformation.

[0099] 2.2 Infection

[0100] Ruegen sterile seedlings (Ruegen, abbreviated as RG, used as the wild type of diploid forest strawberry) were cultivated on MS medium with 2% sucrose. When the sterile seedlings were 40 days old, tender green, thick, and fully unfolded strawberry leaves were cut off. Then, 3-4 horizontal cuts were quickly made on the back of each leaflet along the vertical vein. All the leaves to be transformed were collected and placed in tissue culture bottles containing buffer (MS + 2% sucrose + 100 μM acetylsyleugenone) for later use.

[0101] During infection, completely discard the buffer solution in the tissue culture flask containing the leaves, and add all the resuspended bacterial solution prepared in step 2.1 into the flask. Then, place the flask in a shaker at 28°C and 100 rpm for 30 minutes. After infection, pour out the bacterial solution and place the leaves on dry sterile filter paper to absorb as much of the bacterial solution as possible from the surface.

[0102] 2.3 Co-cultivation

[0103] After the bacterial solution was dried, the leaves were transferred to strawberry co-culture medium (MS + 20 g / L sucrose + 2.5 g / L plant gel + 4 mg / L LTDZ + 0.1 mg / L IBA + 100 μM acetylsyl syringone; pH = 5.8) and co-cultured in the dark for 3 days in a cycle of 23℃ for 16 h and 20℃ for 8 h.

[0104] 2.4 Screening and Culture

[0105] Strawberry leaves co-cultured for 3 days were transferred to strawberry selection medium (MS + 20 g / L sucrose + 2.5 g / L plant gel + 4 mg / L BA + 0.1 mg / L IBA + 4 mg / L hygromycin + 300 mg / L cephalosporin; pH = 5.8), ensuring full contact between the wounds and the selection medium. The leaves were cultured in a culture chamber under cyclical conditions of 23℃ for 16 h and 20℃ for 8 h until budding.

[0106] 2.5 Rooting Culture

[0107] After the callus tissue sprouts, it is peeled off from the callus and transferred to a rooting bottle (MS + 20 g / L sucrose + 2.5 g / L plant gel + 0.1 mg / L IBA + 4 mg / L hygromycin + 300 mg / L cephalosporin; pH = 5.8) for rooting culture to obtain the T0 generation line.

[0108] 2.6 Screening of transgenic positive lines

[0109] When the T0 generation lines grew to 8-9 leaves, DNA was extracted from young leaves. Identification primers were designed upstream and downstream of two sgRNAs targeting FvNAC073. The DNA fragments were amplified using these primers and then sequenced, yielding two heterozygous mutant lines. The primers are as follows;

[0110] NAC073-gRNA1-F:GATGAGGAAGAGGAAGAAGAG (SEQ ID No. 8)

[0111] NAC073-gRNA1-R:GAACTAATAAGCCAAGCACTAG (SEQ ID No. 9)

[0112] NAC073-gRNA2-F:TACTGGTATAGTGTGGTAGAC (SEQ ID No. 10)

[0113] NAC073-gRNA2-R:GAGGAAGAGGAAGAGGAATC (SEQ ID No. 11)

[0114] Seeds from these two lines were collected, and after planting the T1 generation lines, sequencing was performed again to identify two homozygous independent mutant lines, fvnac073-6 and fvnac073-9.

[0115] Example 3: Fruit development was inhibited and fruit ripening time was delayed in the fvnac073 mutant.

[0116] In Example 3, the fruit phenotype, fruit weight, fruit ripening anthocyanin content, ABA content, and firmness of the mutant lines fvnac073-6 and fvnac073-9 obtained in Example 3 were investigated. This included the following:

[0117] 3.1 Examination of fruit phenotypes at different stages

[0118] Fruit phenotypic monitoring was conducted at 11, 16, 21, 22, 24, 25, and 28 days after flowering. Results are shown below. Figure 2 A.

[0119] from Figure 2 As shown in Figure A, the wild-type WT fruit begins to turn reddish at 21 days, reaches full ripeness at 25 days, and begins to lose water at 28 days; the mutant fvnac073-6 begins to turn reddish at 24 days; and the mutant fvnac073-9 begins to turn reddish at 22 days. Compared to the ripe fruit of Ruegen, the ripe fruit of fvnac073-6 and fvnac073-9 is light red.

