Animal models and therapeutic molecules

Abstract

The present invention relates, inter alia, to rodents and cells engineered to contain feline exogenous DNA, their use in medicine and disease studies, methods for producing rodents and cells, and antibodies and antibody chains and derivatives thereof produced by such rodents.

Description

Background Art

[0001] The invention relates in particular to rodents and cells engineered to contain exogenous DNA from a cat, their use in medicine and disease research, methods for producing rodents and cells, and antibodies and antibody chains produced by such rodents, and derivatives thereof.

[0002] Insertion of human DNA into rodents has been disclosed in, for example, Murphy et al., Vol. 111 No. 14, 5153-5158, doi: 10.1073 / pnas.1324022111; MacDonald et al., Vol. 111 No. 14, 5147-5152, doi: 10.1073 / pnas.1323896111; and Lee et al., Nature Biotechnology, Vol. 32, pp. 356-363 2014 DOI:, doi: 10.1038 / nbt.2825. This method is designed to prepare antibody products for human therapeutic use. Insertion of dog and cat DNA into rodents has been described in WO2018189520.

[0003] The present invention relates to rodents and cells and antibody libraries, antibodies and antibody portions, such as antibodies produced by rodents comprising feline immunoglobulin DNA, including whole feline antibodies, and the use of such antibodies and portions thereof to prevent and treat disease in cats, and methods for making such rodents, cells, antibodies, antibody chains and libraries. Summary of the invention

[0004] A rodent or rodent cell having a genome comprising;

[0005] i) no more than 9 feline IGHV gene segments, one or more feline IGHD region gene segments and one or more feline IGHJ region gene segments,

[0006] wherein the rodent or rodent cell is capable of expressing the feline IGH gene segment to form antibody heavy chains,

[0007] wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0008] A rodent or rodent cell having a genome comprising;

[0009] i) no more than 11 feline lambda V gene segments and one or more feline IGL J region gene segments,

[0010] wherein the rodent or rodent cell is capable of expressing the feline lambda gene segment to form an antibody light chain,

[0011] wherein at least one of the feline λ gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126.

[0012] A rodent or rodent cell having a genome comprising;

[0013] i) no more than 6 feline kappa V gene segments and one or more feline IGKJ region gene segments;

[0014] wherein the rodent or rodent cell is capable of expressing the feline κ gene segment to form an antibody light chain,

[0015] wherein at least one of the feline κ gene segments is selected from V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0016] In one embodiment, the gene segment has a nucleic acid sequence as shown in Table 1, wherein "V3-14", "V-124" etc. are designated as corresponding SEQ ID NOs. "Gene segment" also means "gene".

[0017] A method for producing a rodent or rodent cell as disclosed herein, the method comprising inserting into the genome of a rodent cell

[0018] (i) no more than 9 feline IGH V gene segments, one or more feline IGH D region gene segments, and one or more feline IGH J region gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5; and / or

[0019] (ii) no more than 11 feline λV gene segments and one or more feline λJ region gene segments, wherein at least one of the feline λV gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126; and / or

[0020] (iii) no more than 6 feline κV gene segments and one or more feline J region gene segments, wherein at least one of the feline κV gene segments is selected from the group consisting of V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4;

[0021] And wherein the rodent or rodent cell is capable of expressing one or more feline variable region gene segments that combine with constant regions to form antibody chains.

[0022] The cat variable region gene segments mentioned herein refer to cat V region gene segments, cat D region gene segments and / or cat J region gene segments (as the case may be). In one aspect, the cat variable region gene segments are at least 1 cat V region gene segment, at least one cat D region gene segment and at least one cat J region gene segment.

[0023] A method for producing an antibody or antibody chain specific for a desired antigen, the method comprising immunizing a rodent disclosed herein with the desired antigen and recovering the antibody chain or antibody or recovering a cell producing the antibody chain or antibody.

[0024] A method for producing an antibody chain or antibody specific for a desired antigen, the method comprising immunizing a rodent disclosed herein and then replacing any rodent constant region of the antibody chain or antibody with a feline constant region, appropriately by engineering the nucleic acid encoding the antibody.

[0025] Reference herein to replacing any rodent constant region means that, where the constant region is a rodent constant region, it is replaced with, for example, a cat constant region, and where the constant region is already, for example, a cat constant region, such replacement is not required. For example, this may occur at the lambda locus.

[0026] A method for producing an antibody, antibody chain or portion thereof, wherein the antibody chain has a feline variable region, the method comprising expressing in a cell a nucleic acid, such as a DNA, encoding the antibody, antibody chain or portion thereof,

[0027] wherein the sequence of the nucleic acid encoding the variable region of the antibody chain is obtained by immunizing a rodent disclosed herein with an antigen,

[0028] The method optionally comprises the following subsequent steps:

[0029] i. purifying and / or isolating the antibody or antibody chain, and

[0030] ii. Optionally, the antibody or antibody chain is then formulated into a pharmaceutically acceptable formulation suitable for administration to a cat.

[0031] A method of preparing a pharmaceutical composition, the method comprising producing an antibody, preferably a fully feline antibody, according to the methods disclosed herein, and further comprising combining the antibody with a pharmaceutically acceptable carrier or other excipient to produce the composition.

[0032] A nucleic acid encoding a chimeric antibody chain, the nucleic acid comprising any one of a feline IGHV gene segment and a rodent constant region, the feline IGHV gene segment being selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, optionally wherein the feline V gene segment is a sequence that has undergone somatic hypermutation in a rodent.

[0033] A nucleic acid encoding a chimeric antibody chain, the nucleic acid comprising any 2, 3, 4, 5, 6, 7, 8 or all 9 of a feline IGHV gene segment and a rodent constant region, the feline IGHV gene segment being selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, optionally wherein the feline V gene segment is a sequence that has undergone somatic hypermutation in a rodent.

[0034] A nucleic acid encoding a chimeric antibody chain, the nucleic acid comprising any one of the cat λV gene segments of a cat λV gene segment and a rodent constant region, the cat λV gene segment being selected from the list comprising: λV1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126, optionally wherein the cat V gene segment sequence is a sequence that has undergone somatic hypermutation in a rodent.

[0035] A nucleic acid encoding a chimeric antibody chain, the nucleic acid comprising any 2, 3, 4, 5, 6, 7, 8, 9, 10 or all 11 of a feline λV gene segment and a rodent constant region, the feline λV gene segment being selected from the list comprising: λV1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126, optionally wherein the feline V gene segment is a sequence that has undergone somatic hypermutation in a rodent.

[0036] A nucleic acid encoding a chimeric antibody chain, the nucleic acid comprising any one of a feline κV gene segment and a rodent constant region, the feline κV gene segment being selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4, optionally wherein the feline V gene segment sequence is a sequence that has undergone somatic hypermutation in a rodent.

[0037] A nucleic acid encoding a chimeric antibody chain, the nucleic acid comprising any 2, 3, 4, 5 or all 6 of a feline κV gene segment and a rodent constant region, the feline κV gene segment being selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4, optionally wherein the feline V gene segment is a sequence that has undergone somatic hypermutation in a rodent.

[0038] An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5 in a rodent.

[0039] An antibody chain having a variable region bound to a rodent constant region, wherein the variable region is obtained by expression of any two, three, four, five, six, seven, eight or all nine of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5 in a rodent.

[0040] An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained by expression of any one of feline lambda V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 in a rodent.

[0041] An antibody chain having a variable region bound to a rodent constant region, wherein the variable region is obtained by expression of any two, three, four, five, six, seven, eight, nine, ten or all eleven of feline lambda V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 in a rodent.

[0042] An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in a rodent.

[0043] An antibody chain having a variable region combined with a rodent constant region, wherein the variable region is obtained by expression of any two, three, four, five or all six of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in a rodent.

[0044] A pharmaceutical composition comprising an antibody chain having a variable region comprising any one or any 2, 3, 4, 5, 6, 7, 8 or all 9 of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5 in combination with a pharmaceutically acceptable excipient or carrier.

[0045] A pharmaceutical composition comprising an antibody chain having a variable region comprising any one or any 2, 3, 4, 5, 6, 7, 8, 9, 10 or all 11 of cat lambda V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 in combination with a pharmaceutically acceptable excipient or carrier.

[0046] A pharmaceutical composition comprising an antibody chain having a variable region in combination with a pharmaceutically acceptable excipient or carrier, wherein the variable region comprises any one or any 2, 3, 4, 5 or all 6 of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0047] A pharmaceutical composition comprising an antibody having

[0048] (i) a heavy chain having a variable region obtained by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, and any one of the following

[0049] (ii) a lambda light chain obtained by expression of any one of cat lambdas V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13, and V1-126; or

[0050] (iii) a kappa light chain obtained by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9, and V2-4;

[0051] The antibody is formulated in combination with a pharmaceutically acceptable excipient or carrier.

[0052] An antibody heavy chain library comprising antibody heavy chains having feline IGH V gene segments from no more than 9 different feline IGH V gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5

[0053] Optionally wherein the library comprises

[0054] A Antibody heavy chain with feline IGH V gene segments expressed by:

[0055] (i) V3-14, optionally with up to 8 additional feline IGH V gene segments;

[0056] (ii) V3-14 and V3-11, optionally with up to 7 additional feline IGH V gene segments;

[0057] (iii) V3-14, V3-11, and V3-12, optionally with up to 6 additional feline IGH V gene segments;

[0058] (iv) V3-14, V3-11, V3-12, and V3-84, optionally with up to 5 additional feline IGH V gene segments;

[0059] (v) V3-14, V3-11, V3-12, V3-84, and V3-20, optionally with up to 4 additional feline IGH V gene segments;

[0060] (vi) V3-14, V3-11, V3-12, V3-84, V3-20, and V3-27, optionally with up to 3 additional feline IGH V gene segments;

[0061] (vii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, and V4-3, optionally with up to 2 additional feline IGH V gene segments;

[0062] (viii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, and V3-N3, optionally with up to 1 additional feline IGH V gene segment; or

[0063] (ix) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5;

[0064] and / or

[0065] B Antibody heavy chains expressed by IGHV gene segments of feline IGHV families 3 and 4.

[0066] Gene families, such as IGHV family 3, are well-known terms in the art. In one aspect, reference to a gene family, such as IGHV family 3, refers to the symbol of the IMGT library (ImMunoGeneTics), which is available (as of May 26, 2022) from: https: / / www.imgt.org / IMGTrepertoire / LocusGenes / #F .

[0067] An antibody heavy chain library comprising antibody heavy chains having feline IGHV gene segments from no more than 9 different feline IGH V gene segments, wherein 1 IGHV segment must be IGHV4-3 and at least one of the remaining IGH V segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0068] An antibody lambda light chain library, the library comprising antibody light chains having feline lambda V gene segments from no more than 11 different lambda V gene segments, wherein at least one of the V gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13, and V1-126,

[0069] Optionally wherein the library comprises

[0070] A has an antibody lambda light chain comprising the following feline lambda V gene segments

[0071] (i) V1-124, optionally with up to 10 additional feline lambda V gene segments;

[0072] (ii) V1-124 and V1-36, optionally with up to 9 additional feline lambda V gene segments;

[0073] (iii) V1-124, V1-36, and V1-104, optionally with up to 8 additional feline lambda V gene segments;

[0074] (iv) V1-124, V1-36, V1-104, and V1-33, optionally with up to 7 additional feline lambda V gene segments;

[0075] (v) V1-124, V1-36, V1-104, V1-33, and V1-56, optionally with up to 6 additional feline lambda V gene segments;

[0076] (vi) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, optionally with up to 5 additional feline lambda V gene segments; or

[0077] (vii) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, and V1-41, optionally with up to 4 additional feline lambda V gene segments;

[0078] and / or

[0079] B Antibody lambda light chain expressed from lambda V gene segments of feline lambda families 1 and 3.

[0080] An antibody kappa light chain library, the library comprising antibody kappa light chains having feline kappa V gene segments from no more than 6 different feline kappa V gene segments, wherein at least one of the V gene segments is selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4,

[0081] Optionally wherein the library comprises

[0082] A has an antibody kappa light chain comprising the following feline kappa V gene segments

[0083] (i) V4-1, optionally with up to 5 additional feline κV gene segments;

[0084] (ii) V4-1 and V2-12, optionally with up to 4 additional feline κV gene segments;

[0085] (iii) V4-1, V2-12, and V2-5, optionally with up to 3 additional feline κV gene segments;

[0086] (iv) V4-1, V2-12, V2-5, and V2-13, optionally with up to 2 additional feline κV gene segments;

[0087] (v) V4-1, V2-12, V2-5, V2-13, and V2-9, optionally with up to 1 additional feline κV gene segment; or

[0088] (vi) V4-1, V2-12, V2-5, V2-13, V2-4 and V2-4; or

[0089] (vii) V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4;

[0090] and / or

[0091] B Antibody kappa light chains expressed from kappa V gene segments of feline kappa V families 2 and 4.

[0092] An antibody κ light chain library, the library comprising antibody κ light chains having feline κV gene segments from no more than 6 different feline κV gene segments, wherein one of the feline κV gene segments must be IGKV4-1, and at least one of the V gene segments is selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0093] An isolated antibody or antibody chain or portion thereof, or a nucleic acid (such as DNA) encoding an antibody chain or portion thereof (such as a full feline antibody chain or full feline antibody), which has been or can be obtained from a rodent or rodent cell as described herein or from a library as described herein, or a pharmaceutical composition comprising the isolated antibody or antibody chain or portion thereof or the nucleic acid.

[0094] An antibody or antibody or chain or part thereof, or a nucleic acid (such as DNA) encoding an antibody chain or part thereof (such as a full feline antibody chain or a full feline antibody), which has been or can be obtained from a rodent or rodent cell as described herein or from a library as described herein, or a pharmaceutical composition comprising the antibody or antibody or chain or part thereof or the nucleic acid, for treating or preventing a disease in a cat in need thereof.

[0095] A method of treating a cat, the method comprising delivering to a cat in need thereof an antibody or antibody chain or portion thereof, the antibody being or obtainable from a rodent or rodent cell or library as disclosed herein.

[0096] A rodent or a rodent cell having a genome comprising a feline IGH V gene segment selected from any one of the sequences shown in Table 1. A rodent or a rodent cell having a genome comprising a feline IGH V gene segment, one or more feline IGH D region gene segments and one or more feline IGH J region gene segments, wherein the feline IGH V gene segment is selected from the list comprising: IGH V3-14 (SEQ ID NO: 1), V1-36 ​​(SEQ ID NO: 11), V1-104 (SEQ ID NO: 12) and V1-42 (SEQ ID NO: 15),

[0097] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

[0098] A rodent or a rodent cell having a genome comprising a cat IGK V gene segment selected from any one of the sequences shown in Table 1. A rodent or a rodent cell having a genome comprising a cat IGK V gene segment IGK V2-5 (SEQ ID NO: 23) and one or more cat IGH J region gene segments,

[0099] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody light chain.

[0100] surface

[0101] Table 1 - List of preferred V gene sequences

[0102] Table 2a - Analysis of healthy cat PBMCs showing the most commonly observed heavy and light chain pairings

[0103] Table 2b - Analysis of healthy cat PBMCs, listing the most frequently observed heavy chains

[0104] Table 2c - Analysis of healthy cat PBMCs, listing the most commonly observed light chains

[0105] Table 3 - Primer sequences

[0106] Table 4 - Analysis of healthy cat PBMCs, listing the light chains ranked according to the number of different heavy chain pairs

[0107] Table 5a - Analysis of healthy cat PBMCs, listing the most frequently observed heavy chains

[0108] Table 5b - Analysis of healthy cat PBMCs, listing the most frequently observed lambda chains

[0109] Table 5c - Analysis of healthy cat PBMCs, listing the most frequently observed kappa chains DETAILED DESCRIPTION

[0110] The present invention relates to rodents comprising feline immunoglobulin gene segments. Prior art rodents (both prior art rodents containing human IG DNA and prior art rodents containing cat IG DNA) generally wish to insert as many V gene segments as possible to optimize the range of antibodies produced. However, this requires a large amount of genome engineering work to achieve complete insertion of large IG loci. In the present disclosure, the profile of antibodies produced in European shorthair cats has been analyzed, and it has been shown that only a few V gene segments contribute disproportionately to the antibody repertoire. For example, the cat IGH V3-14 gene segment is found in more than 14% of antibody heavy chains. Therefore, it is not necessary to insert all V gene segments to create an antibody population that will provide a suitable library for the identification and selection of lead antibody candidates. This simplifies the genetic engineering required to prepare a rodent model for antibody production, and enables the generation of a rodent model involving IGHV and IG light chain V usage (which reflects the use in kittens).

