Molecular marker for distinguishing flowering morning and evening of common head cabbage and application of molecular marker

Abstract

The invention discloses a molecular marker for distinguishing flowering morning and evening of brassica oleracea and application of the molecular marker. A nucleotide sequence of the molecular marker exists in a genome No.4 chromosome non-coding region of early-flowering brassica oleracea and does not exist in a genome No.4 chromosome non-coding region of late-flowering brassica oleracea; based on the molecular marker, a primer pair Bf5 is further designed, the primer pair is used for amplifying the DNA of the common head cabbage, and the early flowering variety or material of the common head cabbage can be screened according to the existence of a target band. According to the molecular marker and the primer pair provided by the invention, the variety and material of the early-flowering common head cabbage can be rapidly detected, time and resources are greatly saved, and the selection efficiency is greatly improved, so that the breeding process is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker for distinguishing the early and late flowering of cabbage and an application thereof. Background Art

[0002] Cabbage (Brassica oleracea var. capitata) is a biennial vegetable crop of the genus Brassica in the family Cruciferae. It is a chlorotic vernalization plant that completes vegetative growth in the first year, blooms and bears fruit in the second year, and completes reproductive growth. Its main edible organ is the head. The vernalization pathway, photoperiod pathway, circadian rhythm pathway, and gibberellin pathway complement each other and jointly regulate the expression of flowering integration factors, affecting the bolting and flowering of cabbage. In the actual production process of cabbage, cabbage varieties with poor bolting resistance are used, or the phenomenon of late spring cold is encountered in spring. If the cabbage head reaches a certain low temperature before maturity, it will prompt the cabbage plant to quickly switch from vegetative growth to reproductive growth, causing premature bolting. Once bolting occurs, the growth of the head will be prevented, resulting in a decrease in yield and quality, causing serious economic losses. Therefore, cultivating cabbage varieties that are insensitive to low-temperature vernalization is an important way to solve this problem, and the premise for achieving this breeding goal is to select cabbage parent materials that are resistant to bolting and late flowering.

[0003] There are two main methods for screening breeding materials. One is the traditional breeding method, which requires cross-year selection and identification of bolting and flowering traits. It has a long cycle, cumbersome operating procedures, and a large workload. In addition, since the late-flowering trait of bolting resistance is closely related to environmental factors in addition to genetic factors, there is a large inaccuracy in relying on phenotypic identification. The other method is the molecular marker-assisted method developed in recent years, which combines molecular marker technology with traditional breeding science, and uses stable and reliable DNA molecular markers to replace phenotypic markers that are easily affected by the environment to screen breeding materials. Whole genome resequencing technology, that is, by resequencing the genome of different objects of the same species, the individual gene sequences are analyzed based on the published genome sequences. Through the data results of genome resequencing, single nucleotide polymorphism sites (SNPs), insertion and deletion sites (InDels) and copy number variation sites (CNVs) can be identified. These variation sites determine the differences between different individuals of the same species, while the traditional auxiliary marker selection breeding has very limited phenotypic auxiliary markers. Therefore, by performing whole genome resequencing of different cabbage varieties or materials combined with traditional phenotypic identification, a molecular marker that can identify the early or late flowering of cabbage is developed, which is of great significance for screening late-flowering breeding materials at the seedling stage and improving breeding efficiency. Summary of the invention

[0004] One of the purposes of the present invention is to provide an application of a molecular marker in identifying or screening the early or late flowering time of cabbage, wherein the nucleotide sequence of the molecular marker is as follows: TTTTAATTTCACCGGTTCAAATCTGCACACTTATTTGCCGTCCTGAATCCATATTC, this sequence exists in the non-coding region of chromosome 4 of the genome of early-flowering cabbage, but not in the non-coding region of chromosome 4 of the genome of late-flowering cabbage.

[0005] The second object of the present invention is to provide a primer pair Bf5 for use in identifying or screening the early or late flowering time of cabbage, and the sequence of the primer pair Bf5 is as follows: Bf5F:GCCGTCCTGAATCCATATTC; Bf5R: TTGCTAGCATTACGGTCCGG.

[0006] A third object of the present invention is to provide a method for identifying early flowering varieties or materials of cabbage, comprising the following steps: Step 1, extracting genomic DNA of the species or material to be identified; Step 2, using the DNA extracted in step 1 as a template, PCR amplification is performed using primer pair Bf5, and the sequence of primer pair Bf5 is as follows: Bf5F: GCCGTCCTGAATCCATATTC Bf5R: TTGCTAGCATTACGGTCCGG; Step 3, performing electrophoresis separation on the PCR amplification products of step 2 to obtain the banding pattern of each sample. If a 520 bp fragment is obtained, it indicates that the variety or material to be identified is early flowering.