[0120] 3.2 Examination of fruit phenotypes at different stages

[0121] Existing research divides strawberry fruit growth into five stages: Small White, Big White, Pre-turning (white skin, red seed coat), Turning (skin begins to turn red), and Ripening (skin is completely red). Between the Pre-turning and Ripening stages, the strawberry fruit begins to soften and continues to soften as its color changes.

[0122] Ten fruits from WT, fvnac073-6, and fvnac073-9 were compared and analyzed 11-26 days after flowering, and the percentage of fruits at the five growth stages was calculated.

[0123] from Figure 2 According to B, on the 25th day after flowering, all Rugen fruits were already in the rinsing stage; while only 20% of fvnac073-6 fruits were in the rinsing stage, and all fvnac073-9 fruits were in the pre-turning and turning stages.

[0124] from Figure 2 As shown in Figure B, on the 28th day after flowering, all Rugen fruits were already overripe, showing signs of water loss and senescence; while at this time, fvnac073-6 and fvnac073-9 fruits were in the ripening stage.

[0125] 3.3 Examination of fruit weight

[0126] Strawberries were harvested 28 days later, and each strawberry was weighed. The results are shown in the table below. Figure 2 C.

[0127] from Figure 2 As shown in the middle C, compared with wild-type strawberry WT, inhibiting FvNAC073 expression resulted in a 26.52% to 41.77% reduction in strawberry fruit weight.

[0128] 3.4 Examination of the transverse and longitudinal diameters of the fruit

[0129] Strawberries were harvested on day 28. The transverse and longitudinal diameters of individual strawberries were measured using vernier calipers. The results are shown in the table below. Figure 2 D and E in the middle.

[0130] from Figure 2 As shown in D and E, the transverse and longitudinal diameters of the fvnac073 mutant are significantly smaller than those of WT.

[0131] 3.5 Determination of anthocyanin, ABA content, and hardness

[0132] 1) ABA content determination

[0133] Since ABA is the main plant hormone regulating strawberry fruit ripening, it can increase the activity of cellulase and other enzymes, leading to cell wall disintegration and accelerating the ripening and softening process of the fruit. The ABA content of wild-type WT and fvnac073 mutant fruits was measured after harvesting, and the results are shown below. Figure 3 C.

[0134] The assay method was as follows: 0.1 g of fruit pulp was weighed and placed in a 2 mL sterile centrifuge tube. Sterile steel beads were added, and the mixture was rapidly frozen in liquid nitrogen and thoroughly ground. 1 mL of ethyl acetate extract was added. The mixture was thoroughly mixed for 10 min, centrifuged at 10,000 rpm for 5 min at 4°C, and the supernatant was transferred to a new centrifuge tube. The organic phase in the centrifuge tube was dried using a nitrogen blower, and 200 μL of 50% methanol solution was added and thoroughly mixed. After centrifugation at 10,000 rpm for 5 min, the supernatant was absorbed using a 1 mL syringe and filtered through a 0.22 μm organic filter into a liquid injection bottle. The detection of endogenous plant hormones was performed using an LC3000 semi-preparative isobaric high-performance liquid chromatography system (CXTH, BJ, CHN). UV detectors (CXTH, BJ, CHN) and Capecell PAK C18 columns (4.6 mm × 100 mm, 1.8 μm) were installed, and the flow rate was 0.8 mL / min. The elution program was set as follows: 0-4 min, 20% A, 80% B; 4-8 min, 50% A, 50% B; 8-20 min, 80% A, 20% B; 20-22 min, 80% A, 20% B; 22-22.2 min, 20% A, 80% B. Mobile phases A (0.06% acetic acid-water) and B (0.06% acetic acid-methanol) were used, with an injection volume of 20 μL. The UV wavelength was 254 nm, and the column temperature was 40 °C. All chromatographic reagents were purchased from ANPEL (SHH, CHN).

[0135] from Figure 3 As shown in Figure C, the ABA content in the fruit of the fvnac073 mutant strain was significantly lower than that in the wild-type strawberry WT.

[0136] 2) Anthocyanin content determination

[0137] In the early stages of strawberry fruit development, anthocyanin content is minimal or undetectable, but gradually increases as the fruit matures. The anthocyanin content of wild-type WT and fvnac073 mutant fruits was determined after harvesting, and the results are shown below. Figure 3 A.