[0111] If a large portion (such as the entirety) of the feline IG locus is inserted into a rodent, some of the V gene segments that are preferentially used in cats may be expressed less frequently in the rodent due to their distance upstream of the (rodent) constant region. This may reduce the effectiveness of such rodents in producing therapeutically relevant antibodies. Therefore, another advantage of the present invention is that the preferred V gene segments can be inserted closer to the constant region than their natural position in the cat, and therefore these preferred V gene segments may be used more frequently in rodents than if a larger portion of the feline IG locus were inserted, thereby more faithfully representing the natural repertoire of the cat.

[0112] The cat V gene segments selected for insertion into rodents to generate antibody populations can be based on the observed frequency, the number of different pairings (heavy cat V gene segments with light cat V gene segments), or a combination of both. The cat V gene segments with the highest observed frequency are preferred. Preferred heavy cat V gene segments or light cat V gene segments are heavy cat V gene segments or light cat V gene segments contained in antibody chains that are paired with the highest number of different light cat V antibody chains or heavy cat V antibody chains (antibody chains containing different cat V gene segments), respectively.

[0113] Therefore the present invention relates to

[0114] A rodent or rodent cell having a genome comprising;

[0115] i) no more than 9 feline IGHV gene segments, one or more feline D region gene segments and one or more feline J region gene segments,

[0116] ii) wherein the rodent or rodent cell is capable of expressing the feline gene segments to form antibody heavy chains, and

[0117] iii) wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0118] Table 2b lists the observed frequencies of feline heavy chain V gene segments. In the rodent genome, one or more of the 9 preferred IGH V gene segments can be combined with any other one or more feline V gene segments. It is not necessary to be limited to the preferred 9 feline V gene segments, but at least one must be present. The preferred feline gene segment present is IGH V3-14. The preferred alternative feline gene segment is V3-11. These two sequences are found together in more than 23% of feline antibody heavy chains.

[0119] Another embodiment disclosed herein is a rodent or rodent cell disclosed herein comprising the following feline IGH

[0120] (i) V3-14, optionally with up to 8 additional feline IGH V gene segments;

[0121] (ii) V3-14 and V3-11, optionally with up to 7 additional feline IGH V gene segments;

[0122] (iii) V3-14, V3-11, and V3-12, optionally with up to 6 additional feline IGH V gene segments;

[0123] (iv) V3-14, V3-11, V3-12, and V3-84, optionally with up to 5 additional feline IGH V gene segments;

[0124] (v) V3-14, V3-11, V3-12, V3-84, and V3-20, optionally with up to 4 additional feline IGH V gene segments;

[0125] (vi) V3-14, V3-11, V3-12, V3-84, V3-20, and V3-27, optionally with up to 3 additional feline IGH V gene segments;

[0126] (vii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, and V4-3, optionally with up to 2 additional feline IGH V gene segments;

[0127] (viii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, and V3-N3, optionally with up to 1 additional feline IGH V gene segment; or

[0128] (ix) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0129] Additional embodiments disclosed herein are a rodent or rodent cell comprising no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than two, or only 1 of the feline IGH V gene segments V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5.

[0130] Another embodiment disclosed herein is a rodent or rodent cell having only 1 feline IGH V gene segment as listed above, as well as only 1 feline IGH D gene segment and only 1 feline IGH J gene segment, forming a "common heavy chain".

[0131] In one aspect, the common heavy chain approach can be used to generate bispecific antibodies.

[0132] Additional embodiments disclosed herein are a rodent or rodent cell comprising at least 2 IgH gene segments, such as at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or all 9 of the feline IGH V gene segments V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5. The rodent or rodent cell may comprise 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the feline IGH V gene segments V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5.

[0133] In one embodiment of any aspect of the invention, the total number of feline V gene segments inserted at each locus (heavy, lambda and / or kappa) is 9 or less.

[0134] In one embodiment of any aspect of the invention, the total number of feline V gene segments inserted at each locus (heavy, lambda and / or kappa) is 11 or less.

[0135] In one embodiment of any aspect of the invention, the total number of feline V gene segments inserted at each locus (heavy, lambda and / or kappa) is 6 or less.

[0136] In one embodiment of any aspect of the invention, the total number of feline V gene segments inserted at each locus (heavy, lambda and / or kappa) is 20 or less.

[0137] In one embodiment of any aspect of the invention, the total number of feline V gene segments inserted at each locus (heavy, lambda and / or kappa) is 35 or less.

[0138] In one embodiment of any aspect of the invention, the total number of feline V gene segments inserted at each locus (heavy, lambda and / or kappa) is 50 or less.

[0139] Preferably, the rodent comprises at least one gene segment from each of feline IGH V gene families 3 and 4, with no more than 9 feline IGHV gene segments present in the rodent or rodent cell genome.

[0140] In one embodiment, all inserted V genes are functional V genes.

[0141] In one embodiment, the inserted V genes include functional V genes and non-functional V genes (including pseudogenes and open reading frames).

[0142] In an embodiment, a subset of the total number of preferred feline V gene segments is inserted. One, two, three, four, five, six, seven, eight, or nine of the preferred feline IGHV gene segments may be inserted. One, two, three, four, five, six, seven, eight, nine, ten, or eleven of the preferred feline IGL V gene segments may be inserted. One, two, three, four, five, or six of the preferred feline IGK V gene segments may be inserted.

[0143] As disclosed herein, the total number of feline V gene segments inserted at each locus can be limited, so in combination, for example, the present invention contemplates the insertion of 20 feline IGH V gene segments, of which 6 of the inserted feline IGH V gene segments are preferred feline IGH V gene segments.

[0144] In other embodiments, the inserted cat V gene segment is inserted together with other cat V gene segments and / or other regions of the cat IG locus. Specifically, the chromosomal region around the preferred V gene can be inserted together.

[0145] For example, the inserted feline V gene segment is as part of a single bacterial artificial chromosome (BAC). In one aspect, each BAC can contain 3-5 feline V gene segments, including one of the preferred feline V gene segments.

[0146] In one aspect, reference to a BAC, such as BAC FCAB-22313, is a reference to the FCAB library from Amplicon Express, now available through the College of Veterinary Medicine and Biomedical Sciences, Texas A&M University.

[0147] In one aspect, inserting the feline IGH V gene segment can involve inserting some or all of BAC FCAB-223I3.

[0148] In one aspect, inserting a feline IGH V gene segment may involve inserting some or all of BAC FCAB-253K11. In one aspect, inserting a feline IGH V gene segment may involve inserting some or all of BAC FCAB-253K11 and some or all of BAC FCAB-180D24. In one aspect, inserting a feline IGH V gene segment may involve inserting some or all of BAC FCAB-253K11, some or all of BAC FCAB-180D24, and some or all of BAC FCAB-74C2.

[0149] In one aspect, inserting the feline IGL V gene segment can involve inserting some or all of BAC FCAB-3517.

[0150] In one aspect, inserting a feline IGL V gene segment can involve inserting some or all of BAC FCAB-166L22. In one aspect, inserting a feline IGL V gene segment can involve inserting some or all of BAC FCAB-166L22 and some or all of BAC FCAB-87D23. In one aspect, inserting a feline IGL V gene segment can involve inserting some or all of BAC FCAB-166L22, some or all of BAC FCAB-87D23, and some or all of BAC FCAB-526E12.

[0151] In one aspect, inserting the feline IGK V gene segment can involve inserting some or all of BAC FCAB-609P16.

[0152] In one embodiment, the inserted feline gene segments can be inserted as part of an array or cluster of feline gene segments, optionally embedded in rodent or feline non-coding regulatory sequences or scaffold sequences.

[0153] In one embodiment, the inserted cat gene segment can be inserted as part of a minilocus.

[0154] An alternative method of inserting gene segments into rodents is described in US20170306352 (in the context of dogs) and is equally applicable to cats, which is incorporated by reference.

[0155] In one embodiment, the inserted feline V gene segment is inserted as part of a concatemer. In one aspect, the concatemer is a series of preferred feline V gene segments, optionally with feline or rodent regulatory sequences associated with the feline V gene segments.

[0156] The present invention further relates to:

[0157] An isolated nucleotide molecule comprising or consisting of the sequence of any one of SEQ ID NO: 1, 11, 12, 15 or 23, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity (e.g., at least 95% identity) thereto.

[0158] A polypeptide comprising or consisting of an amino acid sequence encoded by a nucleotide molecule according to the present invention. In one embodiment, the polypeptide may be an antibody.

[0159] A pharmaceutical composition comprising an antibody according to the invention.

[0160] A rodent or rodent cell having a genome comprising a sequence of any one of SEQ ID NO: 1, 11, 12, 15 or 23. Suitable such rodent cells may include isolated rodent B cells or cell lines, such as ES cells or iPS cells. For example, mouse ES cell lines are described in WO2018 / 1899520.

[0161] A vector comprising the sequence of any one of SEQ ID NO: 1, 11, 12, 15 or 23.

[0162] A rodent or rodent cell having a genome comprising a feline IGH V gene segment, one or more feline IGHD region gene segments and one or more feline IGH J region gene segments, wherein the feline IGH V gene segment is selected from the list comprising: IGH V3-14 (SEQ ID NO: 1), V1-36 ​​(SEQ ID NO: 11), V1-104 (SEQ ID NO: 12) and V1-42 (SEQ ID NO: 15),

[0163] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

[0164] A rodent or rodent cell having a genome comprising feline IGH V gene segment IGH V3-14 (SEQ ID NO: 1), one or more feline IGH D region gene segments and one or more feline IGH J region gene segments,

[0165] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

[0166] A rodent or rodent cell having a genome comprising feline IGH V gene segment IGH V3-14 (SEQ ID NO: 1) and feline IGH V gene segment IGH V1-36 ​​(SEQ ID NO: 11), one or more feline IGH D region gene segments and one or more feline IGH J region gene segments,

[0167] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

[0168] A rodent or rodent cell having a genome comprising feline IGH V gene segment IGH V3-14 (SEQ ID NO: 1), feline IGH V gene segment IGH V1-36 ​​(SEQ ID NO: 11) and feline IGH V gene segment IGH V1-104 (SEQ ID NO: 12), one or more feline IGH D region gene segments and one or more feline IGH J region gene segments,

[0169] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

[0170] A rodent or rodent cell having a genome comprising feline IGH V gene segment IGH V3-14 (SEQ ID NO: 1), feline IGH V gene segment IGH V1-36 ​​(SEQ ID NO: 11), feline IGH V gene segment IGH V1-104 (SEQ ID NO: 12) and feline IGH V gene segment IGH V1-42 (SEQ ID NO: 15), one or more feline IGH D region gene segments and one or more feline IGH J region gene segments,

[0171] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

[0172] A rodent or rodent cell having a genome comprising a feline IGK V gene segment IGK V2-5 (SEQ ID NO: 23) and one or more feline IGH J region gene segments,

[0173] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody light chain.

[0174] The present invention further relates to:

[0175] A rodent or rodent cell having a genome comprising;

[0176] i) no more than 11 feline lambda V gene segments and one or more feline J region gene segments;

[0177] ii) wherein the rodent or rodent cell is capable of expressing the feline lambda gene segment to form antibody light chains,

[0178] iii) wherein at least one of the feline λ gene segments is selected from V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126.

[0179] Table 2c lists the observed frequencies of feline light chain V gene segments. In the rodent genome, one or more of the 11 preferred cat λ gene segments can be combined with any other one or more cat V gene segments. It is not necessary to be limited to the preferred 11 cat V gene segments, but at least one must be present. The preferred cat gene segment present is IGH V-124. The preferred alternative cat gene segment is V1-36. The preferred alternative cat gene segment is V1-104. The preferred alternative cat gene segment is V1-33. These 4 sequences are found together in more than 17% of the λ antibody chains.

[0180] Another embodiment disclosed herein is a rodent or rodent cell comprising the following cat lambda V

[0181] (i) V1-124, optionally with up to 10 additional feline lambda V gene segments;

[0182] (ii) V1-124 and V1-36, optionally with up to 9 additional feline lambda V gene segments;

[0183] (iii) V1-124, V1-36, and V1-104, optionally with up to 8 additional feline lambda V gene segments;

[0184] (iv) V1-124, V1-36, V1-104, and V1-33, optionally with up to 7 additional feline lambda V gene segments;

[0185] (v) V1-124, V1-36, V1-104, V1-33, and V1-56, optionally with up to 6 additional feline lambda V gene segments;

[0186] (vi) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, optionally with up to 5 additional feline lambda V gene segments; or

[0187] (vii) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42 and V1-41, optionally with up to 4 additional feline λV gene segments.

[0188] Additional embodiments disclosed herein are a rodent or rodent cell comprising no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or only 1 V gene segment selected from the following list: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13, and V1-126.

[0189] Another embodiment disclosed herein is a rodent or rodent cell having only 1 feline λV gene segment as listed above and only 1 feline λJ gene segment, forming a "common light chain".

[0190] Another embodiment disclosed herein is a rodent or rodent cell comprising at least 2 feline λV gene segments, such as at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 feline λV gene segments, wherein the feline λV gene segments are selected from V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126. The rodent or rodent cell may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 of the feline lambda gene segments V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126.

[0191] Preferably, the rodent comprises at least one λV gene segment from each of feline λV gene segment families 1 and 3, with no more than 11 feline λV gene segments present in the genome.

[0192] The present invention further relates to:

[0193] A rodent or rodent cell having a genome comprising;

[0194] i) no more than 6 feline kappa V gene segments and one or more feline J region gene segments;

[0195] ii) wherein the rodent or rodent cell is capable of expressing the feline kappa gene segment to form antibody light chains,

[0196] iii) wherein at least one of the feline κ gene segments is selected from V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0197] Table 2c lists the observed frequencies of cat light chain V gene segments. In the rodent genome, one or more of the 6 preferred cat κ gene segments can be combined with any other cat V gene segment. It is not necessary to be limited to the preferred 6 cat κV gene segments, but at least one must be present. The preferred cat gene segment present is V4-1, which is found in more than 27% of the κ chain antibodies in all κ chain antibodies. The preferred alternative cat gene segment is V2-12. These two sequences are found together in more than 50% of the λ antibody chains.

[0198] Another embodiment disclosed herein is a rodent or rodent cell comprising a feline κV

[0199] (i) V4-1, optionally with up to 5 additional feline κV gene segments;

[0200] (ii) V4-1 and V2-12, optionally with up to 4 additional feline κV gene segments;

[0201] (iii) V4-1, V2-12, and V2-5, optionally with up to 3 additional feline κV gene segments;

[0202] (iv) V4-1, V2-12, V2-5, and V2-13, optionally with up to 2 additional feline κV gene segments;

[0203] (v) V4-1, V2-12, V2-5, V2-13, and V2-9, optionally with up to 1 additional feline κV gene segment; or

[0204] (vi) V4-1, V2-12, V2-5, V2-13, V2-4 and V2-4; or

[0205] (vii) V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0206] Additional embodiments disclosed herein are a rodent or rodent cell comprising no more than 5, no more than 4, no more than 3, no more than 2, or only 1 feline κV gene segment selected from V4-1, V2-12, V2-5, V2-13, V2-9, and V2-4.

[0207] Another embodiment disclosed herein is a rodent or rodent cell having only 1 feline κV gene segment as listed above and only 1 feline κJ gene segment, forming a "common light chain".

[0208] Another embodiment disclosed herein is a rodent or rodent cell comprising at least 2 feline κV gene segments, such as at least 3, at least 4, at least 5 or 6 feline κV gene segments, wherein the feline κV gene segments are selected from V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0209] Additional embodiments disclosed herein are a rodent or rodent cell comprising 1, 2, 3, 4, 5 or 6 feline κV gene segments selected from V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0210] Preferably, the rodent comprises a κV gene segment from each of κV gene segment families 2 and 4, suitably including IGKV2-12 and IGKV4-1, with no more than 6 feline κV gene segments present in the genome.

[0211] In another preferred aspect, the rodent genome comprises feline DNA encoding any one or more of the following heavy and light chain pairs that together form greater than 7% of observed antibody chain pairings:

[0212]

[0213]

[0214] The DNA in which the V gene segment number is limited can be referred to as a restricted insertion or a restricted locus in this article. It should be understood that some embodiments of the present invention allow an unlimited number of insertions of the heavy chain V gene segment (when the light chain is restricted), and vice versa, when the heavy chain is restricted, an unlimited number of insertions of the light chain V gene segment is allowed. 1, 2 or all 3 cat insertions may be restricted.

[0215] The number of feline V gene segments located at the restricted locus suitably provides at least 80% coverage of observed antibody sequences, such as at least 85%, 90%, 95%, 97%, 98% or 99% coverage, optionally wherein the coverage of the observed antibody sequences is less than 100%.

