Pyridoxal 5'-phosphate synthase mutant T50W and its application in the synthesis of pyridoxal 5'-phosphate

Abstract

The present invention belongs to the field of genetic engineering and enzyme engineering, and discloses a 5'-pyridoxal phosphate synthase mutant T50W and its application in the synthesis of 5'-pyridoxal phosphate. The present invention uses site-directed mutagenesis to synthesize a 5'-pyridoxal phosphate synthase mutant T50W derived from Bacillus licheniformis ( Bacillus licheniformis The 50th amino acid of the PLP synthase small subunit PdxT of the 5'-1 ... T50W The yield of PLP synthesis was increased by 37.4% compared with the wild type. The PLP synthase mutant and engineered strain obtained by the present invention have greatly improved the ability to produce PLP through fermentation, and have good industrial application prospects.

Description

Technical Field

[0001] The invention belongs to the fields of enzyme engineering and genetic engineering, and particularly relates to a 5'-pyridoxal phosphate synthase mutant T50W and application thereof in the synthesis of 5'-pyridoxal phosphate. Background Art

[0002] Pyridoxal-5'-phosphate (PLP) is the only metabolically active form of vitamin B6 (VB6), a coenzyme for over 160 enzymes. PLP can act as a scavenger of reactive oxygen species, a metal chelator, and a molecular chaperone in enzyme folding. It also controls the expression and function of steroid hormone receptors and may positively impact immune function. It holds high commercial value and is in high demand in the healthcare, food, animal husbandry, and agricultural sectors.

[0003] At present, the synthesis method of PLP mainly adopts the oxazole chemical synthesis method for artificial total synthesis. However, this synthesis method has many problems such as time-consuming and energy-consuming, serious pollution, high cost and low recovery rate. Therefore, it is of great significance to develop a green and sustainable microbial fermentation method to synthesize PLP. Researchers often use Escherichia coli or rhizobia to produce VB6, and increase the production of VB6 by endogenous or heterologous expression of related genes. Zhang Dawei's team reconstructed the de novo synthesis pathway of vitamin B6, enhanced the precursor DXP and the intermediate metabolite 4HTP to promote metabolic flow, and strengthened the key genes PdxA and PdxJ in the downstream synthesis pathway. They obtained a high-yielding Escherichia coli chassis strain of pyridoxine (PN) with a fermentation yield of 1.4g / L (Liu et al., Nat Commun. 2023 Aug 31; 14(1): 5304). Wu Jing's team used Salmonella typhi acid phosphatase (StAPase) and Escherichia coli pyridoxine oxidase (EcPNPO) as pathway enzymes, and pyridoxine (PN) and pyrophosphate (PPi) as substrates to synthesize PLP, with a yield of 15g / L (Wang et al., J Agric Food Chem. 2024Apr 11). However, the efficiency of E. coli in synthesizing VB6 is relatively low, and it produces endotoxins, so the use of E. coli as a production strain has certain limitations. In addition, the low catalytic efficiency of natural enzymes and the strict regulation of metabolic pathways hinder the high yield of VB6 during microbial fermentation, making its production level in microbial fermentation still not commercially valuable. Therefore, in order to achieve sustainable commercial production of VB6, a large amount of microbial metabolic engineering research and technological innovation are still needed.

[0004] Pyridoxal-5'-phosphate synthase (PdxST) is a key enzyme in Bacillus that catalyzes the synthesis of poly(lactic acid) phosphate (PLP). The protein structure of PLP synthase has been determined, revealing that it consists of two subunits, PdxS and PdxT, forming a heterodimer that then forms a 12-mer to function. Researchers have found that mutation of histidine to asparagine at position 170 in the active site of the glutaminase subunit PdxT significantly enhances the catalytic activity of PdxST. Furthermore, no studies have yet investigated the mutational modification of Pyridoxal-5'-phosphate synthase in China or abroad. Therefore, to further increase PLP production, we need to develop more efficient Pyridoxal-5'-phosphate synthases and recombinant strains that can efficiently produce PLP. Bacillus licheniformis is a food-safe strain used to synthesize substances such as phenylalanine, acetoin, and 2,3-butanediol. However, there are no reports of using Bacillus licheniformis as a cell factory to synthesize Pyridoxal-5'-phosphate. Summary of the Invention

[0005] The purpose of the present invention is to provide a PLP synthase mutant T50W with improved catalytic performance to solve the problem of low catalytic efficiency of existing PLP synthase. The mutant is shown in SEQ ID NO.4.

[0006] Another object of the present invention is to provide the use of the PLP synthase mutant T50W in producing PLP.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] The applicant mutated the 50th amino acid of the wild-type PLP synthase from Bacillus licheniformis DW2 from threonine to tryptophan to obtain the PLP synthase mutant T50W of the present invention, which is shown in SEQ ID NO.4.

[0009] The protection scope of the present invention includes:

[0010] The gene encoding the protein shown in SEQ ID NO.4.

[0011] An expression vector containing the above gene;

[0012] A recombinant microorganism expressing the protein represented by SEQ ID NO.4;

[0013] The microorganism mentioned above is preferably Bacillus licheniformis, which has the ability to metabolize and produce pyridoxal 5'-phosphate.

[0014] The Bacillus licheniformis mentioned above is preferably Bacillus licheniformis DW2.

[0015] Use of the above substances in the preparation of 5'-pyridoxal phosphate synthase;

[0016] In the above application, preferably, the gene encoding the protein shown in SEQ ID NO. 4 is inserted into an expression vector, and transformed into Bacillus licheniformis DW2 for fermentation expression.

