Application of Genetic Markers Associated with Chest Width Trait in RNASEH2B Gene in Chicken Genetic Breeding
The RNASEH2B gene marker CB_marker1 facilitates early selection in chicken breeding, addressing the genetic complexity of chest width to produce high-quality breeds with enhanced breast width.
Patent Information
- Application Number
- CN202411372137.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-29
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2044-09-29
AI Technical Summary
The prior art is difficult to effectively improve the breast wide traits of chickens through conventional breeding methods, making it difficult to cultivate large breast wide old hens that meet market demand.
The genetic marker CB_marker1, which is associated with the chest width trait in the RNASEH2B gene, was used to detect the genotype of the chicken to be tested for early selection, and PCR amplification and sequencing were used for primers Pr_cb1f and Pr_cb1r to determine the genotype for genetic breeding.
It improves the breast width trait of chickens, genetically improves breast width, and obtains high-quality laying hen breeds to meet consumer needs.
Smart Images
Figure CN119372325B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of chicken genetic breeding and biotechnology, and particularly relates to the application of a genetic marker associated with a chest width trait in an RNASEH2B gene in chicken genetic breeding. Background Art
[0002] Chest width is a commonly used indicator for broiler breeding. A large chest width means an increase in the attachment area of the breast muscles, which also means an increase in the weight of the breast muscles. In order to meet the market demand for old hens with large chest width, it is urgent to conduct research on the genetic structure of chest width in order to cultivate high-quality old hens for production of suitable varieties. Chest width is a quantitative trait that is affected by both genetics and the environment. In recent years, the GWAS method has been extended to the genetic analysis of quantitative traits in poultry, mainly used for the study of egg production, body weight, feed utilization efficiency and egg quality. There is no research literature that uses the GWAS method to analyze the genetic laws of breast width in laying hens. The chest width trait is regulated by micro-effect polygenes, and conventional breeding methods are difficult to make effective progress genetically. The only way is to clarify the genetic structure of chest width and improve its breeding accuracy through genomic selection to obtain new chicken breeds or matching lines that can produce large chest widths to meet consumer demand. Summary of the invention
[0003] In order to obtain old hens with excellent chest width trait, the present invention provides the application of genetic markers associated with the chest width trait in RNASEH2B gene in chicken genetic breeding. The genetic markers associated with the chest width trait in the RNASEH2B gene help to genetically improve the chest width. Applying them to chicken genetic breeding is beneficial to improving the chest width and obtaining high-quality laying hen varieties.
[0004] The present invention is achieved through the following technical solutions:
[0005] The invention provides an application of a genetic marker associated with a chest width trait in an RNASEH2B gene in chicken genetic breeding. The genetic marker associated with a chest width trait in the RNASEH2B gene comprises CB_marker1, and the CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGa lGa l 1.mat.broi ler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of the gene RNASEH2B, where the base is G or A.
[0006] Based on the same inventive concept, the present invention provides an early selection method for chicken breast width trait, the early selection method comprising performing early selection on chicken breast width trait based on the genotype of genetic marker CB_marker1;
[0007] The CB_marker1 corresponds to the physical position at the 169817100th site on chromosome 1 of the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belonging to the 9th intron sequence of the gene RNASEH2B, where the base is G or A.
[0008] Further, the early selection method specifically includes:
[0009] Detecting the genotype of CB_marker1 in the genome of the chicken to be tested;
[0010] Based on the genotype of the CB_marker1, early selection is performed on the chest width trait of the chicken to be tested;
[0011] Among them, the chest width of individuals with the GG genotype of the CB_marker1 is greater than that of individuals with the GA genotype, and the chest width of individuals with the GA genotype is greater than that of individuals with the AA genotype.
[0012] Further, detecting the genotype of CB_marker1 in the genome of the chicken to be tested specifically includes:
[0013] Using Pr_cb1 f and Pr_cb1 r as primers, performing PCR amplification on the genomic DNA of the chicken to be tested;
[0014] Sequencing the PCR amplification product to obtain the genotype at the 169817100th site on the sense strand of chromosome 1 of the chicken to be tested;
[0015] Among them, the nucleotide sequence of the Pr_cb1 f is as shown in SEQ ID NO.1, and the nucleotide sequence of the Pr_cb1 r is as shown in SEQ ID NO.2.