[0216] The number of feline V gene segments (which may be a single feline V gene segment) located at the restricted locus suitably provides at least 10% coverage of observed antibody sequences, such as at least 20%, 30%, 40%, 50%, 60% or 70% coverage, optionally wherein the coverage of the observed antibody sequences is less than 100%.

[0217] The number of feline V gene segments located at the restricted locus suitably provides at most 80% coverage of observed antibody sequences, such as at most 85%, 90%, 95%, 97%, 98% or 99% coverage.

[0218] The number of feline V gene segments (which may be a single feline V gene segment) located at the restricted locus suitably provides about 11% coverage of the observed antibody sequences, or about 20%, about 30%, about 40%, about 50%, about 60% or about 70% coverage.

[0219] For example, the rodent or cell genome may comprise a restricted feline heavy chain insertion as disclosed herein in combination with a restricted feline lambda light chain insertion as disclosed herein and / or a restricted feline light chain kappa chain insertion as disclosed herein.

[0220] The rodent or rodent cell genome of the present invention may comprise one or more feline IGHV gene segments as described herein as a restricted insertion, but does not comprise light chain feline DNA, or may comprise one or more feline IG light chain V gene segments as described herein as a restricted insertion, but does not comprise heavy chain feline DNA.

[0221] When the immunoglobulin locus of the rodent or rodent cell genome is not limited by the number of V gene segments, it can have any number (including all) of cat V gene segments. Therefore, the rodent or cell genome can contain a cat heavy chain inserted as disclosed herein in combination with any light chain insertion (such as a full cat light chain) or a cat light chain insertion with more than 11 cat Vλ gene segments and / or more than 6 cat κV gene segments. Alternatively, the rodent or cell genome can contain a cat light chain insertion as disclosed herein in combination with any heavy chain (such as a full cat heavy chain) or a cat heavy chain with more than 9 cat V gene segments.

[0222] For example, when only heavy chain insertion is limited by the number of V gene segments, the light chain locus can have one or more or all light feline V gene segments. It can contain at least 50% (such as at least 60%, at least 70%, at least 80%, at least 90%) of feline light chain lambda variable (V) genes (κ and / or), and on the one hand contain all feline κ and / or λ V genes.

[0223] In one embodiment, the rodent or rodent cell genome may contain at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or at least 100 feline IGλV region genes, optionally functional feline IGλV region genes. In a preferred embodiment, the rodent genome contains at least 78 feline IG light chain λV region genes, optionally functional feline IG light chain λV region genes.

[0224] In one embodiment, the rodent or rodent cell genome may contain at least 5, 6, 7, 8, 9 or at least 10 feline IGκV region genes, optionally functional feline IGκV region genes. In a preferred embodiment, the rodent genome contains at least 10 feline IG light chain κV region genes, optionally functional feline IG light chain κV region genes.

[0225] For example, in the case where only light chain insertion is restricted, the heavy chain locus can have one or more or all heavy chain cat IGH V gene segments. It can include at least 50% (such as at least 60%, at least 70%, at least 80%, at least 90%) cat heavy chain variable (V) genes, and on the one hand include all cat heavy chain V genes. In this regard, rodents or rodent cell genomes can include at least 4, 5, 10, 15 or 20 cat IGH V region genes, such as at least 20, 30, 40 or at least 50 cat IGH V region genes, optionally functional cat IGH V region genes. In a preferred aspect, the rodent genome includes at least 34 cat IG heavy chain V region genes, optionally functional cat IG heavy chain V region genes.

[0226] Where appropriate, references herein to a gene may be references to a gene segment. The use of the term 'gene' is not intended to exclude such features being equivalently disclosed in relation to gene segments unless the context or necessity dictates otherwise.

[0227] Similarly, references herein to a gene segment may be references to a gene, where appropriate. The use of the term 'gene segment' is not intended to exclude such features being equivalently disclosed in relation to a gene, unless the context or necessity dictates otherwise.

[0228] The preferred cat DNA is European Shorthair DNA, and thus preferred cells and rodents contain European Shorthair DNA gene segments, as disclosed herein. The use of European Shorthair regulatory sequences is also preferred. The European Shorthair DNA can be provided as genomic DNA.

[0229] In all embodiments and aspects of the invention, the feline gene segments may be located in the genome upstream of the rodent constant region, suitably upstream of the heavy chain constant region for an inserted feline heavy chain variable region gene segment, and suitably upstream of the light chain constant region for an inserted feline light chain variable region gene segment, such that the rodent or rodent cell is capable of producing a chimeric antibody heavy chain or a chimeric light chain or both resulting from expression of the inserted variable region gene segments and the host constant region.

[0230] Any reference to a position upstream of a variable region of a constant region (such as a rodent constant region) means that the two genomic portions encoding the variable and constant regions of an antibody are in an appropriate relative position to allow expression of the chimeric antibody chain in a rodent. In this way, the inserted cat DNA and constant region are in a functional arrangement with each other to produce an antibody or antibody chain.

[0231] Information about the variable region of the chimeric antibody chain or nucleic acids comprising the variable region can be obtained from cells expressing chimeric antibodies using standard techniques. These sequences can be used to generate full feline antibodies by expressing nucleic acids encoding antibody variable regions with feline constant regions, for example, for therapeutic use in cats.

[0232] The cat DNA can be inserted into the rodent wild-type constant region at the wild-type locus, appropriately between the rodent constant region and the host VDJ or VJ region. The rodent constant region expressed with the cat variable region is preferably a rodent wild-type constant region at the wild-type locus, suitable for a cat heavy or light chain VDJ or VJ. In one aspect, the IGH variable region gene is inserted downstream of the rodent heavy chain J region and upstream of the Eμ enhancer.

[0233] In one aspect, the IGH variable region gene is inserted downstream of the rodent heavy chain J region and upstream of the Eμ enhancer. In one aspect, the rodent is a mouse and the insertion of the IGH V region gene is performed at position 114666435 of the mouse genome on mouse chromosome 12. In one aspect, the insertion of the IGλV region gene is performed at position 19047551 of the mouse genome on chromosome 16. In one aspect, the insertion of the IGκV region gene is performed at position 70674755 of the mouse genome on chromosome 6.

[0234] Preferably, the inserted feline V(D)J gene segments can undergo V(D)J rearrangement to form antibody chains in rodents. However, when inserting a single rearranged heavy or light chain variable region, or inserting a complete antibody chain VDJC or VJC, gene segment rearrangement may not be required.

[0235] In a preferred embodiment, the rodent (or rodent cell) of the present invention is a mouse (or mouse cell).

[0236] Alternatively, the inserted feline gene segments are located (inserted) in the genome in a functional arrangement with feline constant regions, such that the rodent is capable of producing antibody chains produced by expression of the inserted feline VDJ gene segments with feline constant regions, and / or antibody chains produced by expression of the inserted feline VJ gene segments with feline constant regions.

[0237] One possibility is the expression of a whole feline antibody light chain with a chimeric heavy chain having a feline VDJ and a rodent heavy chain constant region. One possibility is the expression of a whole feline antibody heavy chain with a chimeric light chain having a feline VJ and a rodent heavy chain constant region.

[0238] References herein to 'inserted feline gene segments' and 'inserted feline DNA' refer to feline sequences that are present in the genome of a rodent or a rodent cell and thus have been inserted into the genome of a rodent or a rodent cell.

[0239] In one aspect, the inserted feline DNA comprises at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%) of a feline heavy chain diversity (D) gene, and in one aspect comprises all of the feline D genes.

[0240] In one aspect, the inserted feline DNA comprises at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%) of the feline heavy chain joining (J) gene, and in one aspect comprises all of the feline J gene.

[0241] In one aspect, the inserted feline DNA comprises at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%) of a feline light chain joining (J) gene, and in one aspect comprises all of a feline light chain J gene.

[0242] The rodent or rodent cell genome may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 IGHD region gene segments from a cat.

[0243] The rodent or rodent cell genome may comprise at least 1, 2, 3, 4 or 5 IGHJ region genes from a cat.

[0244] The rodent or rodent cell genome may comprise at least 1, 2, 3, 4 or 5 IGκJ region genes from a cat.

[0245] The rodent or rodent cell genome may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 IGλJ region genes from a cat.

[0246] In any aspect, the number of cat genes mentioned above can be further increased, and in one aspect, in the case of homozygotes having insertions at both alleles, the number is doubled.

[0247] One possible insertion of feline V gene segments as described above is upstream of rodent constant regions to generate chimeric antibody chains expressed at an endogenous locus.

[0248] In other aspects, the inserted cat DNA is located in the rodent genome at a different site than the naturally occurring heavy or light constant region, such as on a different chromosome. The insertion can be at a random position in the rodent genome. In this case, the insertion of the VDJ or VJ region gene from the rodent or from the cat is accompanied by the constant region and preferably also accompanied by a 3' enhancer.

[0249] A preferred embodiment is to use rodent constant regions and rodent 3' enhancers with feline VDJ or VJ regions, or to use feline constant regions and feline 3' enhancers with feline VDJ or VJ regions. In one aspect, the feline gene segments are located in the genome in a functional arrangement with the constant regions, enabling the rodent to produce antibody chains.

[0250] The invention also specifically contemplates cells and rodents having an insertion of feline genes (such as DNA encoding feline λV and J and C genes) associated with feline constant regions (encoding "full" feline antibody chains) at the endogenous rodent IG locus.

[0251] In one aspect, the full feline VJC lambda antibody chain described above is inserted into a rodent lambda locus, preferably between the last rodent C gene and the 3' enhancer.

[0252] In one aspect, the rodent or rodent cell comprises one or more cat IGλV region genes, one or more cat IGλJ region genes and one or more cat λ constant region genes located in the rodent cell κ locus (e.g., located within the locus or upstream or downstream of the rodent κ constant region). Preferably, the insertion is located upstream of the IGκ locus constant region so that the IGλV and J region genes are expressed together with the IGκ constant region.

[0253] Suitably, the insertion of the cat genes is located at approximately the same position as the native rodent κ genes, which may be deleted or replaced, for example, the distance from the last inserted 3'λJ gene to the rodent κ constant region gene is the same or substantially the same as the distance from the last rodent κ 3'J gene to the κ constant region.

[0254] In one aspect, the insertion is within 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb or 10 kb of the border (upstream or downstream) of the rodent immunoglobulin kappa locus. The natural expression level of rodent kappa light chains is higher than that of rodent lambda light chains, and the insertion of cat DNA at this kappa locus can provide high-level expression of cat lambda chain V region genes.

[0255] In one aspect, the feline λV and / or J gene segments are associated with feline regulatory sequences or scaffold sequences. In another aspect, the feline λV and / or J gene segments are associated with regulatory sequences or scaffold sequences from rodents (e.g., regulatory sequences or scaffold sequences that are native to rodent cells used to insert feline DNA).

[0256] In one aspect where the cat λV gene is inserted into the rodent κ locus, the rodent κ locus or a portion thereof may be deleted or rendered non-functional, for example by mutation. For example, in WO2021003149 (in the context of dogs), inactivating or rendering non-functional the endogenous mouse or rodent κ light chain locus to increase the expression of λ light chains is described, and the same applies to cats.

[0257] Reference herein to a gene segment associated with a regulatory sequence or scaffold sequence, and similar such statements, refers to a gene segment operably linked to the regulatory sequence or scaffold sequence. In this context, the term 'associated' means 'operably linked' and is interchangeable therewith.

[0258] In one aspect, the rodent genome is homozygous for the inserted feline gene. Such homozygous rodents are preferred for producing feline antibodies by immunization.

[0259] The insertion may be made at the native rodent IG locus. On the other hand, the rodent genome may be heterozygous for the insertion of a cat gene at one or two or three loci, such as the immunoglobulin loci.

[0260] The rodent genome may be heterozygous for the insertion of the cat gene at the kappa locus.

[0261] Wherein the inserted feline DNA at the restricted IgH locus comprises at least 4 IGH variable region genes, preferably one of which is V3-14.

[0262] On the one hand, the rodent genome is modified to reduce or prevent the expression of full rodent antibodies with both variable and constant regions from rodents. This can be achieved by inversion of all or part of the rodent VDJ region and / or VJ region, or by deletion of all or part of the rodent VDJ region and / or VJ region, or by insertion into the endogenous rodent VDJ and / or VJ region of the genome. For example, inserting cat DNA at the IG locus upstream of the rodent constant region will further move the host rodent V (D) and J gene segments away from the rodent constant region and reduce the host rodent antibody expression from the locus or inactivate the host rodent antibody expression.

[0263] In one aspect, the rodent has a VDJ or VJ region or a portion thereof missing.

[0264] On the one hand, all or a certain number of rodent V region genes are deleted, such as:

[0265] At least 50%, preferably at least 75% or at least 90% or all of the rodent IGH V gene segments and / or D gene segments and / or J gene segments, and / or

[0266] At least 50%, preferably at least 75% or at least 90% or all of the rodent IG light chain V gene segments and / or J gene segments from λ and / or κ.

[0267] In one aspect, the rodent is a mouse and the genome comprises a deletion of one or some or all of the mouse IGH V region genes (preferably from V1-85 to V5-2).

[0268] In one aspect, the rodent is a mouse and the genome comprises a deletion of one or some or all of the mouse IGκV region genes (preferably from V3-1 to V2-137).

[0269] In one aspect, the rodent is a mouse and the mouse heavy chain D and J region genes are retained in the genome upstream of the inserted feline heavy chain variable region genes.

[0270] On the one hand, the rodent IGλ gene has not been deleted from the rodent genome.

[0271] In one aspect, one or both alleles of the rodent kappa locus are deleted or inactivated in whole or in part by inserting feline DNA at the rodent kappa locus.

[0272] In one aspect, the rodent kappa locus is fully or partially inactivated, e.g., by insertion, deletion, or inversion.

[0273] In one aspect, the rodent lambda locus is fully or partially inactivated, such as by insertion, deletion, or inversion.

[0274] In one aspect, the rodent heavy chain locus is fully or partially inactivated, e.g., by insertion, deletion, or inversion.

[0275] The feline variable region gene segments are appropriately inserted upstream of the rodent constant region, the latter comprising all of the DNA necessary to encode the entire constant region or a portion of the constant region sufficient to allow the formation of an effective chimeric antibody capable of specifically recognizing the antigen.

[0276] Therefore, the chimeric antibodies or antibody chains mentioned herein with rodent constant regions are not limited to antibody chains with complete constant regions, but also include chimeric antibodies or chains with a portion of a constant region sufficient to provide one or more effector functions seen in antibodies naturally present in rodents. Effector functions include the ability to interact with Fc receptors and / or to bind complement. Similarly, cat variable region DNA can be located in the host genome so that it forms a chimeric antibody chain with all or part of the rodent constant region, thereby forming an antibody chain or part thereof, respectively.

[0277] Preferably, the rodent genome comprises all of the feline heavy constant region DNA and the intervening region. Preferably, the rodent genome comprises all of the feline heavy constant region genes and the intervening region.

[0278] Preferably, the rodent genome comprises all of the feline lambda constant region DNA and the intervening region. Preferably, the rodent genome comprises all of the feline lambda constant region genes and the intervening region.

[0279] Preferably, the rodent genome comprises all of the feline kappa constant region DNA and the intervening region. Preferably, the rodent genome comprises all of the feline kappa constant region genes and the intervening region.

[0280] On the one hand, the inserted feline DNA can be expressed with different rodent constant regions through isotype switching.

[0281] On the one hand, the inserted feline DNA can be expressed together with different rodent constant regions through trans-switching.

[0282] In one embodiment, one or more or all of the inserted feline V, D or J region gene segments are associated with feline regulatory sequences, preferably from the same cat breed.

[0283] In one aspect, at least one rodent enhancer or other control sequence (such as a switch region) is maintained in a functional arrangement with a rodent constant region. In this way, the effect of the enhancer or other control sequence can be fully or partially exerted in a cell or transgenic rodent.

[0284] In one aspect, one or more rodent control sequences (such as the Eμ enhancer sequence) are maintained upstream of the rodent μ constant region, appropriately positioned in its natural position relative to its distance from the constant region.

[0285] In one aspect, one or more rodent control sequences (eg, enhancer sequences) are maintained downstream of the rodent constant region, appropriately positioned in its natural position relative to its distance from the constant region.

[0286] In one aspect, the rodent Sμ switch sequence is maintained upstream of the rodent μ constant region, appropriately positioned in its natural position relative to the distance from the constant region. In such a position, the rodent enhancer or switch sequence functions appropriately in vivo with the host constant region sequence.

[0287] In an additional aspect, one or more promoter elements or other control elements of a feline V, D or J region gene are optimized in the genome to interact with the transcriptional machinery of a rodent.

