ULK1 gene SNP molecular marker related to Muscovy duck breeding traits and application of ULK1 gene SNP molecular marker

Abstract

The invention discloses a Muscovy duck reproduction trait related ULK1 gene SNP molecular marker and application thereof, and belongs to the technical field of molecular biology. The SNP molecular marker of the ULK1 gene is located at the 869761 site of the fourth intron of the ULK1 gene of the Muscovy duck chromosome 16, and Ggt exists; a mutation. Experiments show that the ULK1 gene SNP molecular marker is significantly related to the breeding traits of Muscovy ducks, and more specifically, is significantly related to the age of Muscovy ducks in days at the beginning of laying. The ULK1 gene SNP molecular marker provided by the invention can be used for assisting in breeding Muscovy duck strains with excellent Muscovy duck breeding traits, and a scientific basis is provided for Muscovy duck breeding.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, in particular to a ULK1 gene SNP molecular marker related to the reproductive traits of Muscovy ducks and an application thereof. Background Art

[0002] Muscovy ducks are native to the tropical regions of Central and South America. They are also known as knob-headed ducks, foreign ducks, western ducks, fragrant ducks, musk ducks, etc. They are the main duck breeds raised in southern China. Muscovy ducks are one of the excellent lean-meat duck breeds, with the characteristics of thin skin, tender meat, fast growth, tolerance to roughage and good egg-laying performance. Duck eggs are deeply favored by consumers because they contain a variety of nutrients that promote human health and improve immunity. Traits such as the age of first laying are key indicators for identifying the reproductive performance of Muscovy ducks. However, at this stage, the breeding progress of Muscovy ducks is lagging behind, and breeding for reproductive performance is difficult, which seriously restricts the productivity of Muscovy duck eggs. The heritability of reproductive traits is low, and it is difficult to make great progress in current trait-based breeding.

[0003] Single Nucleotide Polymorphism (SNP) is a common heritable variation in animals, widely present in animal genomes, accounting for more than 90% of all known polymorphisms. SNP has the characteristics of stable inheritance and easy detection, and can be used for molecular marker-assisted selection (MAS) to improve the accuracy of selection and breeding results.

[0004] UNC-51-like kinase (UNC-51like autophagy activating kinase 1, ULK1), one of the serine / threonine kinases, is an important regulatory factor in biology and has a regulatory effect on a variety of life processes. ULK1 was found to be an indispensable component of autophagic vesicles and the main regulator of the autophagy initiation step, which is crucial to maintaining the balance of the intracellular environment. Studies have found that autophagy in ovarian granulosa cells is an important cause of follicular atresia and decreased fertility in laying birds. At present, there are few reports on the regulatory effect of the ULK1 gene on the reproductive traits of laying birds. The present invention provides a new SNP molecular marker in combination with the reproductive performance indicators of Muscovy ducks. Summary of the invention

[0005] The purpose of the present invention is to provide the field of molecular biotechnology, particularly to provide a ULK1 gene SNP molecular marker related to the reproductive traits of Muscovy ducks and its application, so as to solve the problems existing in the above-mentioned prior art. The SNP molecular marker is significantly correlated with the reproductive traits of Muscovy ducks, especially the age at first laying, and provides a new molecular marker for the breeding of Muscovy ducks for reproductive traits.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a ULK1 gene SNP molecular marker related to the reproductive traits of Muscovy ducks. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and a G>A mutation exists at position 101 of the sequence shown in SEQ ID NO: 1.

[0008] Preferably, the genotype of the mutation site of the SNP molecular marker is GG, GA and AA.

[0009] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0010] The invention also provides a kit for identifying the reproductive traits of Muscovy ducks, comprising the primer pair.

[0011] The present invention also provides a method for identifying the reproductive traits of Muscovy ducks, comprising the steps of amplifying the SNP molecular marker, analyzing the genotype of the mutation site of the SNP molecular marker according to the amplification result, and analyzing the reproductive traits of the Muscovy duck according to the genotype, wherein the nucleotide sequence of the primer pair used for amplification is as shown in SEQ ID NO: 2-3.

[0012] Preferably, the reproductive trait of the Muscovy duck is the age at first laying.