[0016] Further, the breeds of the chickens to be tested include Dongxiang Green-shelled Chickens and / or White Leghorns.
[0017] Based on the same inventive concept, the present invention provides primers for detecting the genetic marker CB_marker1, the primers include Pr_cb1 f and Pr_cb1 r, the nucleotide sequence of the Pr_cb1 f is as shown in SEQ ID NO.1, and the nucleotide sequence of the Pr_cb1 r is as shown in SEQ ID NO.2;
[0018] The CB_marker1 corresponds to the physical position at the 169817100th site on chromosome 1 of the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belonging to the 9th intron sequence of the gene RNASEH2B, where the base is G or A.
[0019] Based on the same inventive concept, the present invention provides the application of primers for detecting genetic marker CB_marker1 in chicken genetic breeding.
[0020] Based on the same inventive concept, the present invention provides a kit, which contains the above-mentioned primers for detecting genetic marker CB_marker1.
[0021] Based on the same inventive concept, the present invention provides the application of the above-mentioned kit in chicken genetic breeding.
[0022] Based on the same inventive concept, the present invention provides the application of genetic marker CB_marker1 in predicting the breast width at 40 weeks of age in chickens. The CB_marker1 corresponds to the physical position of the 169817100th site on chromosome 1 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of the gene RNASEH2B, where the base is G or A.
[0023] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:
[0024] The application of the genetic marker associated with the breast width trait in the RNASEH2B gene of the present invention in chicken genetic breeding. The genetic marker associated with the breast width trait in the RNASEH2B gene is CB_marker1. The individuals with the dominant genotype (GG) of CB_marker1 have a higher breast width at 40 weeks of age. Applying it to chicken genetic breeding helps to genetically improve the breast width, and then obtain laying hen breeds with a high breast width, meeting the needs of consumers for high-quality old hens. Description of the Drawings
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0026] Figure 1 It is the Manhattan plot of the breast width GWAS analysis of the resource population in Example 2 of the present invention;
[0027] Figure 2 It is the QQ plot of the breast width GWAS analysis of the resource population in Example 2 of the present invention;
[0028] Figure 3 It is the box plot of the breast width of individuals with different genotypes in Example 3 of the present invention. Detailed Embodiments
[0029] The present invention will be specifically described below in combination with specific embodiments and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present invention, rather than limiting the present invention.
[0030] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which the present invention pertains. In case of contradiction, this specification shall prevail.
[0031] Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment, etc. used in the present invention can be obtained through market purchase or can be prepared by existing methods.
[0032] The application of genetic markers associated with chest width traits in the RNASEH2B gene of the present application in chicken genetic breeding will be described in detail below in combination with examples and experimental data.
[0033] Example 1
[0034] Construction of resource population
[0035] According to the F2 design, a laying hen resource population was constructed, using Dongxiang Green-shell laying hens and White Leghorns as parents, and the F1 and F2 generations were obtained through reciprocal crosses. The experimental chickens were raised individually in a fully enclosed chicken house, with 16 hours of artificial supplementary lighting during the laying period, and cooled by fans and wet curtains. Routine immunization was carried out according to the immunization program formulated by the Jiangsu Institute of Poultry Science. The feed was from COFCO, and the feed components for laying hens included 16.5% crude protein and 11511 kJ / kg of feed metabolic energy. During the laying period, the chickens had free access to food, were supplied with water through nipple drinkers, were fed with a traveling feeder, and the chicken manure was removed by a chicken manure conveyor belt. At 40 weeks of age, the chest width was measured with an electronic vernier caliper.
[0036] After preliminary screening of the chest width data, removing obvious errors and duplicate data, and then removing outliers, the data was organized into an excel table form. After data cleaning, the chest width data set of the F2 generation of the resource population remained 1512 records. Using IBM SPSS 21.0 software, through QQ plot observation, kurtosis and skewness statistics, and Kolmogorov-Smirnov test, it was determined that the chest width data distribution was basically not skewed and could be used for the next GWAS analysis and to analyze its genetic structure.
[0037] Example 2
[0038] GWAS analysis of chest width at 40 weeks of age
[0039] The experimental chickens were from the laying hen resource population constructed in Example 1. About 0.5 ml of blood samples were collected from the wing veins of the experimental chickens and placed into BD anticoagulant tubes (BD Medical Devices (Suzhou) Co., Ltd.) and stored at -70°C. Genomic DNA was extracted by the phenol-chloroform method. After detection by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometry, the DNA samples were diluted to 50±5 ng / μl after passing the tests, and were used for genotyping with gene chips.