[0007] Furthermore, the reaction system for PCR amplification in step 2 is 20 µL, including: 1 µL of genomic DNA template, 1 µL of upstream and downstream primers, and 10 µL of 2×EasyTaq PCR SuperMix for PAGE.

[0008] Furthermore, the reaction conditions for PCR amplification in step 2 are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, extension at 72°C for 60 s, 35 cycles; extension at 72°C for 10 min.

[0009] The present invention obtains the difference segment gene sequence of early flowering cabbage and late flowering cabbage by statistically analyzing the flowering time of early flowering cabbage and late flowering cabbage; after identification, the late flowering cabbage genome non-coding region lacks the segment sequence, and the early flowering cabbage genome non-coding region contains the segment sequence. Then, according to the segment sequence information, a primer pair Bf5 is designed, which can be used to quickly and efficiently identify the variety or material of early flowering cabbage.

[0010] The present invention overcomes the shortcomings of the traditional method, such as long time period, high cost, high inaccuracy, etc. Through the present invention, selection at the seedling stage can be achieved, the workload can be reduced, and the selection efficiency can be improved; at the same time, it is also conducive to the establishment of a late-flowering molecular marker-assisted breeding system for cabbage. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 These are the statistical results of flowering time of early-flowering cabbage and late-flowering cabbage.

[0012] Figure 2 These are the results of a comparison of differentially expressed genes between early-flowering cabbage and late-flowering cabbage.

[0013] Figure 3 The figure is the agarose gel electrophoresis result after PCR amplification of different varieties of cabbage with the marker primer Bf5, wherein: M is DL2000 Marker. As shown in the figure, the early flowering varieties in lanes 2, 3, 4, 5, 6, 7, 8, and 17 can amplify fragments of 520 bp, while the late flowering varieties in lanes 1, 9, 10, 11, 12, 13, 14, 15, and 16 do not have fragments of about 520 bp. DETAILED DESCRIPTION

[0014] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0015] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0016] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Example 1

[0017] Flowering time statistics of early-flowering cabbage and late-flowering cabbage: The field flowering time of different cabbages was investigated, and 39 early-flowering cabbages and 37 late-flowering cabbages were screened. The flowering time of early-flowering cabbage and late-flowering cabbage was counted for three consecutive years, and the results were as follows: in 2018, the mean flowering time of early-flowering cabbage was 198.21±6.76 days, and the mean flowering time of late-flowering cabbage was 202.13±7.32 days. The flowering time of late-flowering cabbage was about 4 days later than that of early-flowering cabbage; in 2019, the mean flowering time of early-flowering cabbage was 203.22±6.15 days, and the mean flowering time of late-flowering cabbage was 208.37±7.73 days. The flowering time of late-flowering cabbage was about 5 days later than that of early-flowering cabbage; in 2020, the mean flowering time of early-flowering cabbage was 201.38±8.18 days, and the mean flowering time of late-flowering cabbage was 204.05±8.75 days. The flowering time of late-flowering cabbage was about 3 days later than that of early-flowering cabbage; Figure 1 As shown, the flowering time of late-flowering cabbage was significantly later than that of early-flowering cabbage (P<0.01).

[0018] According to the genome resequencing results of early and late flowering cabbage materials, the differences in genome sequences of materials with different flowering characteristics were analyzed, and the differential sequences were functionally analyzed to screen the target differential segments, and primer pairs were designed. The early and late flowering cabbage with a sample number greater than 25 were selected for PCR amplification, and the segments with statistical differences in the genome of early and late flowering cabbage were compared and screened; further sequencing verification was performed to obtain the differential segment gene sequences of early flowering and late flowering cabbage, and the nucleotide sequence information of the differential segments was obtained by comparison in combination with the anchored segments with statistical differences; according to the nucleotide sequence information of the differential segments, primer pairs were designed to amplify and verify the cabbage genome DNA; combined with the flowering period phenotypic data of early flowering and late flowering cabbage, molecular markers were identified and obtained, and the insertion and deletion sequences were as follows: TTTTAATTTCACCGGTTCAAATCTGCACACTTATTTGCCGTCCTGAATCCATATTC.