[0288] In one aspect, the rodent or rodent cell genome comprises one or more feline promoters or enhancers, and / or other control elements associated with feline V, D or J gene segments.

[0289] In one aspect, one or more feline control regions (elements) (such as promoters or enhancers or switch regions) replace one or more rodent promoters or enhancers or switch regions, respectively. The feline control sequences are appropriately maintained in a functional arrangement with the constant region so that the effects of the control sequences can be fully or partially exerted in cells or transgenic rodents.

[0290] In one aspect, at least one or more of the inserted feline V, D or J gene segments are associated with a regulatory sequence, such as a recombination signal sequence (RSS), from the same cat, optionally wherein the regulatory sequence directs successful recombination of the one or more V, D or J gene segments.

[0291] On the one hand, 'same' cat refers to cats of the same breed. On the other hand, identical cats refer to exactly the same animal.

[0292] In one aspect, at least one or more of the inserted feline V, D or J gene segments are directly associated in cis or trans with a regulatory sequence, or are flanked on one or both sides by a regulatory sequence, optionally wherein one or more of the gene segments are directly flanked by a regulatory sequence.

[0293] In one aspect, the regulatory sequence comprises a promoter preceding an individual V gene segment, and / or a splice site within an individual V gene segment, and / or a recombination signal sequence for V(D)J recombination downstream of a V gene segment, flanking a D gene segment, or upstream of a J gene segment.

[0294] In one aspect, the V, D or J sequences of the inserted cat DNA are flanked by RSS sequences from the same cat. For example, a cat RSS sequence can be used with a cat V, D and / or J sequence. It will be appreciated that this can be provided by inserting a genomic fragment from a cat into a rodent genome.

[0295] In a further aspect, the invention provides a method for replacing the endogenous immunoglobulin variable region locus in a rodent cell with a feline locus, in whole or in part, the method comprising: obtaining a cloned genomic fragment or synthetic sequence containing a companion locus, in whole or in part, the companion locus comprising at least one V or D (for heavy chain) or J gene segment and at least one associated regulatory sequence, and inserting the feline DNA into the genome of the rodent, appropriately at the endogenous rodent immunoglobulin locus, preferably at a heavy chain or light chain rodent locus corresponding to the properties of the inserted feline DNA.

[0296] On the one hand, the inserted cat DNA is associated with rodent regulatory sequences that allow V(D)J recombination in rodents. For example, such methods are disclosed in US20170306352 (the context is dogs), and the same applies to cats, which is incorporated by reference.

[0297] In one aspect, the regulatory sequence is a non-coding regulatory sequence comprising the following endogenous host-derived sequences: a promoter, introns, splice sites, and a recombination signal sequence for V(D)J recombination preceding each V gene segment coding sequence. In another aspect, the regulatory sequence is one or more of the following: a promoter, introns, splice sites, and a recombination signal sequence for V(D)J recombination preceding each V gene segment coding sequence, all of which are endogenous host-derived.

[0298] In another aspect, the partial feline immunoglobulin locus generated by the invention comprises one or more of the following endogenous host-derived sequences: an ADAM6A or ADAM6B gene, a Pax-5 activated intergenic repeat (PAIR) element, or a CTCF binding site from the heavy chain intergenic control region 1.

[0299] In one aspect, the present invention relates to a transgenic rodent (e.g., a mouse) in whose genome the entire endogenous immunoglobulin variable locus has been deleted and replaced by a partially engineered feline immunoglobulin locus comprising feline immunoglobulin variable gene VH, D and JH and / or feline VL and JL coding sequences as described herein and rodent immunoglobulin variable locus non-coding regulatory sequences, wherein the partially engineered feline immunoglobulin locus of the transgenic rodent is functional and expresses immunoglobulin chains comprising feline variable domains and rodent constant domains.

[0300] The rodent may be a mouse as described in US20170306352, the disclosure of which is incorporated by reference.

[0301] The rodent may be a mouse as described in WO2021003149, the disclosure of which is incorporated by reference.

[0302] In one aspect, the inserted cat DNA at the restricted locus is not a genomic DNA fragment. In order to insert one or more gene segments with the highest native expression, the inserted DNA can include DNA in which the gene segments are not in their natural germline configuration and genomic DNA. For example, the inserted cat DNA can be a minigene with multiple different V gene segments.

[0303] The inserted cat V gene segment at the restricted locus can be arranged together with one or more gene segments that are most concerned about the closest constant region. For example, the IGHV 3-14 gene segment can be positioned closest to the constant region to maximize expression. The gene segment positioned closer to the constant region is usually expressed at a higher level. Alternatively, the gene segment with the highest natural occurrence in the cat antibody population can be positioned farther from the constant region to provide a balanced library.

[0304] The present invention provides a rodent or rodent cell that expresses a limited number of preferred V gene segments, such as one gene segment, and as a preferred feature, includes only a single V, D and J gene segment for the heavy chain variable region and / or a single V and J gene segment for the light chain variable region in the genome. In this way, the rodent will only produce a single type of heavy chain variable region of the feline antibody chain produced, and / or a single type of light chain variable region.

[0305] On the one hand, the term 'single type of variable region' refers to a variable region that has only one V, (one D) and one J gene segment sequence.

[0306] Such an arrangement can provide a common light chain that can be used to generate bispecific antibodies where a single light chain is desired and is expressed together with two different heavy chains in the bispecific antibody.

[0307] Therefore, the present invention also relates to a method for producing bispecific antibodies, which method comprises immunizing a rodent as disclosed herein, whose rodent genome contains only a single type of feline light chain variable region (a single feline V and J gene segment, feline VJ), with an antigen, and selecting a bispecific antibody capable of binding to the antigen and, appropriately, also to a second preferred antigen target.

[0308] The present invention also relates to bispecific antibodies obtained or obtainable from the methods of the present invention, wherein the antibody light chains are obtained from the expression of preferred V gene segments as disclosed herein, suitably obtained from the rodents of the present invention. Suitably, the bispecific has preferred light and heavy chain pairings as disclosed herein.

[0309] Any bispecific antibody format may be used, such as any of those disclosed in Brinkmann U and Kontermann RE, MAbs. 2017 Feb-Mar;9(2):182-212.

[0310] The selection of feline V gene segments for the common light chain can be based on frequency (Table 2b and Table 2c), the number of different heavy chain feline V gene segment pairings (Table 4), or a combination of both.

[0311] On the other hand, the present disclosure explicitly contemplates the use of IGHV3-16 (SEQ ID NO:45) instead of IGHV3-N3 (SEQ ID NO:8). For the purposes of this aspect of the invention, references herein to IGHV3-N3 or SEQ ID NO:8 may also be considered as references to IGHV3-16 or SEQ ID NO:45.

[0312] On the other hand, the present disclosure explicitly contemplates the use of IGLV1-N1 (SEQ ID NO:46) instead of IGLV1-33 (SEQ ID NO:13). For the purposes of this aspect of the invention, references herein to IGLV1-33 or SEQ ID NO:13 may also be considered as references to IGHV1-N1 or SEQ ID NO:46.

[0313] On the other hand, the present disclosure explicitly contemplates the use of IGLV1-N14 (SEQ ID NO:47) instead of IGLV1-41 (SEQ ID NO:16). For the purposes of this aspect of the invention, references herein to IGLV1-41 or SEQ ID NO:16 may also be considered references to IGHV1-N14 or SEQ ID NO:47.

[0314] The present disclosure also expressly contemplates the use of IGHV3-16 (SEQ ID NO:45) instead of IGHV3-N3 (SEQ ID NO:8), the use of IGLV1-N1 (SEQ ID NO:46) instead of IGLV1-33 (SEQ ID NO:13), and the use of IGLV1-N14 (SEQ ID NO:47) instead of IGLV1-41 (SEQ ID NO:16).

[0315] The term "bispecific antibody" means an antibody comprising specificities for two target molecules, and includes forms such as DVD-Ig (see DiGiammarino et al., "DVD-Ig for Bispecific Targeting"). TM Design and generation of DVD-Ig molecules TMmolecules for dual-specific targeting), "Meth. Mo. Biol.", 2012, 889, 145 156), mAb2 (see WO2008 / 003103), FIT-Ig (see WO2015 / 103072), mAb-dAb, docking and locking, Fab-arm exchange, SEEDbody, trifunctional antibody, LUZ-Y, Fcab, κλ body, orthogonal Fab, sc bifunctional antibody-Fc, bifunctional antibody Fc, tandem scFv-Fc, Fab-scFv-Fc, Fab-scFv, intracellular antibody, BiTE, bifunctional antibody, DART, TandAb, sc bifunctional antibody, sc bifunctional antibody-CH3, bifunctional antibody-CH3, triplet, mini antibody, mini antibody, TriBi mini antibody, scFv-CH3 KIH, scFv-CH-CL-scFv, F(ab')2-scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCab, ImmTAC, knobs-in-holes, knobs-in-holes with common light chain, knobs-in-holes with common light chain and charge pair, charge pair, charge pair with common light chain, DT-IgG, DutaMab, IgG(H)-scFv, scFv-(H)IgG, IgG(L)-scFv, scFv-(L)IgG, IgG(L,H)-Fv, IgG(H)-V, V(H)-IgG, IgG(L)-V, V(L)-IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig and zybody. For a review of bispecific formats, see Spiess, C. et al., Mol. Immunol. (2015).

[0316] In another embodiment, the bispecific molecule comprises an antibody fused to another non-Ig format, such as a T cell receptor binding domain; an immunoglobulin superfamily domain; an agnathous variable lymphocyte receptor; a fibronectin domain (e.g., Adnectin TM ); antibody constant domains (e.g., CH3 domains, e.g., Fcab TM CH2 and / or CH3), wherein the constant domain is not a functional CH1 domain; scFv; (scFv)2; sc-bifunctional antibody; scFab; centrosome protein (centyrin) and derived from CTLA-4 (Evibody TM ) of a scaffold; a lipocalin domain; a protein A, such as a Z domain of protein A (e.g., an AffibodyTM or SpA); A domain (e.g., Avimer TM or Maxibody TM ); heat shock proteins (e.g., epitope binding domains derived from GroEI and GroES); transferrin domains (e.g., trans-isomers); ankyrin repeat proteins (e.g., DARPin TM ); polypeptide aptamers; C-type lectin domains (e.g., Tetranectin TM ); human γ-crystallin or human ubiquitin (avidin); a PDZ domain; a scorpion toxin; and a Kunitz-type domain of a human protease inhibitor.

[0317] Antibody structure has been used to engineer various antibody formats to target human diseases. An example of such an engineered antibody format is a bispecific antibody. Bispecific antibodies bind to two different targets and are therefore able to bind to two different epitopes simultaneously. An area of ​​interest is bispecific antibodies directed to T cells for effective tumor killing. Bispecific antibodies can have "dual targeting" functionality and bind to two different surface receptors or ligands to affect a variety of disease pathways.

[0318] Bispecific antibodies can also place two targets in very close proximity to support the formation of protein complexes on a cell or to trigger contact between cells. The forms of bispecific antibodies differ in many aspects, including their molecular weight, the number of antigen binding sites, the spatial relationship between different binding sites, the titer of each antigen, the ability to support secondary immune function, and the pharmacokinetic half-life. These different forms provide great opportunities for customizing the design of bispecific antibodies to match the proposed mechanism of action and the expected clinical application, (Kontermann and Brinkmann "Current Bispecific Antibody Drug Discovery (Bispecific Antibodies Drug Discovery Today)", Vol. 20, No. 7, 2015).

[0319] The bispecific antibodies of IgG type produced by co-expressing two light chains and two heavy chains in a single host cell may be very challenging, because the yield of the desired bispecific IgG is low, and it is difficult to remove the closely related mispairing IgG contaminants. This reflects that the heavy chain forms homodimers and desired heterodimers, the so-called heavy chain pairing problem. Additionally, the light chain may be mispaired with non-homologous heavy chains, the so-called light chain pairing problem. Therefore, in addition to the desired bispecific antibodies, the co-expression of two antibodies can produce up to nine unwanted IgG species.

[0320] Various methods are described in the art to promote heterodimerization, ie the formation of certain bispecific antibodies of interest for use in human therapy, thereby reducing the content of undesired homodimers in the resulting mixture.

[0321] In one embodiment, the antibody is a multispecific antibody or a fragment thereof. A multispecific protein (e.g., a multispecific antibody) binds to at least two different targets, i.e., is at least bispecific. Thus, in one embodiment, the antibody is a bispecific antibody or a fragment thereof. In other embodiments, a multispecific antibody or a fragment thereof binds to three, four or more targets.

[0322] Bispecific antibodies have specificity for no more than two epitopes. Bispecific antibodies are characterized by a first immunoglobulin variable domain sequence that has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.

[0323] In one embodiment, the first epitope and the second epitope are on the same antigen, such as the same protein (or subunit of a multimeric protein). In one embodiment, the first epitope and the second epitope overlap. In one embodiment, the first epitope and the second epitope do not overlap. In one embodiment, the first epitope and the second epitope are on different antigens, such as different proteins (or different subunits of a multimeric protein).

[0324] In another embodiment, the bispecific antibody comprises a heavy chain variable domain sequence and a light chain variable domain sequence having binding specificity to a first epitope, and a heavy chain variable domain sequence and a light chain variable domain sequence having binding specificity to a second epitope. In another embodiment, the bispecific antibody molecule comprises an antibody having binding specificity to a first epitope and an antibody having binding specificity to a second epitope. In one embodiment, the bispecific antibody molecule comprises an antibody or fragment thereof having binding specificity to a first epitope and a half antibody or fragment thereof having binding specificity to a second epitope. In one embodiment, the bispecific antibody or fragment thereof comprises a Fab having binding specificity to a first epitope and a Fab having binding specificity to a second epitope.

[0325] The bispecific antibodies (comprising two heavy chains and two light chains) of the present invention based on the IgG form can be produced by various methods known in the art. For example, bispecific antibodies can produce new cell lines by fusing two cell lines that secrete antibodies, or by expressing two antibodies in a single cell using recombinant DNA technology. These methods produce multiple antibody species, because the corresponding heavy chain from each antibody can form a monospecific dimer (also referred to as homodimer) containing two heavy chains with the same pairing of the same specificity and a bispecific dimer (also referred to as heterodimer) containing two heavy chains with different pairings of different specificities. In addition, the light chain and heavy chain from each antibody can be randomly paired to form an inappropriate, non-functional combination. This problem is referred to as heavy chain and light chain mismatch, which can be solved by selecting antibodies that share a common light chain as bispecific expression. The method for solving the problem of light chain-heavy chain mismatch includes using a single light chain to produce bispecific antibodies. This requires heavy chain-light chain engineering or a novel antibody library that utilizes a single light chain that limits diversity. In addition, antibodies with a common light chain have been identified from transgenic mice with a single light chain. Another approach is to exchange the CH1 domain of one heavy chain with the CL domain of its cognate light chain (Crossmab technology). scFv formats are also contemplated.

[0326] Methods for preparing bispecific antibodies are described in WO2019008123 and WO2014160179, which are incorporated by reference.

[0327] The present invention also relates to a method for producing a bispecific antibody, the method comprising immunizing a first rodent as disclosed herein with a first antigen, the rodent genome of the rodent comprising only a single feline lambda light chain variable region (a single feline V and J gene segment, feline VJ), and selecting antibodies capable of binding to the first antigen, and immunizing a second rodent as disclosed herein with a second antigen, the rodent genome of the rodent comprising the same single feline lambda light chain variable region (a single feline V and J gene segment, feline VJ), and selecting antibodies capable of binding to the second antigen, optionally wherein the single feline lambda light chain V gene segment is selected from the list comprising: feline lambda V1-124, V3-7, V1-42, V1-104, V1-56, V1-126, V3-13, V3-5, V3-36, V1-41 and V1-33.

[0328] In one aspect, the single lambda feline light chain V gene segment is V1-124.

[0329] In one aspect, the single lambda feline light chain V gene segment is V3-7.

[0330] The present invention also relates to bispecific antibodies obtained or obtainable from the methods of the present invention, wherein the feline antibody light chain is obtained from the expression of a single preferred lambda V gene segment as disclosed herein, suitably obtained from a rodent of the present invention. Suitably, the bispecific has a preferred light chain and heavy chain pairing as disclosed herein. In one aspect, the single lambda feline V gene segment is selected from a list comprising: feline lambda V1-124, V3-7, V1-42, V1-104, V1-56, V1-126, V3-13, V3-5, V3-36, V1-41 and V1-33.

[0331] The invention provides a rodent or rodent cell comprising a single cat lambda V and J of a light chain variable region in the genome. In this way, the rodent will only produce a single type of light chain variable region of the feline antibody chain produced. In one aspect, the single cat lambda light chain V gene segment is V1-124. In one aspect, the single lambda cat light chain V gene segment is V3-7.