[0040] GeneChip of Affymetrix company was used for genotyping with 600K Chicken Genotyping Array. Quality control of the data was carried out with reference to the chip instruction manual, mainly including: quality control before genotyping using APT software; quality control using PLINK, removing SNPs with a detection rate lower than 0.97 and eliminating SNP markers deviating from the Hardy-Weinberg equilibrium; screening SNPs with metrics.R, SNP_filter.R and SNP, CR, FLD information analysis; and genotype imputation using BEAGLE. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.
[0041] Before performing the genome-wide association study (GWAS), multi-dimensional principal component analysis was first carried out to eliminate false positives and population structure. The first five principal components were used as covariate parameters and added to the genetic model, and the chicken house effect was placed into the fixed effect of the model. The "simpleM" method in the R script was used to calculate the independent test estimates for each SNPs locus, and 59,308 independent markers were obtained. After multiple corrections, the genome-wide significant threshold was 8.43×10- 7 and the genome-wide suggestive threshold was 1.69×10- 5 . The mixed linear model was used to analyze the chest width at 40 weeks of age of the eggs, and the P values of the significance tests for each SNPs marker were obtained. The matrix expression of the linear model was
[0042] y = Wα + xβ + Gu + ε
[0043] where y represents the vector of sample phenotypic values; W represents the covariance matrix; α is the intercept vector; x is the genotype vector of the marker, β is the effect value of the marker; G is the genetic relationship matrix constructed based on the chip, u is the random effect vector (here it is the breeding value); and ε is the residual.
[0044] After screening by GWAS, CB_marker1 associated with the chest width at 40 weeks of age was obtained (Table 1). Genome-wide association analysis was carried out on the chest width at 40 weeks of age of 1,512 chickens, and the results were as Figure 1 、 Figure 2 shown. As Figure 1(Manhattan plot) It can be seen that there are genomic significant level markers on chicken chromosome 1, and there are 255 SNPs around it exceeding the genomic significant level, which can be used as evidence to support CB_marker1. The QQ plot further verifies the reliability of the GWAS results. From Figure 2 (QQ plot) It can be seen that the vast majority of SNPs that do not deviate from the diagonal are affected by genetic drift, and the SNPs located at the tail of the QQ plot are affected by artificial selection. After calculation, the inflation coefficient is 0.987, indicating that there is no obvious population stratification in the chest width trait of the resource population. Analyzing genetic parameters with the pedigree genetic relationship matrix, the heritability of chest width at 40 weeks of age is 0.342 ± 0.038, and the CB_marker1 genetic marker can explain 5.8% of the phenotypic variance.
[0045] Table 1 CB_marker1 genetic markers related to chest width
[0046]
[0047] Among them: The physical position of the marked chromosome refers to the chicken whole genome (bGa l Ga l 1.mat.bro i ler.GRCg7b).
[0048] Example 3
[0049] Detection and verification of genetic markers
[0050] Perform candidate gene association analysis on the Dongxiang blue-shelled egg chicken - White Leghorn chicken resource population using the above SNP genetic markers. The specific operation steps are as follows:
[0051] 1) PCR primers: Download the DNA template sequence information from the NCBI website, design PCR amplification primers with the primer premier 6.0 software, and the primer information is shown in Table 2. The PCR primers are synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0052] Table 2 Amplification primers used to detect the genetic markers of chicken chest width at 40 weeks of age
[0053]
[0054] 2) Genomic DNA extraction: Extract genomic DNA from 1512 blood samples by the phenol-chloroform method. After being qualified by ultraviolet spectrophotometer detection and agarose gel electrophoresis detection, perform PCR amplification.
[0055] 3) PCR amplification process:
[0056] ① Reaction system: The 10 μl system includes 50 ng of the DNA template of the identification material, 10 ng each of the forward and reverse primers, 5 μL of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.
[0057] ② Reaction procedure: First, denature at 94°C for 30 s, anneal at 53.5°C for 30 s, extend at 72°C for 30 s, for a total of 5 cycles; then denature at 94°C for 30 s, anneal at 53.5°C for 30 s, extend at 72°C for 30 s, for a total of 30 cycles; extend at 72°C for 5 min and store at 4°C.