[0138] Assay method: Approximately 0.2 g of fruit pulp was ground in liquid nitrogen, and 600 μL of 1% HCl (v / v, diluted with methanol) was added. The mixture was extracted in the dark at 4°C for 12 hours. 400 μL of ddH₂O and 1 mL of chloroform were added to the extract and vortexed. After centrifugation for 5 min, the upper aqueous phase was separated, and the absorbance was measured at 530 nm and 657 nm.

[0139] The anthocyanin content is calculated as: (A530-A657) / FW, where FW is the fresh weight of the strawberry fruit. Three biological replicates were performed.

[0140] from Figure 3As shown in Figure A, after measuring the anthocyanin content of fruits 22 days after flowering and at maturity, it was found that the anthocyanin content in the fruits of mutant fvnac073-6 was 98.70% and 24.04% lower than that in wild-type strawberry (WT) fruits at the same time point, respectively. Similarly, the anthocyanin content in the fruits of mutant fvnac073-9 was 99.44% and 26.87% lower than that in wild-type strawberry (WT) fruits at the same time point, respectively. This indicates that inhibiting FvNAC073 can reduce anthocyanin content and delay fruit coloring in strawberries.

[0141] 3) Hardness Measurement

[0142] The degree of ripening and softening of fruit is mainly reflected by its firmness. Fruit firmness depends primarily on the tension of the fruit's cells and the integrity of their cell walls, with the content and form of cellulose and pectin, which constitute the cell walls, playing a crucial role. Studies have found that as strawberry fruit ripens, the soluble pectin content continuously increases, and the fruit firmness decreases, gradually softening.

[0143] Fruit firmness is an important indicator of fruit maturity and storage quality. Fruit firmness gradually decreases during ripening and senescence. The firmness of wild-type WT and fvnac073 mutant fruits was measured after harvest. The results are shown below. Figure 3 B.

[0144] Measurement: Fruit firmness was measured using a GY5AB fruit firmness tester. Five biological replicates were performed.

[0145] from Figure 3 As shown in B, fruit softening was significantly inhibited in mutants fvnac073-6 and fvnac073-9, and their fruit firmness at 22 days was 4-6 times higher than that of wild-type strawberry WT.

[0146] Example 4: Changes in fruit ripening-related genes in the fvnac073 mutant

[0147] To identify genes regulated by FvNAC073 transcription during fruit development and ripening, we performed transcriptome analysis using RNA-seq on 22-day-old WT and fvnac073-9 mutant fruits (Shanghai Paisenno Biotechnology Co., Ltd.).

[0148] Since the anthocyanin content in the fruit of the fvnac073 mutant was significantly reduced, we first focused on genes related to anthocyanin synthesis and degradation.

[0149] Anthocyanins are synthesized by a series of enzymes, including phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone-3-hydroxylase (F3H), dihydroflavonol reductase (DFR), anthocyanin synthase (ANS), and flavonoid 3-o-glycosyltransferase (UFGT).

[0150] from Figure 4 As shown in section A, the expression of FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, and FvUFGT was significantly reduced in the fvnac073 mutant, indicating that anthocyanin synthesis was inhibited, which is consistent with the results of step 3.5 in section 2.

[0151] ABA is the main plant hormone controlling strawberry fruit ripening, and the ABA content in the mutant fvnac073 is significantly reduced. NCED is a key catalytic enzyme in abscisic acid synthesis, catalyzing the conversion of zeaxanthin or neoxanthin into xanthocyanin, which is then rapidly metabolized into abscisic acid. CYP707A is a key catalytic enzyme in abscisic acid degradation, degrading abscisic acid to safflower tannic acid. Reduced abscisic acid content delays fruit ripening and softening, mainly manifested as increased fruit firmness and decreased expression of cell wall degradation-related genes.

[0152] from Figure 4 As shown in Figure B, transcriptome analysis revealed that the gene encoding 9-cis-epoxycarotenoid dioxygenase (FvNCED5), the rate-limiting enzyme in ABA biosynthesis inactivation, was significantly downregulated in the fvnac073 mutant fruit. The expression of ABA inactivation enzyme genes FvCYP707A4b and FvCYP707A4a was significantly increased.