[0332] The present invention also relates to a method for producing bispecific antibodies, the method comprising immunizing a first rodent as disclosed herein with a first antigen, the rodent genome of the rodent comprising only a single feline κ light chain variable region (single feline V and J gene segments, feline VJ), and selecting antibodies capable of binding to the first antigen, and immunizing a second rodent as disclosed herein with a second antigen, the rodent genome of the rodent comprising the same single feline κ light chain variable region (single feline V and J gene segments, feline VJ), and selecting antibodies capable of binding to the second antigen, optionally wherein the single feline κ light chain V gene segment is selected from the list comprising: feline κ V2-5, V2-9, V2-12, V2-13, V4-1 and V2-4.

[0333] In one aspect, the single kappa feline light chain V gene segment is V4-1.

[0334] In one aspect, the single kappa feline light chain V gene segment is V2-5.

[0335] The present invention also relates to bispecific antibodies obtained or obtainable from the methods of the present invention, wherein the feline antibody light chain is obtained from the expression of a single preferred κV gene segment as disclosed herein, suitably obtained from a rodent of the present invention. Suitably, the bispecific has a preferred light chain and heavy chain pairing as disclosed herein. In one aspect, the single κ feline V gene segment is selected from a list comprising: feline κ V2-5, V2-9, V2-12, V2-13, V4-1 and V2-4.

[0336] The invention provides a rodent or rodent cell comprising a single feline kappa V and J light chain variable region in the genome. In this way, the rodent will only produce a single type of light chain variable region for the feline antibody chain produced. In one aspect, the single feline kappa light chain V gene segment is V4-1. In one aspect, the single lambda feline light chain V gene segment is V2-5.

[0337] The present invention also relates to bispecific antibodies, wherein the two light chains are identical and are selected from the list comprising feline lambda V1-124, V3-7, V1-42, V1-104, V1-56, V1-126, V3-13, V3-5, V3-36, V1-41 and V1-33.

[0338] In one embodiment, both light chains are feline lambda V1-124.

[0339] In one embodiment, both light chains are feline λV3-7.

[0340] The present invention also relates to bispecific antibodies, wherein the two light chains are identical and are selected from the list comprising feline kappa V2-5, V2-9, V2-12, V2-13, V4-1 and V2-4.

[0341] In one embodiment, both light chains are feline λV4-1.

[0342] In one embodiment, both light chains are feline λV2-5.

[0343] In one aspect, the rodent cells of the invention are rodent ES cells, rodent hematopoietic stem cells, or other cells capable of developing into cells capable of producing a library of antibody chains comprising variable regions encoded by cat DNA (e.g., chimeric antibody heavy chains or chimeric antibody light chains, or full cat antibody chains or antibodies encoded by cat variable regions having variable regions and constant regions).

[0344] In one aspect, the cells of the invention are rodent ES cells or induced pluripotent stem cells (iPS cells). Such cells are suitable for insertion of cat DNA to produce rodents expressing antibody chains as described herein.

[0345] In one aspect, the cell is an isolated rodent cell.

[0346] In one aspect, the cell is an isolated rodent B cell.

[0347] The rodent or rodent cell of the present invention is preferably a mouse or rat, or a mouse or rat cell (such as a mouse or rat ES cell), and is preferably a mouse or mouse ES cell. The ES cell can be a mouse cell strain 129 or C57BL, such as strain C57BL / 6N, C57BL / 6J, 129S5 or 129Sv, or a cell having a hybrid genome comprising 129 and / or C57BL genomic DNA.

[0348] The invention also relates to cell lines, including immortalized cell lines, grown from or derived from the cells as described herein.

[0349] The cells or cell lines of the invention may comprise feline V, (D) or J genes in an unrearranged configuration or rearranged after in vivo maturation.

[0350] The present invention also relates to a cell or cell line (such as a CHO cell line) expressing an antibody chain with a variable region, the antibody chain can be obtained by immunizing a rodent of the present invention with an antigen, or the nucleic acid sequence of the variable region can be or has been identified from a rodent or rodent cell as described herein or an antibody library as described herein. The antibody chain can be a chimeric antibody heavy chain or preferably a full cat antibody chain. The cell or cell line expressing the antibody chain or antibody can be a CHO cell or other mammalian cell line suitable for producing an animal therapeutic agent. The cell can be immortalized by fusion with a tumor cell to provide cells and cell lines that produce antibodies, or prepared by direct cell immortalization.

[0351] The present invention further relates to vectors for the present invention. On the one hand, such vectors are bacterial artificial chromosomes (BACs) comprising all or part of the cat IG loci suitable for insertion into ES cells. It should be understood that other cloning vectors may also be used in the present invention, and therefore BACs mentioned herein generally refer to any suitable vector. The vector may comprise one or more selectable markers and / or one or more site-specific recombination sites. On the one hand, the vector comprises 2 or more (such as 3) heterologous specific and incompatible site-specific recombination sites. On the one hand, the site-specific recombination site may be a loxP site or a variant thereof or a FRT site or a variant thereof. On the one hand, the vector comprises one or more transposon ITR (inverted terminal repeat) sequences.

[0352] Suitable BACs containing feline DNA are available from the FCAB library of Amplicon Express, now available through the College of Veterinary Medicine and Biomedical Sciences at Texas A&M University.

[0353] In one aspect, some or all of the inserted DNA is from a European Shorthair cat.

[0354] Preferably, the cell or rodent comprises feline V, D and J gene segments from the FCAB BAC library from Amplicon Express, now available through the College of Veterinary Medicine and Biomedical Sciences at Texas A&M University.

[0355] In one aspect, the one or more cat gene segment alleles used in the present invention are reference alleles for each cat gene. In one aspect, these alleles are FelisCatus8.0 assembled in November 2014, see assembly accession GCA_000181335.3. In one aspect, these alleles are FelisCatus9.0 assembled in November 2017, see assembly accession GCF_000181335.3.

[0356] In one aspect, at least 90%, at least 95%, and preferably all of the inserted cat gene segments are from the CanFam3.1 reference allele. In one aspect, at least 50%, 60%, 70%, 80%, 90% or 100% of the inserted V gene segments are cat V gene reference alleles, and / or at least 50%, 60%, 70%, 80%, 90% or 100% of the inserted D gene segments are cat D gene reference alleles, and / or at least 50%, 60%, 70%, 80%, 90% or 100% of the inserted J gene segments are cat J gene reference alleles, and combinations thereof.

[0357] In one aspect, reference to a cat gene segment (such as IGHV3-14) is a reference to an equivalent gene segment of FelisCatus8.0 or FelisCatus9.0. However, it should be understood that such sequences may differ from the exact sequence of FelisCatus8.0 or FelisCatus9.0, such as 99% identical, 98% identical, 97% identical, 96% identical, or 95% identical.

[0358] In one aspect, a reference to a feline gene segment (such as IGHV3-14) is a reference to a gene segment having the relevant sequence in Table 1.

[0359] In one aspect, a reference to a feline gene segment (such as IGHV3-14) is a reference to a gene segment having a relevant sequence in Table 1, or having 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0360] In one aspect, the rodent or rodent cell comprises a reference allele of one or more feline gene segments.

[0361] Preferably, the V(D) and J region gene segments inserted into the genome are both from the same breed of cat or the same cat.

[0362] On the one hand, rodents are able to produce at least 1×106 The diversity of different functional chimeric immunoglobulin sequence combinations.

[0363] It should be noted that references herein to 'cat' or references herein to 'feline' are intended to be interchangeable and both terms refer to the domestic cat (Felis catus).

[0364] The invention also relates to methods for making rodents comprising inserted feline DNA, methods for making antibodies and antibody chains from these rodents, and methods for making pharmaceutical compositions comprising feline antibody chains or antibodies.

[0365] A method for producing a rodent or rodent cell as disclosed herein, the method comprising inserting into the genome of a rodent cell

[0366] (i) no more than 9 feline IGH V gene segments, one or more feline IGH D region gene segments, and one or more feline IGH J region gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5; and / or

[0367] (ii) no more than 11 feline lambda V gene segments and one or more feline lambda J region gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126; and / or

[0368] (iii) no more than 6 feline κ V gene segments and one or more feline J region gene segments, wherein at least one of the feline κ gene segments is selected from V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4;

[0369] And wherein the rodent or rodent cell is capable of expressing one or more feline variable region gene segments that combine with constant regions to form antibody chains.

[0370] Methods for targeting exogenous DNA into endogenous rodent loci so that the inserted V, D and J genes can be expressed together with the host constant region are well known in the art. The same principle can also be used for the insertion of feline DNA. See Murphy et al., Vol. 111, No. 14, 5153-5158, doi: 10.1073 / pnas.1324022111; MacDonald et al., Vol. 111, No. 14, 5147-5152, doi: 10.1073 / pnas.1323896111; and Lee et al., Nature Biotechnology, Vol. 32, pp. 356-363, Year of Publication: 2014 DOI:, doi: 10.1038 / nbt.2825. Suitable methods for constructing chimeric IG loci encoding feline VDJ and / or VJ gene segments with constant regions are disclosed in WO2018189520, the methods of which are incorporated herein by reference.

[0371] Preferably, the method involves inserting light and heavy chain feline VDJ and VJ region genes, respectively, so that antibodies are produced in which both the light and heavy chains have variable regions derived from expression of feline DNA.

[0372] In one aspect, rodent ES cells carrying one or more chimeric loci are used to prepare chimeras in which host embryos are produced from a RAG-1 deficient background or other suitable genetic background that prevents the production of mature host B and T lymphocytes. This allows all B cells and T cells to be derived from the injected ES cells.

[0373] The ES cells of the invention can be used to produce animals using techniques well known in the art, which can, for example, comprise injecting the ES cells into blastocysts, followed by implanting the chimeric blastocysts into females to produce offspring, which can be cultured to produce heterozygous offspring, which can then be crossed to produce homozygous recombinants having the desired insertion. In one aspect, the host blastocyst is Rag-deficient, such as RAG-1-deficient.

[0374] The present invention relates to a chimeric rodent produced by injecting the ES cells of the present invention into blastocysts and subsequently implanting the chimeric blastocysts into female rodents to produce offspring.

[0375] In a preferred aspect, the rodent or rodent cell is a mouse or mouse cell, and the mouse ADAM6a and ADAM6b genes are present in the mouse genome and were not previously deleted and then reinserted from the IGH locus.

[0376] In one aspect, the rodent ADAM6a and ADAM6b genes are located 5' to the inserted one or more feline V, D and J genes.

[0377] In one aspect, the rodent IGH D and J genes are present in the rodent genome. In one aspect, the rodent IGHD and J genes are not deleted from the rodent genome. In one aspect, the rodent IGH D and J genes are located at the 5' position of the inserted one or more feline V, D and J gene segments.

[0378] The present invention also relates to a method for producing an antibody or antibody chain specific for a desired antigen, the method comprising immunizing a rodent as disclosed herein with the desired antigen and recovering the antibody or antibody chain alone or as part of an intact antibody, or recovering cells producing the antibody or antibody chain alone or as part of an intact antibody (see, e.g., Harlow, E. and Lane, D. 1998, 5th ed., Antibodies: A Laboratory Manual, Cold Spring Harbor Lab. Press, Plainview, NY; and Pasqualini and Arap, Proceedings of the National Academy of Sciences (2004) 101:257-259).

[0379] An immunogenic amount of the antigen is suitably delivered.The present invention also relates to a method for detecting a target antigen, the method comprising detecting the antibody with a second detection agent that recognizes a portion of the antibody produced as above.

[0380] The present invention also relates to a method for producing an antibody chain or antibody specific for a desired antigen, the method comprising immunizing a rodent comprising a cat gene segment located upstream of a constant region that is not from a cat, as disclosed herein, and then appropriately replacing the constant region of the antibody chain or antibody with a constant region of a cat constant region by engineering the nucleic acid encoding the antibody. Preferably, the constant region is from the same cat breed. Standard cloning techniques are known to replace non-human mammalian constant regions with suitable cat constant region DNA sequences—see, for example, Sambrook, J and Russell, D. (2001, 3rd edition) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Plainview, New York). Alternatively, direct nucleic acid synthesis can be used to generate full cat sequences using sequence information from DNA encoding chimeric antibodies.

[0381] The invention also relates to a method comprising identifying feline variable regions by single cell sequencing and preparing vectors to express full antibody chains with corresponding feline constant regions. The invention also relates to obtaining these feline sequences by PCR and joining them to appropriate constant regions (such as feline constant regions) by suitable molecular biology techniques (such as, but not limited to, bridge PCR and Gibson cloning). DNA may also be synthesized for inclusion in expression vectors.

[0382] In yet other aspects, the chimeric antibodies or antibody chains produced in the present invention can be appropriately manipulated at the DNA level to produce molecules with antibody-like properties or structures, such as:

[0383] feline variable regions from heavy or light chains without constant regions,

[0384] Domain antibodies,

[0385] Feline variable regions with any constant region of a heavy or light chain from the same or different species

[0386] A feline variable region with a non-naturally occurring constant region; or a feline variable region and any other fusion partner. The present invention relates to all such chimeric antibody derivatives derived from the chimeric antibodies identified according to the present invention.

[0387] The present invention also relates to a method for preparing an antibody or a portion thereof, the method comprising providing:

[0388] (i) a nucleic acid encoding an antibody or a portion thereof obtained or obtainable according to the present invention; or

[0389] (ii) sequence information from which a nucleic acid encoding an antibody obtained or obtainable according to the invention or a portion thereof can be expressed to allow the production of the antibody; and

[0390] Expression of antibody chains.

[0391] Also disclosed is a method for producing an antibody chain or a portion thereof, the antibody chain having a feline variable region, the method comprising expressing in a cell a nucleic acid, such as a DNA, encoding the antibody chain or a portion thereof,

[0392] wherein the sequence of the nucleic acid encoding the variable region of the antibody chain is obtained or can be obtained by immunizing a rodent disclosed herein with an antigen so that an antibody chain is produced, or is obtained from an antibody in a library as described herein,

[0393] The method optionally comprises the following subsequent steps:

[0394] purifying and / or isolating said antibody chains, and

[0395] The antibody is optionally then formulated into a pharmaceutically acceptable formulation suitable for administration to a cat.

[0396] Also disclosed is a method of preparing a pharmaceutical composition, the method comprising producing an antibody according to the methods disclosed herein and further comprising combining the antibody with a pharmaceutically acceptable carrier or other excipient to produce the composition.

[0397] The present invention further relates to chimeric antibodies or antibody chains expressed from gene segments identified as being important for the production of feline antibodies and nucleic acids encoding the same, such as:

[0398] A nucleic acid encoding a chimeric antibody chain having a variable domain and a rodent constant region, wherein the variable domain comprises any one of the feline IGHV gene segments selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, optionally wherein the feline V gene segment is a sequence that has undergone somatic hypermutation in a rodent.

[0399] An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5 in a rodent.

[0400] A nucleic acid encoding a chimeric antibody chain having a variable domain and a rodent constant region, wherein the variable domain comprises any one of the cat λV gene segments selected from the list comprising: λV1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126, optionally wherein the cat V gene segment is a sequence that has undergone somatic hypermutation in a rodent.

[0401] An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained by expression of any one of feline lambda V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 in a rodent.

[0402] A nucleic acid encoding a chimeric antibody chain having a variable domain and a rodent constant region, wherein the variable domain comprises any one of the feline κV gene segments selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4, optionally wherein the feline V gene segment is a sequence that has undergone somatic hypermutation in a rodent.

[0403] An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in a rodent.

[0404] The antibody or antibody chain or nucleic acid may be or is obtainable from a rodent or a rodent cell, or from an antibody library as disclosed herein.

[0405] The present invention also relates to part or all of an immunoglobulin molecule comprising a restricted inserted feline variable domain and a rodent constant domain derived from a B cell from a rodent, as well as a hybridoma cell obtainable from or from said B cell, and part or all of an immunoglobulin molecule comprising a feline variable domain and a rodent constant domain obtainable from or from said hybridoma cell.

[0406] In another aspect, the present invention relates to fragments and functional derivatives of the antibodies and chains disclosed herein, also referred to as parts of antibody chains, and the use of the antibodies, chains and fragments in medicine, including diagnosis and in vitro or ex vivo studies. Functional antibody fragments / parts may include fragments that are capable of specific binding to an antigen.

[0407] Functional antibody fragments can be, for example, FAB or single chain variable fragments (scFv). The fragment can contain at least the variable region of the antibody. The fragment can contain at least the CDR region. Suitably, the functionality of these parts is that they can bind to the desired antigen (preferably the same antigen used to immunize rodents to stimulate antibody production).