[0013] Preferably, the Muscovy duck individuals whose genotype at the mutation site of the SNP molecular marker is GG have a younger age at first laying than the Muscovy duck individuals whose genotypes are GA and AA.

[0014] The present invention also provides application of the SNP molecular marker in breeding of Muscovy duck reproduction traits.

[0015] The invention also provides application of the primer pair in preparing a kit for identifying the reproductive traits of Muscovy ducks.

[0016] Preferably, the reproductive trait of the Muscovy duck is the age at which the Muscovy duck lays eggs.

[0017] The present invention discloses the following technical effects:

[0018] The present invention analyzes the ULK1 gene and finds that the 869761 site on the fourth intron of the gene (i.e., the 101st position of the sequence shown in SEQ ID NO: 1) is significantly correlated with the reproductive traits of Muscovy ducks, providing a new SNP molecular marker for MAS, and through experimental verification, it is found that the SNP molecular marker (g.869761G>A) is significantly correlated with the age of first laying of Muscovy ducks (p<0.05), wherein the age of first laying of wild homozygous genotype GG individuals is less than that of AA mutation homozygous genotype individuals and GA heterozygous genotype individuals (p<0.05), but there is no significant difference between AA and GA (p>0.05). The SNP molecular marker provided by the present invention can accurately identify the reproductive traits of Muscovy ducks, thereby providing a scientific basis for the breeding of Muscovy ducks. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 This is the genotyping diagram of the SNP site in the ULK1 gene sequence. DETAILED DESCRIPTION

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0023] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0024] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0025] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0026] Example 1

[0027] 1. Materials and methods

[0028] 1.1 Animal samples

[0029] The experimental animals were 484 female Muscovy ducks aged 65 weeks (Guangdong Wenshi Southern Poultry Breeding Co., Ltd.), and 2 mL of subcutaneous venous blood was collected and stored at -80°C for DNA extraction. At the same time, the reproductive traits of the selected group, such as the age of first laying, egg production at 58 weeks, the number of qualified eggs at 58 weeks, the number of eggs produced at 65 weeks, and the number of qualified eggs at 65 weeks, were recorded.

[0030] 1.2 Main Reagents

[0031] Animal genomic DNA extraction kit (brand: Qingke; product number: TSP201-50; Beijing Qingke Biotechnology Co., Ltd.), 2×Es Taq MasterMix (Dye) (brand: Kangwei, product number: CW0690M, Kangwei Century Biotechnology Co., Ltd.); DNA marker (brand: Novezan, product number: MD101, Jiangsu Novezan Biotechnology Co., Ltd.); high-purity low-electrosmotic agarose (brand: Qingke, product number: TSJ001, Beijing Qingke Biotechnology Co., Ltd.).

[0032] 1.3 Experimental methods

[0033] 1.3.1 Primer design

[0034] According to the ULK1 gene (ENSCMMG00000006476) of the Muscovy duck (domestic type) genome (GCA_009194515.1) published by Ensembl, primers were designed using the Primer-BLAST tool of NCBI, and primer synthesis services were provided by Guangzhou Qingke Biotechnology Co., Ltd. The relevant information of the primer sequences is shown in Table 1.

[0035] Table 1 PCR amplification primer sequences

[0036]

[0037] 1.3.2 Blood DNA extraction

[0038] Extract blood sample DNA according to the operating manual of the blood sample DNA extraction kit.

[0039] 1.3.3 PCR amplification of ULK1 gene intron sequences

[0040] The genomic DNA of the blood samples of the above 484 Muscovy ducks was used as the PCR template, and the amplification system was: 2×Es TaqMasterMix 25μL, ULK1-SNP-F 2μL, ULK1-SNP-R 2μL, template DNA 2μL, ddH2O Up to 50μL. The reaction procedure was: 94℃ pre-denaturation for 2min; 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 30s, 34 cycles; 72℃ final extension for 3min; 4℃ storage.

[0041] 1.3.4 SNP identification and genotyping

[0042] The SeqMan tool in DNAstar software was used to analyze the sequence peak diagram of the Sanger sequencing results of the PCR products to determine the potential SNP sites, and the sequencing data of each sample was compared through this tool for genotyping.