[0019] The molecular marker is located at 4239, 3723-4239, 3779 in the non-coding region of chromosome 4 of the genome, with a length of 56 bp. The molecular marker is missing in the non-coding region of the late-flowering cabbage genome, and the molecular marker is contained in the non-coding region of the early-flowering cabbage genome. Figure 2 shown. Example 2

[0020] This embodiment provides a method for identifying the early or late flowering of cabbage, comprising the following steps: Step 1: Extraction of genomic DNA from cabbage leaves Take 0.1g of young cabbage leaves, grind them with liquid nitrogen, add 500µL CTAB lysis buffer, transfer to a 1.5mL centrifuge tube, cool in a 65℃ water bath for 0.5~1h, add an equal volume of chloroform / isoamyl alcohol mixture and shake gently, centrifuge at 12000r / min for 8~10min, extract the supernatant with chloroform / isoamyl alcohol mixture 1~2 times, add pre-cooled isopropanol, let stand at 4℃ for more than 3 hours, collect flocculent DNA, wash with 70% ethanol by volume, dry and save in TE buffer, test the purity and concentration of DNA, dilute to 50ng / µL, and store in a -20℃ refrigerator for later use; The composition of the CTAB lysis solution is as follows: 2% CTAB, 2mol / L NaCl2, 20mmol / L EDTA, 100mmol / L Tris-HCl, pH=8.0, and 0.2% β-mercaptoethanol by volume; the volume ratio of chloroform to isoamyl alcohol in the chloroform / isoamyl alcohol mixture is 24:1.

[0021] Step 2, amplification of primer pair Bf5 in the cabbage genome The PCR reaction system was 20 µL, including 1 µL of genomic DNA template, 1 µL of upstream and downstream primers, and 10 µL of 2×EasyTaqPCR SuperMix for PAGE.

[0022] The sequence of primer pair Bf5 is as follows: Bf5F:GCCGTCCTGAATCCATATTC; Bf5R: TTGCTAGCATTACGGTCCGG.

[0023] The PCR reaction conditions were as follows: 94°C pre-denaturation for 3 min; 94°C denaturation for 50 s, 56°C for 50 s, 72°C extension for 60 s, 35 cycles; 72°C extension for 10 min, and then storage at 4°C; Step 3, agarose gel electrophoresis detection After PCR amplification, 1.2% agarose gel electrophoresis was performed with 1×TAE buffer, 10 μL of sample was loaded, and electrophoresis was performed at 150 V for 20 min. The samples were then observed and photographed using a gel imager.

[0024] The electrophoresis results are as follows Figure 3 It can be seen that the early flowering varieties in lanes 2, 3, 4, 5, 6, 7, 8, and 17 can all amplify fragments of 520 bp, while the late flowering varieties in lanes 1, 9, 10, 11, 12, 13, 14, 15, and 16 do not have fragments of about 520 bp.

[0025] From the above results, it can be seen that if the labeled primer Bf5 is used to amplify the varieties or materials of cabbage that bloom early or late, if a 520bp fragment can be amplified, it indicates that the cabbage has the early flowering trait.

Claims

1. An application of a molecular marker in identifying or screening the early or late flowering time of cabbage, characterized in that: The nucleotide sequence of the molecular marker is as follows: TTTTAATTTCACCGGTTCAAATCTGCACACTTATTTGCCGTCCTGAATCCATATTC, this sequence exists in the non-coding region of chromosome 4 of the genome of early-flowering cabbage, but not in the non-coding region of chromosome 4 of the genome of late-flowering cabbage.

2. Use of primer pair Bf5 in identifying or screening early or late flowering time of cabbage, characterized in that: The sequence of the primer pair Bf5 is as follows: Bf5F:GCCGTCCTGAATCCATATTC; Bf5R: TTGCTAGCATTACGGTCCGG.

3. A method for identifying early flowering varieties or materials of cabbage, characterized in that: The following steps are involved: Step 1, extracting genomic DNA of the species or material to be identified; Step 2, using the DNA extracted in step 1 as a template, PCR amplification is performed using primer pair Bf5, and the sequence of primer pair Bf5 is as follows: Bf5F: GCCGTCCTCTGAATCCATATTC Bf5R: TTGCTAGCATTACGGTCCGG; Step 3, performing electrophoresis separation on the PCR amplification products of step 2 to obtain the banding pattern of each sample. If a 520 bp fragment is obtained, it indicates that the variety or material to be identified is early flowering.

4. The method according to claim 3, characterized in that The reaction system for PCR amplification in step 2 is 20µL, including: 1µL genomic DNA template, 1µL upstream and downstream primers, and 10µL 2×EasyTaq PCR SuperMix for PAGE.

5. The method according to claim 3, characterized in that The reaction conditions for PCR amplification in step 2 are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, extension at 72°C for 60 s, 35 cycles; extension at 72°C for 10 min.

Images