[0408] The present invention also relates to nucleic acids, such as DNA or RNA, encoding the antibodies, antibody chains or parts thereof. Specifically, the part may be the variable part of the antibody chain, i.e. the part encoded by the cat DNA in rodents.

[0409] In one aspect, the antibody or fragment comprises any combination exemplified in the Examples and Tables herein or any derivative thereof (whole feline antibodies or fragments thereof capable of antigen binding).

[0410] In one aspect, the antibodies of the invention may be isolated, separated from a cell or organism expressing the antibody.

[0411] The present invention relates to both polyclonal and monoclonal antibodies of chimeric or fully feline antibodies, as described herein, which can be produced or derived from the rodents of the present invention in response to antigenic challenge, and / or which can comprise a V gene segment identified herein as being highly utilized, such as IGH V3-14. Methods for producing monoclonal and polyclonal antibodies are well known in the art.

[0412] Also disclosed herein is a pharmaceutical composition comprising the antibody and antibody chain or a nucleic acid encoding the antibody or antibody chain.

[0413] The present invention relates to a pharmaceutical composition comprising an antibody chain having a variable region in combination with a pharmaceutically acceptable excipient or carrier, wherein the variable region comprises any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0414] A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline lambda V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 in combination with a pharmaceutically acceptable excipient or carrier.

[0415] A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in combination with a pharmaceutically acceptable excipient or carrier.

[0416] A pharmaceutical composition comprising an antibody having

[0417] (i) a heavy chain having a variable region obtained by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, and any one of the following

[0418] (ii) a lambda light chain obtained by expression of any one of cat lambdas V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13, and V1-126; or

[0419] (iii) a kappa light chain obtained by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9, and V2-4;

[0420] The antibody is formulated in combination with a pharmaceutically acceptable excipient or carrier.

[0421] Suitable excipients and carriers are well known in the art and include water, surfactants, carbohydrates (eg, cyclodextrin derivatives), and amino acids.

[0422] The present invention also relates to a pharmaceutical composition comprising a whole feline antibody packaged in a delivery vehicle such as an IV injection bag or injection device.

[0423] The antibody chains can be chimeric antibody chains or whole feline antibody chains.

[0424] The present invention also relates to antibody libraries prepared in any manner. For example, the library may be derived from a transgenic rodent (such as a mouse), or alternatively utilizes the same limited set of immunoglobulin V gene segments as disclosed herein for the insertion of heavy chain and / or light chain cat DNA synthetic antibody libraries, such as phage display systems. For example, WO2018234438 (in the context of dogs) describes a suitable method for generating a synthetic antibody library and this is also applicable to cats, and the document is incorporated by reference.

[0425] Accordingly, the present invention relates to a library of antibody heavy chains comprising antibody heavy chains having feline IGH V gene segments from no more than 9 different feline IGH V gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, optionally wherein at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8 or all 9 feline IGH V gene segments are selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0426] Optionally, the library comprises antibody heavy chains having feline IGHV gene segments expressed by

[0427] (i) V3-14, optionally with up to 8 additional feline IGH V gene segments;

[0428] (ii) V3-14 and V3-11, optionally with up to 7 additional feline IGH V gene segments;

[0429] (iii) V3-14, V3-11, and V3-12, optionally with up to 6 additional feline IGH V gene segments;

[0430] (iv) V3-14, V3-11, V3-12, and V3-84, optionally with up to 5 additional feline IGH V gene segments;

[0431] (v) V3-14, V3-11, V3-12, V3-84, and V3-20, optionally with up to 4 additional feline IGH V gene segments;

[0432] (vi) V3-14, V3-11, V3-12, V3-84, V3-20, and V3-27, optionally with up to 3 additional feline IGH V gene segments;

[0433] (vii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, and V4-3, optionally with up to 2 additional feline IGH V gene segments;

[0434] (viii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, and V3-N3, optionally with up to 1 additional feline IGH V gene segment; or

[0435] (ix) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0436] In one embodiment, the library comprises antibody heavy chains expressed by IGHV gene segments of feline IGHV families 3 and 4.

[0437] Also disclosed is an antibody light chain library comprising antibody light chains having feline λV gene segments from no more than 11 different feline λV gene segments, wherein at least one of the feline λV gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13, and V 1-126, optionally wherein at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or all 11 feline λV gene segments are selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126.

[0438] Optionally, the library comprises antibody lambda light chains having feline lambda V gene segments comprising

[0439] (i) V1-124, optionally with up to 10 additional feline lambda V gene segments;

[0440] (ii) V1-124 and V1-36, optionally with up to 9 additional feline lambda V gene segments;

[0441] (iii) V1-124, V1-36, and V1-104, optionally with up to 8 additional feline lambda V gene segments;

[0442] (iv) V1-124, V1-36, V1-104, and V1-33, optionally with up to 7 additional feline lambda V gene segments;

[0443] (v) V1-124, V1-36, V1-104, V1-33, and V1-56, optionally with up to 6 additional feline lambda V gene segments;

[0444] (vi) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, optionally with up to 5 additional feline lambda V gene segments; or

[0445] (vii) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42 and V1-41, optionally with up to 4 additional feline λV gene segments.

[0446] In another embodiment, the library comprises antibody lambda light chains expressed from lambda V gene segments of feline lambda families 1 and 3.

[0447] Also disclosed is an antibody light chain library comprising antibody κ light chains having feline κV gene segments from no more than 6 different feline κV gene segments, wherein at least one of the feline κV gene segments is selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4, optionally wherein at least 2, at least 3, at least 4, at least 5 or all 6 of the feline κV gene segments are selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0448] Optionally, the library comprises antibody kappa light chains having feline kappa V gene segments comprising

[0449] (i) V4-1, optionally with up to 5 additional feline κV gene segments;

[0450] (ii) V4-1 and V2-12, optionally with up to 4 additional feline κV gene segments;

[0451] (iii) V4-1, V2-12, and V2-5, optionally with up to 3 additional feline κV gene segments;

[0452] (iv) V4-1, V2-12, V2-5, and V2-13, optionally with up to 2 additional feline κV gene segments;

[0453] (v) V4-1, V2-12, V2-5, V2-13, and V2-9, optionally with up to 1 additional feline κV gene segment; or

[0454] (vi) V4-1, V2-12, V2-5, V2-13, V2-4 and V2-4; or

[0455] (vii) V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0456] In another embodiment, the library comprises antibody κ light chains expressed from κV gene segments of feline κV families 2 and 4.

[0457] The antibodies and antibody chains disclosed herein can be used in methods for preventing or treating cat diseases. Specifically, whole cat antibodies with cat constant regions can be used.

[0458] Thus, the present invention relates to antibodies or antibody chains or portions thereof as disclosed herein, such as antibodies obtainable from or obtainable from a rodent or rodent cell as disclosed herein or from a library disclosed herein, such as whole feline antibodies prepared using sequence information from a rodent or rodent cell, for use in treating or preventing a disease in a cat in need thereof.

[0459] The present invention also relates to a method of treating a cat, the method comprising delivering to a cat in need thereof an antibody or antibody chain or portion thereof as disclosed herein, the antibody being, for example, an antibody obtainable from or obtainable from a rodent or rodent cell as disclosed herein or from a library as disclosed herein, or a whole cat antibody prepared using sequence information from a rodent or rodent cell.

[0460] In a further aspect, the present invention relates to the use of rodents as described herein as models for testing drugs and vaccines. The present invention therefore relates to a method for identifying or validating a drug or vaccine, the method comprising delivering the vaccine or drug to a mammal (such as a cat) of the present invention and monitoring one or more of the following: immune response, safety profile, effect on disease.

[0461] The present invention also relates to a kit comprising an antibody or antibody derivative as disclosed herein, and instructions for use of such antibody or suitable laboratory reagents, such as buffers, antibody detection reagents or excipients for formulation with the antibody.

[0462] Certain preferred gene segments are disclosed herein, and the relevant sequences have been provided:

[0463] an IGH V gene segment, the IGH V gene segment is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5 or is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5.

[0464] A lambda gene segment selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 or selected from the list comprising: V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13 and V1-126.

[0465] A κ gene segment selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0466] The present invention also relates to a cat D gene segment (IGHD-N1). The cat D gene segment has the following DNA sequence (SEQ ID NO: 48):

[0467] GTGACTACTGTATCGGGAGTAGCTGTGCTAC

[0468] The present invention also relates to a vector or a cell genome or a cell line genome or a rodent genome, which comprises the feline D gene segment IGHD-N1.

[0469] The present disclosure specifically contemplates the use of IGHD-N1 (SEQ ID NO: 48) in the rodents, rodent cells and methods, antibodies, pharmaceutical compositions, etc. described herein (either in combination with or separately from the V gene segments described herein).

[0470] For example, in one embodiment, the invention relates to a rodent or a rodent cell having a genome comprising:

[0471] one or more feline IGHV gene segments, a feline D gene segment IGHD-N1 and one or more feline IGH J region gene segments,

[0472] wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain,

[0473] Optionally wherein no more than 9 feline IGH V gene segments are present, and wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16N3 and V3-5.

[0474] The present disclosure also expressly contemplates the use of IGHD-N1 (SEQ ID NO: 48) in hosts other than rodents. Thus, references herein to "rodents" may be read as "non-human animals" (or "non-human mammals") in these contexts.

[0475] As with the feline V gene segments disclosed herein, use of IGHD-N1 can obviate the need to insert a full complement of feline D genes into a host to generate an antibody population that would provide a suitable library for identifying and selecting antibody candidates for therapeutic and prophylactic treatments.

[0476] Table 1

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483] It should be understood that the specific embodiments described herein are shown by way of illustration and not as limitations of the present invention. The main features of the present invention may be employed in various embodiments without departing from the scope of the present invention. Those skilled in the art will recognize or be able to determine many equivalents of the specific procedures described herein using only routine research. Such equivalents are considered to be within the scope of the present invention and are covered by the claims. All disclosures and patent applications mentioned in this specification indicate the level of those skilled in the art to which the present invention belongs. All disclosures and patent applications are incorporated herein by reference to the extent that each individual disclosure or patent application is specifically and individually indicated to be incorporated by reference.

[0484] When used in conjunction with the term "comprising" in the claims and / or the specification, the use of the words "a" or "an" can mean "one", but it is also consistent with the meaning of "one or more", "at least one", and "one or more than one". The use of the term "or" in the claims is used to mean "and / or" unless it is explicitly stated to refer to only alternatives or the alternatives are mutually exclusive, but the present disclosure supports a definition referring only to alternatives and "and / or". Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, method used to determine the value, or the variation that exists between the subjects of study.

[0485] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended, and do not exclude additional unrecited elements or method steps.

[0486] As used herein, the term "or a combination thereof" refers to all permutations and combinations of the items listed before the term. For example, "A, B, C, or a combination thereof" is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if the order is important in a particular context, BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, combinations containing repetitions of one or more items or terms, such as BB, AAA, ABAB, BBC, AAABCCCC, CBBAAA, CABABB, etc., are expressly included. The skilled person will understand that the number of items or terms in any combination is generally not limited unless otherwise apparent from the context.

[0487] Any part of this disclosure may be read in conjunction with any other part of this disclosure unless otherwise apparent from the context.

[0488] All compositions and / or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. Although the compositions and methods of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that the compositions and / or methods and the steps or sequence of steps of the methods described herein can be varied without departing from the concept, spirit and scope of the present invention.

[0489] The invention is described in more detail in the following non-limiting examples.

[0490] Examples

[0491] Example 1: Analysis of healthy feline PBMCs, sorting of intact single B cells and 10X immune profiling to generate VH:VL paired data

[0492] Two frozen PBMC samples from two healthy European shorthair SPF cats were obtained from Life Link Biologicals.

[0493] After the dead cells stained with viability dyes were excluded by gating, the live lymphocytes (including B cells) in the enrichment cell fraction were sorted using the FACS of forward scatter-side scatter lymphocyte gating. Sample 1 produces about 320,000 B cells (CD21 positive cells), and sample 2 produces about 120,000 B cells (CD21 positive cells). 40,000 cells from each sample were precipitated by centrifugation, and the microfluidic encapsulation scheme from 10X genomics company Chromium Next Gem single cell 5'v2 kit (10X Genomics Chromium Next Gem Single Cell5'v2 kit) (10X genomics company (10X Genomics)) was used, and the scheme of the manufacturer was processed. Using Qubit fluorometer (ThermoFisher) and bioanaylser analysis (Agilent Technologies (Agilent)) the obtained cDNA was quantitatively subjected to quality control. The cDNA was then processed to generate a 5' VDJ NGS sequencing library using feline constant region specific PCR primers designed to cross-react with as many constant regions as possible as shown in Table 3. After pelleting, the number of cells expected to be loaded into the 10X chip was approximately 28,000.

[0494] The resulting 5'VDJ library was sequenced on the Illumina NGS platform using 150 bp paired-end sequencing. At this read length, a minimum of two thousand read pairs per cell barcode is recommended. The resulting sequencing data was demultiplexed and each library would contain a pair of Read1 and Read2.fastq.gz files.

[0495] The resulting set of FASTQ files was processed by Cell Ranger software (10X Genomics): for the combination of VDJ and 5'GEX libraries, processed by the 'cellranger multi' command, giving a list of heavy and light V+D+J+C reference sequences within the cat library, provided as a reference set to the internal cat genome reference and annotation (incorporating information from FelisCatus8.0 and FelisCatus9.0 as well as internal sequence data), including a list of validated IG genes from the 3 IG loci in the internally managed cat genome, and a list of internal primers designed for this purpose as parameters. The results of the VDJ library were QCed by the 'cellranger multi' step and compared to the estimated number of cells in the cell counting step. 14,562 10X VJ paired cells were recovered for sample 1, and 1,503 were recovered for sample 2. The reconstructed chains from Cellranger (all_contig.fasta) were aligned to a set of heavy and light V+D+J reference sequences formatted for running the enclone software (10x Genomics). The results of the enclone step were sorted by aa% and filtered for v_name sequences corresponding to high confidence heavy+light V library cell barcode calls, and only high confidence cells were selected as the final results.

[0496] result:

[0497] Based on the heavy + light pairing data obtained, a graph of heavy chain usage relative to light chain usage was plotted. Some heavy chain / light chain pairing patterns are more dominant than others.

[0498] Tables 2a-2c show the combined data, in which the top pairs, heavy chain V gene segments, and light chain V gene segments are ranked.

[0499] Table 4 shows the ranking of light chain V genes according to the number of different heavy V gene pairings.

[0500] Table 2a

[0501]

[0502]

[0503] Table 2b

[0504] Heavy chain frequency IGHV3-14 8712 IGHV3-11 5625 IGHV3-12 4598 IGHV3-84 3923 IGHV3-20 2879 IGHV3-27 2772 IGHV4-3 2746 IGHV3-N3 2657 IGHV3-5 2424

[0505] Table 2c

[0506]

[0507]

[0508] Table 3

[0509] 5'-3' primer sequence name SEQ ID NO Heavy-IgG GTGGGAACACCGATGGGGC fIgG(1-3)_IN-short 27 TCACCGGCTCAGGGAAGTAG fIgG(1-3)_IN-long 28 ATGCTGCTGAGAGAGTAGAGC fIgG(1-3)_OUT 29 Heavy-IgA TGGGGCTCCAAGTCACTCTC fIgA_IN_Long 30 GGTTCCCGGAAGCAGACTTC fIgA_OUT 31 CTGAGGCTCAGCGGGAAGAC fIgA_IN_Short 32 Light-λ GGAGGGCTTGGTGGTCTCC fIgL_OUT 33 TCAAGCCGCTGGGGTAGAAG fIgL_IN_Long 34 AGGGTGGGAAGAGTGTGACC fIgL_IN_Short 35 Light-κ GGACTACGCCATCCACTTTCC fIgK_IN_Long 36 GGTGCTGCTGAGGCTGTAGG fIgK_OUT 37 GCACACGATAGAGGCACTTCC fIgK_IN_Short 38 Heavy-IgM TCTCAGGACTGGAGGGAAGG fIgM_OUT 39 GAGAAGGTGACGGAGCTGGG fIgM_IN-long 40 GGACAGGGAGCTCTCACAGG fIgM_IN-short 41 Heavy-IgD GGGCAGTCAGGAAGGACAGC fIgD_OUT 42 CACCTGCACTGACTCTTGGG fIgD_IN-long 43 TGACACCCCGAGACCAAGGG fIgD_IN_Short 44

[0510] Table 4

[0511]

[0512]

[0513] This experiment was repeated for later data and produced the following data:

[0514] Table 5a

[0515] Heavy chain use IGHV3-14 14.22％ IGHV3-11 8.52％ IGHV3-12 7.77％ IGHV3-84 5.22％ IGHV3-27 4.67％ IGHV4-3 4.60％ IGHV3-5 4.09％ IGHV3-20 3.02％ IGHV3-16 2.77％

[0516] Table 5b

[0517]

[0518]

[0519] Table 5c

[0520] Lambda Chain frequency IGKV4-1 3.12％ IGKV2-12 2.39％ IGKV2-5 1.63％ IGKV2-13 1.24％ IGKV2-9 0.81％ IGKV2-4 0.59％

[0521] The present invention is further described in the following numbered clauses:

[0522] 1. A rodent or rodent cell having a genome comprising:

[0523] No more than 9 feline IGHV gene segments, one or more feline IGH D region gene segments, and one or more feline IGH J region gene segments,

[0524] wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain,

[0525] wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0526] 2. The rodent or rodent cell according to claim 1, comprising the following feline IGH

[0527] (i) V3-14, optionally with up to 8 additional feline IGH V gene segments;

[0528] (ii) V3-14 and V3-11, optionally with up to 7 additional feline IGH V gene segments;

[0529] (iii) V3-14, V3-11, and V3-12, optionally with up to 6 additional feline IGH V gene segments;

[0530] (iv) V3-14, V3-11, V3-12, and V3-84, optionally with up to 5 additional feline IGH V gene segments;

[0531] (v) V3-14, V3-11, V3-12, V3-84, and V3-20, optionally with up to 4 additional feline IGH V gene segments;

[0532] (vi) V3-14, V3-11, V3-12, V3-84, V3-20, and V3-27, optionally with up to 3 additional feline IGH V gene segments;

[0533] (vii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, and V4-3, optionally with up to 2 additional feline IGH V gene segments;

[0534] (viii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, and V3-N3, optionally with up to 1 additional feline IGH V gene segment; or

[0535] (ix) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5.