[0153] In addition, some genes involved in ABA signaling also showed differential expression, including protein phosphatases (FvPP2C1, FvPP2C6, FvPP2C10), FvSnRK2.8a, and FvSnRK2.6 protein kinases.

[0154] Example 5: Changes in genes related to cell wall development and degradation in the fvnac073 mutant.

[0155] Fruit softening is an important characteristic of ripening. This softening is mainly related to cell wall structure, which primarily consists of cellulose, pectin, and hemicellulose, as well as some proteins. Currently identified cell wall metabolism-related enzymes and proteins associated with fruit softening include pectate lyase (PL), polygalacturonase (PG), xyloglucan endotransglucosylase / hydrolase (XTH), and expansion protein (EXP).

[0156] PL acts on pectin substances through β-transfer and elimination mechanisms, randomly cleaving β-1,4-galacturonic acid residues in the pectin layer and primary cell walls of higher plants. Its main function is to participate in the cleavage of pectin structure during fruit ripening to achieve fruit softening. PG catalyzes the cleavage of 1,4-2-D-galactosidic bonds in pectin molecules, leading to cell wall disintegration and fruit softening. XTH promotes plant cell wall elongation. EXP is a class of non-enzymatic cell wall active proteins that can relax plant cell walls. The development and decreased firmness of strawberry fruits are related to the activity of enzymes involved in cell wall loosening, degradation, and remodeling. The expression analysis results of cell wall-related genes are shown in […]. Figure 5 The analytical method used was quantitative real-time PCR, the same as in Example 7.

[0157] from Figure 5 It was found that the expression of cell wall degradation genes (polygalacturonases FvPG1, FvPG2; pectin lyases FvPL1, FvPL2), cell wall remodeling genes (xyloglucan endoglucosyltransferases / hydrolases FvXTH2, FvXTH3), and cell wall loosening genes (FvEXP2, FvEXP3) was significantly reduced in the fvnac073 mutant. Figure 5 ).

[0158] Decreased expression of cell wall degradation genes indicates that FvNAC073 can inhibit cell wall expansion; decreased expression of cell wall remodeling genes indicates that FvNAC073 can inhibit cell wall expansion; decreased expression of extensin genes indicates that FvNAC073 can relax the cell wall. In summary, inhibiting FvNAC073 can inhibit cell wall expansion and extension, while relaxing the cell wall, thus resulting in smaller fruit and delayed softening in the fvnac073 mutant.

[0159] Example 6: Investigation of the effect of FvNAC073 overexpression on strawberry ripening and development

[0160] In this embodiment, the overexpression vector pHB-FvNAC073-YFP from CN202210932778 was transiently injected into Ruegen strawberry fruits. The strawberry fruits overexpressing FvNAC073 were photographed and observed, and physiological indicators were detected, including the following:

[0161] 6.1 Instantaneous injection of strawberry fruit

[0162] Overexpression experimental group (FvNAC073-OE): Agrobacterium strain containing the overexpression vector pHB-FvNAC073-YFP was activated and added to liquid YEP medium containing 50 mg / L Rif (rifampicin) and 50 mg / L Kan (kanamycin). The mixture was shaken vigorously until OD600 = 0.6-0.8, and the cells were collected by centrifugation at 4000 rpm for 10 min at room temperature. The cells were resuspended in infection buffer (MS medium + 2% sucrose) containing 100 pMAS and activated at 28℃ for 1 h to obtain the infection solution containing the overexpression vector pHB-FvNAC073-YFP.

[0163] Select Ruegen strawberries with similar growing environments and developmental stages for instantaneous injection. Specifically, insert the tip of a 1mL syringe needle into the fruit from the base of the stem and slowly inject the infecting bacterial solution into the strawberry until the entire fruit appears macerated. Mark the strawberry as FvNAC073-OE.

[0164] At the same time, a negative control group (EV-OE) was set up. The negative control group (EV-OE) was a strawberry that was injected into strawberries using the same construction method and Agrobacterium-mediated transformation method as the overexpression vector pHB-FvNAC073-YFP. The strawberry was then labeled as EV-OE.

[0165] 6.2 Phenotypic Investigation at Different Days After Injection

[0166] Fruit phenotypic monitoring was conducted at 1, 3, 5, and 7 days post-injection. Results are shown in [Figure number missing]. Figure 6 A.