[0043] 1.3.5 Association analysis between SNP genotypes and reproductive traits of Muscovy ducks

[0044] The SNP loci and genotypes corresponded to the reproductive trait data of Muscovy duck individuals, and the GLM procedure (General Linear Models Procedure) of SAS software was used to perform association analysis between SNP and the reproductive traits of Muscovy ducks.

[0045] 2. Results

[0046] 2.1 PCR amplification of ULK1 gene intron sequence and SNP screening

[0047] 484 Muscovy ducks were selected, and PCR amplification was performed using the blood sample DNA of each individual as a template. The PCR products (the amplified nucleotide sequence is shown in SEQ ID NO: 1) were obtained for Sanger sequencing. The peak graphs after sequencing were compared and analyzed, and a total of one SNP site g.869761G>A was detected. The SNP site is located at the 869761 site of the fourth intron of the ULK1 gene on chromosome 16 of the Muscovy duck. The SNP site corresponds to the 101st position of the sequence shown in SEQ ID NO: 1. The comparison results after Sanger sequencing are shown in Figure 1 shown.

[0048] SEQ ID NO: 1 is:

[0049] GGGCGACACGGGGCAGACTACAGCACCCAGAAGGCACCGCGACCAGGCTGCACCGTGCTGCGGGTGACGTGGGGCCGCCCAAACCAATCCATGCAGAAGGA G GAATGTCAACAAACACGGGCCTCGTGACACCAGGGACACGGCAGGCAGCCCCCCGGCACGGGACCAGTGGCTACCAGGGTCTGGCATGGGGTCCTGGGCC.

[0050] Note: The underlined base "G" in the above sequence is the mutation site.

[0051] 2.2 Association analysis between ULK1 intron sequence SNP sites and reproductive traits of Muscovy ducks

[0052] The above SNP loci were associated with the reproductive traits of Muscovy ducks (age of first laying, number of eggs laid at 58 weeks, number of qualified eggs at 58 weeks, number of eggs laid at 65 weeks, and number of qualified eggs at 65 weeks). The results are shown in Table 1.

[0053] The molecular marker g.869761G>A was significantly correlated with the age of first laying of Muscovy ducks (p<0.05). Among them, the age of first laying of wild homozygous genotype GG individuals was lower than that of AA mutation homozygous genotype individuals and GA heterozygous genotype individuals (p<0.05), but there was no significant difference between AA and GA (p>0.05).

[0054] Table 1 Association results between SNP sites in the intron of ULK1 gene and reproductive traits of Muscovy duck

[0055]

[0056] Note: Data in the same row with different lowercase letters indicate significant differences (P<0.05).

[0057] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A ULK1 gene SNP molecular marker related to the reproductive traits of Muscovy duck, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and there is a G>A mutation at position 101 of the sequence shown in SEQ ID NO:

1.

2. The SNP molecular marker according to claim 1, characterized in that The genotypes of the mutation sites of the SNP molecular markers are GG, GA and AA.

3. A primer pair for amplifying the SNP molecular marker according to claim 1, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NOs: 2-3.

4. A kit for identifying the reproductive traits of Muscovy ducks, characterized in that: Comprising the primer pair described in claim 3.

5. A method for identifying the reproductive traits of Muscovy ducks, characterized in that: The method comprises the steps of amplifying the SNP molecular marker of claim 1, analyzing the genotype of the mutation site of the SNP molecular marker according to the amplification result, and analyzing the reproductive traits of the Muscovy duck according to the genotype, wherein the nucleotide sequence of the primer pair used for amplification is shown in SEQ ID NO: 2-3.

6. The method according to claim 5, characterized in that The reproductive trait of the Muscovy duck is the age at first laying.

7. The method according to claim 6, characterized in that The Muscovy duck individuals whose genotype at the mutation site of the SNP molecular marker is GG have a younger age at the beginning of laying eggs than the Muscovy duck individuals whose genotypes are GA and AA.

8. Use of the SNP molecular marker as claimed in claim 1 or 2 in the breeding of Muscovy duck reproductive traits.

9. Use of the primer pair as claimed in claim 3 in preparing a kit for identifying the reproductive traits of Muscovy duck.

10. The use according to claim 8 or 9, characterized in that: The reproductive trait of the Muscovy duck is the age at which the Muscovy duck starts laying eggs.

Images