[0536] 3. The rodent or rodent cell of claim 1, comprising no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than two or only 1 of said feline IGH V gene segments, optionally wherein the rodent or rodent cell has a genome that encodes only a single type of feline heavy chain VDJ variable region.

[0537] 4. The rodent or rodent cell of claim 1, comprising at least 2 IGH gene segments, such as at least 3, at least 4, at least 5, at least 6, at least 7, at least 8 or 9 feline IGH V gene segments.

[0538] 5. The rodent or rodent cell according to claims 1 to 4, comprising at least one gene segment of a feline IGH V gene segment from family 3 and 4.

[0539] 6. A rodent or rodent cell having a genome comprising:

[0540] No more than 11 feline lambda V gene segments and one or more feline lambda J region gene segments;

[0541] wherein the rodent or rodent cell is capable of expressing the feline lambda gene segment to form an antibody light chain,

[0542] wherein at least one of the feline λ gene segments is selected from V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126.

[0543] 7. The rodent or rodent cell according to claim 6, comprising the following cat lambda V

[0544] (i) V1-124, optionally with up to 10 additional feline lambda V gene segments;

[0545] (ii) V1-124 and V1-36, optionally with up to 9 additional feline lambda V gene segments;

[0546] (iii) V1-124, V1-36, and V1-104, optionally with up to 8 additional feline lambda V gene segments;

[0547] (iv) V1-124, V1-36, V1-104, and V1-33, optionally with up to 7 additional feline lambda V gene segments;

[0548] (v) V1-124, V1-36, V1-104, V1-33, and V1-56, optionally with up to 6 additional feline lambda V gene segments;

[0549] (vi) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, optionally with up to 5 additional feline lambda V gene segments; or

[0550] (vii) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42 and V1-41, optionally with up to 4 additional feline λV gene segments.

[0551] 8. The rodent or rodent cell of claim 6, comprising no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2 or only 1 V gene segment, optionally wherein the rodent or rodent cell has a genome that encodes only a single type of feline lambda light chain VJ variable region.

[0552] 9. The rodent or rodent cell of claim 6, comprising at least 2 feline λV gene segments, such as at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or 11 feline λV gene segments.

[0553] 10. The rodent or rodent cell of claims 6 to 9, comprising feline λV gene segments from each of λV families 1 and 3.

[0554] 11. A rodent or rodent cell having a genome comprising:

[0555] No more than 6 feline kappa V gene segments and one or more feline kappa J region gene segments,

[0556] wherein the rodent or rodent cell is capable of expressing the feline κ gene segment to form an antibody light chain,

[0557] wherein at least one of the feline κ gene segments is selected from V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0558] 12. The rodent or rodent cell according to claim 11, comprising the following feline κV

[0559] (i) V4-1, optionally with up to 5 additional feline κV gene segments;

[0560] (ii) V4-1 and V2-12, optionally with up to 4 additional feline κV gene segments;

[0561] (iii) V4-1, V2-12, and V2-5, optionally with up to 3 additional feline κV gene segments;

[0562] (iv) V4-1, V2-12, V2-5, and V2-13, optionally with up to 2 additional feline κV gene segments;

[0563] (v) V4-1, V2-12, V2-5, V2-13, and V2-9, optionally with up to 1 additional feline κV gene segment; or

[0564] (vi) V4-1, V2-12, V2-5, V2-13, V2-4 and V2-4; or

[0565] (vii) V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

[0566] 13. The rodent or rodent cell of claim 11, comprising no more than 5, no more than 4, no more than 3, no more than 2 or only 1 feline κV gene segment, optionally wherein the rodent or rodent cell has a genome that encodes only a single type of feline κ light chain VJ variable region.

[0567] 14. The rodent or rodent cell of claim 11, comprising at least 2 feline κV gene segments, such as at least 3, at least 4, at least 5 or 6 feline κV gene segments.

[0568] 15. The rodent or rodent cell of claims 11 to 14, comprising feline κV gene segments from each of κV gene segment families 2 and 4, suitably including IGKV4-1 and IGKV2-12.

[0569] 16. The rodent or rodent cell of claims 1 to 15, wherein the rodent genome comprises feline gene segments from both the heavy chain and at least one feline light chain, optionally wherein

[0570] (i) the rodent or cell genome is according to claims 1 to 5, combined with a feline lambda gene segment according to any one of claims 6 to 10 and / or a feline kappa V gene segment according to any one of claims 11 to 15, or

[0571] (ii) the rodent or cell genome is that of claims 1 to 5 and additionally comprises a feline κV gene segment and a feline κJ gene segment that can be expressed to form a κ antibody light chain variable domain; and / or the rodent or cell genome is that of a rodent or rodent cell of claims 1 to 4 that additionally comprises a feline λV gene segment and a feline λJ gene segment that can be expressed to form a λ antibody light chain.

[0572] 17. The rodent or rodent cell according to any one of the preceding claims, wherein

[0573] (i) the feline gene segments are located in the genome upstream of the rodent constant region, suitably upstream of the heavy chain constant region for an inserted feline heavy chain variable region gene segment, and / or suitably upstream of the light chain constant region for an inserted feline light chain variable region gene segment, such that the rodent or rodent cell is capable of producing chimeric antibody heavy or light chains, or both, resulting from expression of the inserted feline variable region gene segments and the host constant region; or

[0574] (ii) the feline gene segments are located in the genome in a functional arrangement with the feline constant regions, such that the rodent is capable of producing antibody chains resulting from expression of the feline VDJ gene segments with the feline constant regions and / or antibody chains resulting from expression of the feline VJ gene segments with the feline constant regions.

[0575] 18. The rodent or rodent cell of any one of claims 1 to 16, having a genome in which one or more feline V gene segments are regulated by non-coding regulatory sequences, the non-coding regulatory sequences being one or more of the following: a promoter preceding each V gene segment coding sequence, an intron, a splice site, and a recombination signal sequence for V(D)J recombination, wherein the regulatory sequences are of endogenous host origin.

[0576] 19. A nucleic acid encoding a chimeric antibody chain having a variable domain and a rodent constant region, wherein the variable domain comprises any one of the feline IGHV gene segments selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, optionally wherein the feline V gene segment has undergone somatic hypermutation in a rodent.

[0577] 20. An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained or obtainable by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5 in a rodent.

[0578] 21. A nucleic acid encoding a chimeric antibody chain, the nucleic acid having a variable domain and a rodent constant region, the variable domain comprising any one of the cat λV gene segments selected from the list comprising: λV1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126, optionally wherein the cat V gene segment has undergone somatic hypermutation in a rodent.

[0579] 22. An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained or obtainable by expression of any one of feline lambda V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 in a rodent.

[0580] 23. A nucleic acid encoding a chimeric antibody chain, the nucleic acid having a variable domain and a rodent constant region, the variable domain comprising any one of the feline κV gene segments selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4, optionally wherein the feline V gene segment has undergone somatic hypermutation in a rodent.

[0581] 24. An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained or obtainable by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in a rodent.

[0582] 25. A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5 in combination with a pharmaceutically acceptable excipient or carrier.

[0583] 26. A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline lambda V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126 in combination with a pharmaceutically acceptable excipient or carrier.

[0584] 27. A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in combination with a pharmaceutically acceptable excipient or carrier.

[0585] 28. A pharmaceutical composition comprising an antibody having

[0586] (i) a heavy chain having a variable region obtained by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5, and any one of the following

[0587] (ii) a lambda light chain obtained by expression of any one of cat lambdas V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13, and V1-126; or

[0588] (iii) a kappa light chain obtained by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9, and V2-4;

[0589] The antibody is formulated in combination with a pharmaceutically acceptable excipient or carrier.

[0590] 29. An antibody heavy chain library comprising antibody heavy chains having feline IGH V gene segments from no more than 9 different feline IGH V gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5

[0591] Optionally wherein the library comprises

[0592] A Antibody heavy chain having feline IGH V gene segments expressed by

[0593] (i) V3-14, optionally with up to 8 additional feline IGH V gene segments;

[0594] (ii) V3-14 and V3-11, optionally with up to 7 additional feline IGH V gene segments;

[0595] (iii) V3-14, V3-11, and V3-12, optionally with up to 6 additional feline IGH V gene segments;

[0596] (iv) V3-14, V3-11, V3-12, and V3-84, optionally with up to 5 additional feline IGH V gene segments;

[0597] (v) V3-14, V3-11, V3-12, V3-84, and V3-20, optionally with up to 4 additional feline IGH V gene segments;

[0598] (vi) V3-14, V3-11, V3-12, V3-84, V3-20, and V3-27, optionally with up to 3 additional feline IGH V gene segments;

[0599] (vii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, and V4-3, optionally with up to 2 additional feline IGH V gene segments;

[0600] (viii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, and V3-N3, optionally with up to 1 additional feline IGH V gene segment; or

[0601] (ix) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3 and V3-5;

[0602] and / or

[0603] B Antibody heavy chains expressed by IGH V gene segments of feline IGH V families 3 and 4.

[0604] 30. An antibody light chain library, the library comprising antibody light chains having feline λV gene segments from no more than 11 different feline λV gene segments, wherein at least one of the feline λV gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126,

[0605] Optionally wherein the library comprises

[0606] A has an antibody lambda light chain comprising the following feline lambda V gene segments

[0607] (i) V1-124, optionally with up to 10 additional feline lambda V gene segments;

[0608] (ii) V1-124 and V1-36, optionally with up to 9 additional feline lambda V gene segments;

[0609] (iii) V1-124, V1-36, and V1-104, optionally with up to 8 additional feline lambda V gene segments;

[0610] (iv) V1-124, V1-36, V1-104, and V1-33, optionally with up to 7 additional feline lambda V gene segments;

[0611] (v) V1-124, V1-36, V1-104, V1-33, and V1-56, optionally with up to 6 additional feline lambda V gene segments;

[0612] (vi) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, optionally with up to 5 additional feline lambda V gene segments; or

[0613] (vii) V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, and V1-41, optionally with up to 4 additional feline lambda V gene segments;

[0614] and / or

[0615] B Antibody lambda light chain expressed from feline lambda V gene segments of feline lambda families 1 and 3.

[0616] 31. An antibody light chain library, the library comprising antibody κ light chains having feline κV gene segments from no more than 5 different feline κV gene segments, wherein at least one of the feline κV gene segments is selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4,

[0617] Optionally wherein the library comprises

[0618] A has an antibody kappa light chain comprising the following feline kappa V gene segments

[0619] (i) V4-1, optionally with up to 5 additional feline κV gene segments;

[0620] (ii) V4-1 and V2-12, optionally with up to 4 additional feline κV gene segments;

[0621] (iii) V4-1, V2-12, and V2-5, optionally with up to 3 additional feline κV gene segments;

[0622] (iv) V4-1, V2-12, V2-5, and V2-13, optionally with up to 2 additional feline κV gene segments;

[0623] (v) V4-1, V2-12, V2-5, V2-13, and V2-9, optionally with up to 1 additional feline κV gene segment; or

[0624] (vi) V4-1, V2-12, V2-5, V2-13, V2-4 and V2-4; or

[0625] (vii) V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4;

[0626] and / or

[0627] B Antibody kappa light chain expressed by feline kappa V gene segments of feline kappa V families 2 and 4.

[0628] 32. An antibody or antibody chain or part thereof, or DNA encoding an antibody chain or part thereof, which has been or can be obtained from a rodent or rodent cell according to any one of claims 1 to 18 or from a library according to any one of claims 29 to 31.

[0629] 33. An antibody or antibody or chain or part thereof, obtained or obtainable from a rodent or cell according to any one of claims 1 to 18 or a library according to any one of claims 29 to 31, for use in treating or preventing a disease in a cat in need thereof.

[0630] 34. A method for producing a rodent or rodent cell according to any one of the preceding claims, the method comprising inserting into the rodent cell genome

[0631] (i) no more than 9 feline IGH V gene segments, one or more feline IGH D region gene segments, and one or more feline IGH J region gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-N3, and V3-5; and / or

[0632] (ii) no more than 11 feline lambda V gene segments and one or more feline lambda J region gene segments, wherein at least one of the feline V gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-33, V1-56, V1-42, V1-41, V3-7, V3-5, V3-13 and V1-126; and / or

[0633] (iii) no more than 6 feline κV gene segments and one or more feline κJ region gene segments, wherein at least one of the feline κ gene segments is selected from the group consisting of V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4;

[0634] And wherein the rodent or rodent cell is capable of expressing one or more feline variable region gene segments that combine with constant regions to form antibody chains.

[0635] 35. A method for producing an antibody or antibody chain specific for a desired antigen, the method comprising immunizing a rodent according to any one of claims 1 to 18 with the desired antigen and recovering the antibody chain or antibody or recovering cells producing the antibody chain or antibody.

[0636] 36. A method for producing an antibody chain or antibody specific for a desired antigen, the method comprising immunizing a rodent according to any one of claims 1 to 18 with a desired antibody, and then appropriately replacing the rodent constant region of the antibody chain or antibody with a cat constant region by engineering the nucleic acid encoding the antibody.

[0637] 37. A method for producing an antibody chain or a portion thereof, said antibody chain having a feline variable region, said method comprising expressing in a cell a nucleic acid encoding said antibody chain or a portion thereof,

[0638] wherein the sequence of the nucleic acid encoding the variable region of the antibody chain is obtained or can be obtained from a rodent according to any one of claims 1 to 18 immunized with an antigen, or from an antibody in the antibody library according to claims 29 to 31, and the sequence comprises one of the feline heavy gene segment, kappa gene segment or lambda gene segment according to claims 1, 5 or 10, respectively,

[0639] The method optionally comprises the following subsequent steps:

[0640] purifying and / or isolating said antibody chains, and

[0641] The antibody is optionally then formulated into a pharmaceutically acceptable formulation suitable for administration to a cat.

[0642] 38. A method of preparing a pharmaceutical composition, the method comprising producing an antibody according to any one of claims 35 to 37, and further comprising combining the antibody with a pharmaceutically acceptable carrier or other excipient to produce the pharmaceutical composition.

[0643] 39. A pharmaceutical composition comprising the antibody according to claims 25 to 28, which is a monoclonal antibody.

[0644] 40. A method of treating a cat, the method comprising delivering to a cat in need thereof an antibody or antibody chain or a functional portion thereof, the antibody being obtained or obtainable from a rodent or cell according to any one of claims 1 to 18, optionally wherein

[0645] The antibody chain is according to any one of claims 20, 22, 24 or 32, and / or

[0646] The antibody or antibody chain is in the form of a pharmaceutical composition according to any one of claims 25 to 28, and / or

[0647] The antibody or antibody chain is a whole cat antibody or antibody chain, and the whole cat antibody or antibody chain has a cat variable region and a constant region;

[0648] Preferably wherein the method comprises delivering the antibody in the form of a pharmaceutical composition having a full feline heavy chain and a full feline light chain.