[0167] from Figure 6 As shown in Figure A, FvNAC073-OE began to color at 3 days and the fruit turned completely red at 5 days, indicating that overexpression of FvNAC073-OE can promote the ripening of strawberry fruit.

[0168] 6.3 Examination of the transverse and longitudinal diameters of the fruit

[0169] Five and seven days after injection, the horizontal and vertical diameters of individual strawberries were measured using vernier calipers. The results are shown below. Figure 6B and C.

[0170] from Figure 6 As shown in Figures B and C, at 5 and 7 days post-injection, the transverse and longitudinal diameters of FvNAC073-OE were significantly larger than those of EV-OE.

[0171] 6.4 Examination of Fruit Weight

[0172] Strawberries were harvested 5 and 7 days after injection, and each strawberry was weighed. The results are shown below. Figure 6 D.

[0173] from Figure 6 As shown in the data from D, compared with EV-OE, overexpression of FvNAC073 resulted in an increase of 79.12% and 31.01% in strawberry fruit weight at 5 days and 7 days, respectively.

[0174] 6.5 Determination of anthocyanins and hardness

[0175] 1) Hardness Measurement

[0176] Fruit firmness was measured 5 and 7 days after injection, and the results are shown below. Figure 6 E in Chinese.

[0177] from Figure 6 As shown in the study, 5 days after injection, the fruit of FvNAC073-OE softened significantly earlier, and its fruit firmness was 61.82% lower than that of EV-OE 5 days after injection.

[0178] 2) Anthocyanin content determination

[0179] from Figure 6 As shown in the results, after measuring the anthocyanin content of the fruit 5 and 7 days after injection, it was found that the anthocyanin content in FvNAC073-OE increased by more than 3 times and 25.38% respectively compared with the fruit of EV-OE at the same time. This indicates that overexpression of FvNAC073 can increase anthocyanin content and promote the coloring of strawberry fruit.

[0180] Overall, FvNAC073 overexpression promotes the development of the transverse and longitudinal diameters of strawberries, increases fruit weight, accelerates softening, increases anthocyanin content, advances coloring time and deepens color, and promotes the ripening and development of strawberries.

[0181] Example 7: Investigation of ripening-related genes in fruit after FvNAC073 overexpression

[0182] In Example 7, the expression of genes related to ripening was analyzed by real-time quantitative PCR of the strawberry overexpressing FvNAC073 obtained in Example 6.

[0183] 7.1 RNA Extraction

[0184] The total RNA from FvNAC073-OE and EV-OE fruits was extracted 5 days after injection using the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit, for a total of 5 biological replicates.

[0185] 7.2 Obtaining cDNA

[0186] Using the obtained total RNA as a template, cDNA was obtained by reverse transcription according to the instructions of the full-length gold cDNA synthesis kit.

[0187] 7.3 Quantitative Real-Time PCR Analysis

[0188] Specific primers were designed to analyze the relative expression levels of genes related to fruit ripening and cell wall function in strawberry fruits. The primers are shown in Table 1 below.

[0189] Table 1

[0190]

[0191]

[0192] Quantitative fluorescence analysis: Using the cDNA synthesized in step 7.2 as a template, quantitative fluorescence PCR analysis was performed using the specific primers listed in Table 1. The real-time PCR reaction was performed on a BIO-RAD Chromo 4 real-time quantitative analyzer.

[0193] The reaction system consisted of 20 μL of material, and a three-step reaction was performed: denaturation at 94℃ for 20 s, followed by 36 cycles: 94℃ for 15 s; 58℃ for 15 s; and 72℃ for 25 s. The expression results of genes related to fruit ripening and cell wall function are shown below. Figure 7 .

[0194] from Figure 7 It can be seen that the expression of FvPAL2, FvCHS, FvCHI, FvF3H, FvDFR2, FvANS, FvUFGT, and FvMYB10 in FvNAC073-OE is significantly increased, indicating that overexpression of FvNAC073 can promote the increase of anthocyanin synthesis, which is consistent with the results in Example 4.