[0058] 4) The amplified product is sent to a sequencing company for sequence polymorphism detection.
[0059] The sequence of the amplified fragment is shown as follows:
[0060] >CB_marker1
[0061] ATGCCATTGATCTTGTGTTGTAATCTTCATACTGTCCAGTTTGTCAGCACAGGGAGTCTGGCCATTGGCCAATG ATAAGACAGCTTACAAAGA[A / G]TATGTGTGCTCTACTACAGCTGAAGAGCAAATACTTTGCTGAAATGCAAACATT GTATTATAAGTTTTAAAAATTTGTTTATCAGATTCCAAAGAGAGAAGAATAGTAATTATTCATTAGATTGTCATTTGAAAATGTAATCACAGCTCAGTCAACAGCCTCCCGGAGAGTCTGATCCAGATACCATTGAAATCAAAAAAAGAAGGCTGCTGTTGGATCTGGTTCTAAGAGCTGAGAAATCTAAGCTGCAGACCTGGTTTCAGTGCCAGAGAAAGCGGGGGTGGGGAGTGGGGATCACAGGCTCCGTAAACAAAATGAATAAAACAGGATCTTAAAATGGTACAGTACCATCCACGTTGCTTGCAAAATCACTCTCTTTGGCACAGAAACTAGGAAGGCCACAGCTTAGGTTTCACAGGATATTAAGGACAGG
[0062] In the sequence, the sites marked [] are the mutation sites, and the alleles in the brackets are the allelic variations. The primer sequences are shown in bold at the beginning and end of the sequence.
[0063] 5) Association analysis: All the tested individuals have genotypes and chest widths at 40 weeks of age, and then a significance test is performed. The analysis results are as Figure 3As shown, the chest width of AA genotype individuals at 40 weeks of age was 5.96 ± 0.39 cm, the chest width of AG genotype individuals at 40 weeks of age was 6.20 ± 0.44 cm, and the chest width of GG genotype individuals at 40 weeks of age was 6.35 ± 0.45 cm. By genotyping technology, increasing the frequency of G allele can improve the chest width of laying hens.
[0064] Finally, it should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article or device.
[0065] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.
[0066] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.
Claims
1. Application of genetic markers associated with chest width trait in RNASEH2B gene in chicken genetic breeding, characterized in that, The genetic markers associated with the chest width trait in the RNASEH2B gene include CB_marker1, and the CB_marker1 corresponds to the physical position at the 169817100th site on chromosome 1 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 9th intron sequence of the gene RNASEH2B, and the base here is G or A; Among them, the breed of the chicken is selected from Dongxiang blue-shelled egg chickens and / or White Leghorns.
2. An early selection method for the trait of broad chicken breast, characterized in that, The early selection method includes early selection of the chest width trait of the chicken based on the genotype of the genetic marker CB_marker1; The CB_marker1 corresponds to the physical position at the 169817100th site on chromosome 1 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 9th intron sequence of the gene RNASEH2B, and the base here is G or A; Among them, the chest width of the individual with the GG genotype of the CB_marker1 is greater than that of the individual with the GA genotype, and the chest width of the individual with the GA genotype is greater than that of the individual with the AA genotype; The breed of the chicken is selected from Dongxiang blue-shelled egg chickens and / or White Leghorns.
3. An early selection method for the breast width trait according to claim 2, characterized in that The early selection method specifically includes: Detecting the genotype of CB_marker1 in the genome of the chicken to be tested; Early selection of the chest width trait of the chicken to be tested based on the genotype of the CB_marker1.
4. An early selection method for the chicken breast width trait according to claim 3, characterized in that, The detection of the genotype of CB_marker1 in the genome of the chicken to be tested specifically includes: Using Pr_cb1 f and Pr_cb1 r as primers to perform PCR amplification on the genomic DNA of the chicken to be tested; Sequencing the PCR amplification product to obtain the genotype at the 169817100th site on the sense strand of chromosome 1 of the chicken to be tested; Among them, the nucleotide sequence of Pr_cb1 f is as shown in SEQ ID NO.1, and the nucleotide sequence of Pr_cb1 r is as shown in SEQ ID NO.2.