[0649] 41. A rodent or rodent cell having a genome comprising a feline IGH V gene segment, one or more feline IGH D region gene segments and one or more feline IGH J region gene segments, wherein the feline IGH V gene segment is selected from the list comprising: IGH V3-14 (SEQ ID NO: 1), V1-36 ​​(SEQ ID NO: 11), V1-104 (SEQ ID NO: 12) and V1-42 (SEQ ID NO: 15),

[0650] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

[0651] 42. A rodent or rodent cell having a genome comprising feline IGK V gene segment IGK V2-5 (SEQ ID NO: 23) and one or more feline IGH J region gene segments,

[0652] Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody light chain.

Claims

1. A rodent or rodent cell having a genome comprising: No more than 9 feline IGHV gene segments, one or more feline IGH D region gene segments, and one or more feline IGH J region gene segments, wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5.

2. The rodent or rodent cell according to claim 1, comprising the following feline IGH (i) V3-14, optionally with up to 8 additional feline IGH V gene segments; (ii) V3-14 and V3-11, optionally with up to 7 additional feline IGH V gene segments; (iii) V3-14, V3-11, and V3-12, optionally with up to 6 additional feline IGH V gene segments; (iv) V3-14, V3-11, V3-12, and V3-84, optionally with up to 5 additional feline IGH V gene segments; (v) V3-14, V3-11, V3-12, V3-84 and V3-20, optionally with up to 4 additional feline IGHV gene segments; (vi) V3-14, V3-11, V3-12, V3-84, V3-20, and V3-27, optionally with up to 3 additional feline IGH V gene segments; (vii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, and V4-3, optionally with up to 2 additional feline IGHV gene segments; (viii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, and V3-16, optionally with up to 1 additional feline IGH V gene segment; or (ix) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5.

3. The rodent or rodent cell of claim 1, comprising no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than two or only 1 of said feline IGH V gene segments, optionally wherein the rodent or rodent cell has a genome that encodes only a single type of feline heavy chain VDJ variable region.

4. The rodent or rodent cell of claim 1, comprising at least 2 IGH gene segments, such as at least 3, at least 4, at least 5, at least 6, at least 7, at least 8 or 9 feline IGH V gene segments.

5. The rodent or rodent cell according to claims 1 to 4, comprising at least one gene segment of a feline IGH V gene segment from family 3 and 4.

6. A rodent or rodent cell having a genome comprising: No more than 11 feline lambda V gene segments and one or more feline lambda J region gene segments; wherein the rodent or rodent cell is capable of expressing the feline lambda gene segment to form an antibody light chain, wherein at least one of the feline λ gene segments is selected from V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13 and V1-126.

7. The rodent or rodent cell according to claim 6, comprising the following cat lambda V (i) V1-124, optionally with up to 10 additional feline lambda V gene segments; (ii) V1-124 and V1-36, optionally with up to 9 additional feline lambda V gene segments; (iii) V1-124, V1-36, and V1-104, optionally with up to 8 additional feline lambda V gene segments; (iv) V1-124, V1-36, V1-104, and V1-N1, optionally with up to 7 additional feline lambda V gene segments; (v) V1-124, V1-36, V1-104, V1-N1, and V1-56, optionally with up to 6 additional feline lambda V gene segments; (vi) V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, optionally with up to 5 additional feline lambda V gene segments; or (vii) V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42 and V1-N14, optionally with up to 4 additional feline λV gene segments.

8. The rodent or rodent cell of claim 6, comprising no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2 or only 1 V gene segment, optionally wherein the rodent or rodent cell has a genome that encodes only a single type of feline lambda light chain VJ variable region.

9. The rodent or rodent cell of claim 6, comprising at least 2 feline λV gene segments, such as at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or 11 feline λV gene segments.

10. The rodent or rodent cell of claims 6 to 9, comprising feline λV gene segments from each of λV families 1 and 3.

11. A rodent or rodent cell having a genome comprising: No more than 6 feline kappa V gene segments and one or more feline kappa J region gene segments, wherein the rodent or rodent cell is capable of expressing the feline κ gene segment to form an antibody light chain, wherein at least one of the feline κ gene segments is selected from V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

12. The rodent or rodent cell according to claim 11, comprising the following feline κV (i) V4-1, optionally with up to 5 additional feline κV gene segments; (ii) V4-1 and V2-12, optionally with up to 4 additional feline κV gene segments; (iii) V4-1, V2-12, and V2-5, optionally with up to 3 additional feline κV gene segments; (iv) V4-1, V2-12, V2-5, and V2-13, optionally with up to 2 additional feline κV gene segments; (v) V4-1, V2-12, V2-5, V2-13, and V2-9, optionally with up to 1 additional feline κV gene segment; or (vi) V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4.

13. The rodent or rodent cell of claim 11, comprising no more than 5, no more than 4, no more than 3, no more than 2 or only 1 feline κV gene segment, optionally wherein the rodent or rodent cell has a genome that encodes only a single type of feline κ light chain VJ variable region.

14. The rodent or rodent cell of claim 11, comprising at least 2 feline κV gene segments, such as at least 3, at least 4, at least 5 or 6 feline κV gene segments.

15. The rodent or rodent cell of claims 11 to 14, comprising feline κV gene segments from each of κV gene segment families 2 and 4, suitably including IGKV4-1 and IGKV2-12.

16. The rodent or rodent cell of claims 1 to 15, wherein the rodent genome comprises feline gene segments from both the heavy chain and at least one feline light chain, optionally wherein (i) the rodent or cell genome is according to claims 1 to 5, combined with a feline lambda gene segment according to any one of claims 6 to 10 and / or a feline kappa V gene segment according to any one of claims 11 to 15, or (ii) the rodent or cell genome is that of claims 1 to 5 and additionally comprises a feline κV gene segment and a feline κJ gene segment that can be expressed to form a κ antibody light chain variable domain; and / or the rodent or cell genome is that of a rodent or rodent cell of claims 1 to 4 that additionally comprises a feline λV gene segment and a feline λJ gene segment that can be expressed to form a λ antibody light chain.

17. The rodent or rodent cell according to any one of the preceding claims, wherein (i) the feline gene segments are located in the genome upstream of the rodent constant region, suitably upstream of the heavy chain constant region for an inserted feline heavy chain variable region gene segment, and / or suitably upstream of the light chain constant region for an inserted feline light chain variable region gene segment, such that the rodent or rodent cell is capable of producing chimeric antibody heavy or light chains, or both, resulting from expression of the inserted feline variable region gene segments and the host constant region; or (ii) the feline gene segments are located in the genome in a functional arrangement with the feline constant regions, such that the rodent is capable of producing antibody chains resulting from expression of the feline VDJ gene segments with the feline constant regions and / or antibody chains resulting from expression of the feline VJ gene segments with the feline constant regions.

18. The rodent or rodent cell of any one of claims 1 to 16, having a genome in which one or more feline V gene segments are regulated by non-coding regulatory sequences, the non-coding regulatory sequences being one or more of the following: a promoter preceding each V gene segment coding sequence, an intron, a splice site, and a recombination signal sequence for V(D)J recombination, wherein the regulatory sequences are of endogenous host origin.

19. A nucleic acid encoding a chimeric antibody chain having a variable domain and a rodent constant region, wherein the variable domain comprises any one of the feline IGHV gene segments selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5, optionally wherein the feline V gene segment has undergone somatic hypermutation in a rodent.

20. An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained or obtainable by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5 in a rodent.

21. A nucleic acid encoding a chimeric antibody chain, the nucleic acid having a variable domain and a rodent constant region, the variable domain comprising any one of the cat λV gene segments selected from the list comprising: λV1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13 and V1-126, optionally wherein the cat V gene segment has undergone somatic hypermutation in a rodent.

22. An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained or obtainable by expression of any one of feline lambda V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13 and V1-126 in a rodent.

23. A nucleic acid encoding a chimeric antibody chain, the nucleic acid having a variable domain and a rodent constant region, the variable domain comprising any one of the feline κV gene segments selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4, optionally wherein the feline V gene segment has undergone somatic hypermutation in a rodent.

24. An antibody chain having a variable region bound to a rodent constant region, the variable region being obtained or obtainable by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in a rodent.

25. A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5 in combination with a pharmaceutically acceptable excipient or carrier.

26. A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline lambda V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13 and V1-126 in combination with a pharmaceutically acceptable excipient or carrier.

27. A pharmaceutical composition comprising an antibody chain having a variable region comprising any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4 in combination with a pharmaceutically acceptable excipient or carrier.

28. A pharmaceutical composition comprising an antibody having (i) a heavy chain having a variable region obtained by expression of any one of feline IGH V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5, and any one of the following (ii) a lambda light chain obtained by expression of any one of feline lambdas V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13, and V1-126; or (iii) a kappa light chain obtained by expression of any one of feline kappa V4-1, V2-12, V2-5, V2-13, V2-9, and V2-4; The antibody is formulated in combination with a pharmaceutically acceptable excipient or carrier.

29. An antibody heavy chain library comprising antibody heavy chains having feline IGH V gene segments from no more than 9 different feline IGH V gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16, and V3-5 Optionally wherein the library comprises A Antibody heavy chain having feline IGH V gene segments expressed by (i) V3-14, optionally with up to 8 additional feline IGH V gene segments; (ii) V3-14 and V3-11, optionally with up to 7 additional feline IGH V gene segments; (iii) V3-14, V3-11, and V3-12, optionally with up to 6 additional feline IGH V gene segments; (iv) V3-14, V3-11, V3-12, and V3-84, optionally with up to 5 additional feline IGH V gene segments; (v) V3-14, V3-11, V3-12, V3-84 and V3-20, optionally with up to 4 additional feline IGHV gene segments; (vi) V3-14, V3-11, V3-12, V3-84, V3-20, and V3-27, optionally with up to 3 additional feline IGH V gene segments; (vii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, and V4-3, optionally with up to 2 additional feline IGHV gene segments; (viii) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, and V3-16, optionally with up to 1 additional feline IGH V gene segment; or (ix) V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16 and V3-5; and / or B Antibody heavy chains expressed by IGH V gene segments of feline IGH V families 3 and 4.

30. An antibody light chain library, the library comprising antibody light chains having feline λV gene segments from no more than 11 different feline λV gene segments, wherein at least one of the feline λV gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13 and V1-126, Optionally wherein the library comprises A has an antibody lambda light chain comprising the following feline lambda V gene segments (i) V1-124, optionally with up to 10 additional feline lambda V gene segments; (ii) V1-124 and V1-36, optionally with up to 9 additional feline lambda V gene segments; (iii) V1-124, V1-36, and V1-104, optionally with up to 8 additional feline lambda V gene segments; (iv) V1-124, V1-36, V1-104, and V1-N1, optionally with up to 7 additional feline lambda V gene segments; (v) V1-124, V1-36, V1-104, V1-N1, and V1-56, optionally with up to 6 additional feline lambda V gene segments; (vi) V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, optionally with up to 5 additional feline lambda V gene segments; or (vii) V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, and V1-N14, optionally with up to 4 additional feline lambda V gene segments; and / or B Antibody lambda light chain expressed from feline lambda V gene segments of feline lambda families 1 and 3.

31. An antibody light chain library, the library comprising antibody κ light chains having feline κV gene segments from no more than 5 different feline κV gene segments, wherein at least one of the feline κV gene segments is selected from the list comprising: V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4, Optionally wherein the library comprises A has an antibody kappa light chain comprising the following feline kappa V gene segments (i) V4-1, optionally with up to 5 additional feline κV gene segments; (ii) V4-1 and V2-12, optionally with up to 4 additional feline κV gene segments; (iii) V4-1, V2-12, and V2-5, optionally with up to 3 additional feline κV gene segments; (iv) V4-1, V2-12, V2-5, and V2-13, optionally with up to 2 additional feline κV gene segments; (v) V4-1, V2-12, V2-5, V2-13, and V2-9, optionally with up to 1 additional feline κV gene segment; or (vi) V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4; and / or B Antibody kappa light chain expressed by feline kappa V gene segments of feline kappa V families 2 and 4.

32. An antibody or antibody chain or part thereof, or DNA encoding an antibody chain or part thereof, which has been or can be obtained from a rodent or rodent cell according to any one of claims 1 to 18 or from a library according to any one of claims 29 to 31.

33. An antibody or antibody or chain or part thereof, obtained or obtainable from a rodent or cell according to any one of claims 1 to 18 or a library according to any one of claims 29 to 31, for use in treating or preventing a disease in a cat in need thereof.

34. A method for producing a rodent or rodent cell according to any one of the preceding claims, the method comprising inserting into the rodent cell genome (i) no more than 9 feline IGH V gene segments, one or more feline IGH D region gene segments, and one or more feline IGH J region gene segments, wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16, and V3-5; and / or (ii) no more than 11 feline lambda V gene segments and one or more feline lambda J region gene segments, wherein at least one of the feline V gene segments is selected from the list comprising: V1-124, V1-36, V1-104, V1-N1, V1-56, V1-42, V1-N14, V3-7, V3-5, V3-13 and V1-126; and / or (iii) no more than 6 feline κV gene segments and one or more feline κJ region gene segments, wherein at least one of the feline κ gene segments is selected from the group consisting of V4-1, V2-12, V2-5, V2-13, V2-9 and V2-4; And wherein the rodent or rodent cell is capable of expressing one or more feline variable region gene segments that combine with constant regions to form antibody chains.

35. A method for producing an antibody or antibody chain specific for a desired antigen, the method comprising immunizing a rodent according to any one of claims 1 to 18 with the desired antigen and recovering the antibody chain or antibody or recovering cells producing the antibody chain or antibody.

36. A method for producing an antibody chain or antibody specific for a desired antigen, the method comprising immunizing a rodent according to any one of claims 1 to 18 with a desired antibody, and then appropriately replacing the rodent constant region of the antibody chain or antibody with a cat constant region by engineering the nucleic acid encoding the antibody.

37. A method for producing an antibody chain or a portion thereof, the antibody chain having a feline variable region, the method comprising expressing in a cell a nucleic acid encoding the antibody chain or a portion thereof, wherein the sequence of the nucleic acid encoding the variable region of the antibody chain is obtained or can be obtained from a rodent according to any one of claims 1 to 18 immunized with an antigen, or from an antibody in the antibody library according to claims 29 to 31, and the sequence comprises one of the feline heavy gene segment, kappa gene segment or lambda gene segment according to claims 1, 5 or 10, respectively, The method optionally comprises the following subsequent steps: purifying and / or isolating said antibody chains, and The antibody is optionally then formulated into a pharmaceutically acceptable formulation suitable for administration to a cat.

38. A method of preparing a pharmaceutical composition, the method comprising producing an antibody according to any one of claims 35 to 37, and further comprising combining the antibody with a pharmaceutically acceptable carrier or other excipient to produce the pharmaceutical composition.

39. A pharmaceutical composition comprising the antibody according to claims 25 to 28, which is a monoclonal antibody.

40. A method of treating a cat, the method comprising delivering to a cat in need thereof an antibody or antibody chain or a functional portion thereof, the antibody being obtained or obtainable from a rodent or cell according to any one of claims 1 to 18, optionally wherein The antibody chain is according to any one of claims 20, 22, 24 or 32, and / or The antibody or antibody chain is in the form of a pharmaceutical composition according to any one of claims 25 to 28, and / or The antibody or antibody chain is a whole cat antibody or antibody chain, and the whole cat antibody or antibody chain has a cat variable region and a constant region; Preferably wherein the method comprises delivering the antibody in the form of a pharmaceutical composition having a full feline heavy chain and a full feline light chain.

41. A rodent or rodent cell having a genome comprising a feline IGH V gene segment, one or more feline IGH D region gene segments and one or more feline IGH J region gene segments, wherein the feline IGH V gene segment is selected from the list comprising: IGH V3-14 (SEQ ID NO: 1), V1-36 ​​(SEQ ID NO: 11), V1-104 (SEQ ID NO: 12) and V1-42 (SEQ ID NO: 15), Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain.

42. A rodent or rodent cell having a genome comprising feline IGK V gene segment IGK V2-5 (SEQ ID NO: 23) and one or more feline IGH J region gene segments, Wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody light chain.

43. A vector or cell genome or cell line genome or rodent genome comprising the feline D gene segment IGHD-N1 (SEQ ID NO: 48).

44. A rodent or rodent cell having a genome comprising: one or more feline IGHV gene segments, a feline D gene segment IGHD-N1 and one or more feline IGH J region gene segments, wherein the rodent or rodent cell is capable of expressing the feline gene segment to form an antibody heavy chain, Optionally wherein no more than 9 feline IGH V gene segments are present, and wherein at least one of the feline IGH V gene segments is selected from the list comprising: V3-14, V3-11, V3-12, V3-84, V3-20, V3-27, V4-3, V3-16N3 and V3-5.

Images