[0195] The expression of cell wall degradation genes FvPG1, FvPG2, FvPL1, and FvPL2, cell wall remodeling genes FvXTH2 and FvXTH3, and cell wall loosening genes FvEXP2 and FvEXP3 were all significantly increased in FvNAC073-OE. Figure 7 This indicates that FvNAC073 can promote cell wall expansion and extension, while also relaxing the cell wall, resulting in larger FvNAC073-OE fruits and earlier softening.

[0196] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. FvNAC073 The use of genes or their encoded proteins as targets in screening products that regulate strawberry ripening or strawberry fruit development, said FvNAC073 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. The regulation of strawberry ripening or strawberry fruit development is achieved by inhibiting or reducing the... FvNAC073 Gene expression is achieved; fruit ripening refers to fruit softening, fruit coloring, or an increase in abscisic acid content in the fruit; fruit development refers to the transverse diameter, longitudinal diameter, or weight of the fruit.

2. FvNAC073 Use of the gene or the protein it encodes in at least one of A1)-A2): A1) Regulate strawberry fruit ripening, wherein fruit ripening refers to fruit softening, fruit coloring, or an increase in abscisic acid content in the fruit; A2) Regulate strawberry fruit development, where fruit development refers to the transverse diameter, longitudinal diameter, or weight of the fruit; overexpression FvNAC073 To promote the ripening or development of strawberry fruits; Knockout FvNAC073 This inhibits the ripening or development of strawberry fruits. The FvNAC073 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The use as described in claim 2, characterized in that, The knockout FvNAC073 The regulator is FvNAC073 Inhibitors FvNAC073 Inhibitors are substances that can inhibit FvNAC073 Gene transcription or translation may be inhibited. FvNAC073 The substance that expresses or activates a protein; the overexpression FvNAC073 The regulator is FvNAC073 Accelerator, the FvNAC073 Accelerators are substances that can promote FvNAC073 Gene transcription or translation may promote FvNAC073 The substance that expresses or activates proteins.

4. The use as described in claim 3, characterized in that, The accelerator is selected from FvNAC073 The gene-encoded protein or related to the FvNAC073 Gene-related biological materials, wherein the biological materials are selected from one or both of recombinant expression vectors or bioengineered bacteria; And / or, the FvNAC073 The inhibitor is selected from one or more of nucleic acid molecules, nucleic acid constructs, lentiviruses, adeno-associated viruses, gene editing systems, and genetically engineered bacteria.

5. The use as described in claim 4, characterized in that, The FvNAC073 Inhibitors include at least one of the following: 1) The above FvNAC073 The inhibitor is a nucleic acid molecule, and the target sequence of the nucleic acid molecule is shown in SEQ ID No. 2 or SEQ ID No. 3; 2) The above FvNAC073 The inhibitor is a gene editing system, which comprises the nucleic acid molecule described in 1); 3) The above FvNAC073 The inhibitor is a genetically engineered bacterium, which contains the nucleic acid molecule described in 1) or is obtained by transfecting a host with the gene editing system described in 2).

6. A method for promoting strawberry fruit ripening or development, characterized in that, The method includes one or both of the following steps: 1) Import into strawberry FvNAC073 Genes that promote strawberry ripening or strawberry development; 2) Import the above into strawberry. FvNAC073 Gene-related biological materials for promoting strawberry fruit ripening or development, wherein the biological materials are selected from one or both of recombinant expression vectors or bioengineered bacteria; The FvNAC073 The nucleotide sequence of the gene is shown in SEQ ID NO.1; Fruit ripening refers to fruit softening, fruit coloring, or an increase in abscisic acid content in the fruit. Fruit development refers to the transverse diameter, longitudinal diameter, or weight of the fruit.

7. A method for delaying strawberry fruit ripening or inhibiting strawberry fruit development, characterized in that, The method includes the following steps: reducing the concentration of [unclear text - likely referring to a specific substance or process] in strawberries. FvNAC073 The expression level of genes is used to inhibit strawberry fruit ripening or inhibit strawberry fruit development; FvNAC073 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the fruit ripening refers to the softening of the fruit, the coloring of the fruit, or the increase of abscisic acid content in the fruit; the fruit development refers to the transverse diameter, longitudinal diameter, or weight of the fruit.

Citation Information

Patent Citations

  • A FvNAC073 protein and its encoding gene and use

    CN115960188B

  • FvNAC073 protein as well as coding gene and application thereof

    CN115960188A