[0017] Application of the above substances in the preparation and production of 5'-pyridoxal phosphate.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] The present invention uses site-directed mutagenesis to mutate the 50th amino acid of PLP synthase from threonine to tryptophan, significantly improving the catalytic activity of PLP synthase and greatly enhancing its ability to produce PLP. Fermentation yield analysis revealed that, compared to wild-type PLP synthase, the PLP synthase mutant T50W of the present invention exhibited significantly improved PLP synthesis under fermentation conditions with glucose as the sole carbon source, demonstrating its greater suitability for industrial production. Experiments have shown that a recombinant strain of Bacillus licheniformis expressing the PLP synthase mutant has excellent PLP production capacity. After 60 hours of shake flask fermentation at 37°C, the T50W mutant increased PLP production by 37.4% compared to the control strain, reaching 140.53 mg / L. This yield demonstrates better prospects for industrial application than recombinant bacteria containing the unmutated PLP synthase gene. DETAILED DESCRIPTION

[0020] The technical solutions described in the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all commercially available. To make the technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to specific examples, but this does not constitute a limitation of the present invention.

[0021] The culture medium involved in the following examples is as follows:

[0022] LB liquid medium: yeast powder 5g·L -1 , peptone 10 g·L -1 、NaCl 10g·L -1 , pH 7.0.

[0023] LB solid medium: yeast powder 5g·L -1 , peptone 10 g·L -1 、NaCl 10g·L -1 , agar powder 15g·L -1 .

[0024] PP liquid culture medium: yeast powder 15g·L -1 、(NH4)2SO4 20g·L -1 、KH2PO4 2g·L-1 、MgSO4·7H2O3g·L -1 、MnSO4 5mg·L -1 , 80g / L glucose, the solvent is deionized water, and the pH value is natural.

[0025] The detection methods involved in the following embodiments are as follows:

[0026] HPLC detection of PLP content:

[0027] The fermentation broth supernatant was filtered through a 0.22 μm microporous filter membrane, and the PLP yield was detected by high performance liquid chromatography (HPLC).

[0028] The HPLC operating conditions were as follows: the chromatographic separation column was a Hypersil ODS2 C18 (250 mm × 4.6 mm), the UV detection wavelength was 291 nm, the injection volume was 10 μL, the mobile phase A was 100% methanol, the mobile phase B was 0.1% formic acid, the pH was natural, the detection mobile phase was 100% methanol:0.1% formic acid = 20%:80%, and the flow rate was 0.6 ml / min.

[0029] The yield of generated PLP was calculated based on the absorption peak area and the peak area of ​​PLP standard.

[0030] Example 1:

[0031] Construction of recombinant plasmid pHY-pdxST:

[0032] The PLP synthase gene pdxST (SEQ ID NO. 1, encoding the protein SEQ ID NO. 2) was cloned from Bacillus licheniformis DW2 (Bacillus licheniformis DW2, CCTCC NO: M2011344, CN111321099A) using pdxST-F and pdxST-R. The P43 promoter was amplified using primers P43-F and P43-R from the Bacillus subtilis 168 genome. The amylase terminator TamyL was amplified using primers TamyL-F and TamyL-R. Using primers P43-F and TamyL-R, the P43, pdxST, and TamyL fragments were amplified using SOE-PCR to generate the fusion fragment P43-pdxST-TamyL. Using the plasmid pHY300PLK as a template and primers pHY-T5-F and pHY-T5-R, full-plasmid PCR amplification was performed to obtain the linearized pHY300PLK vector. The amplified product was verified by electrophoresis and purified and recovered using a gel extraction kit. The fusion fragment was fused to the linearized pHY300PLK vector using the ClonExpress II One-Step Cloning Kit to generate the recombinant plasmid pHY-pdxST. The fused recombinant plasmid pHY-pdxST was transformed into competent E. coli DH5α, and positive colonies were selected on LB plates containing tetracycline. After overnight incubation at 37°C in a shaking incubator, the plasmid pHY-pdxST was extracted and verified by sequencing.

[0033] Among them, the sequence of the primer is:

[0034] P43-F:TTTTTATAACAGGAATTCTGATAGGTGGTATGTTTTCG

[0035] P43-R:TAATCTCCTACTGTATACATTGATCCTTCCTCCTTTAGA

[0036] pdxST-F:GTATACAGTAGGAGATTAATGGCTCAAACAGGTACT

[0037] pdxST-R:ATGATTTATTTTGTTCAGTTATACGACGGCTTCCTG

[0038] TamyL-F:CTGAACAAAATAAATCATAAAAGAGCAGAGAGGACGGATT

[0039] TamyL-R:TTTGCCCCAAGCTTCTAGAAGCGCAATAATGCCGTCGCACT

[0040] pHY-T5-F:GAATTCCTGTTATAAAAAAAGGATC

[0041] pHY-T5-R:TCTAGAAGCTTGGGCAAAGCGTTTT

[0042] Example 2:

[0043] Preparation of engineered Bacillus licheniformis expressing wild-type PLP synthase and enzyme activity determination:

[0044] The plasmid pHY-pdxST sequenced correctly in Example 1 was transformed into Bacillus licheniformis DW2 as a wild-type control strain for use in the following examples. Transformants were selected and verified to be correct, inoculated into LB medium, and cultured at 37°C for 12 hours. Transformants were then transferred to TB liquid medium with an inoculum size of 3% and cultured at 37°C for 24 hours. The cells were collected by centrifugation, washed twice with PBS, reconstituted with PBS, and added with a final concentration of 0.6 mg mL -1 The lysozyme was reacted at 37°C for 30 min, and then placed in ice water for ultrasonic crushing (ultrasonic power 25%, time 10 min), 12000 r·min -1 Centrifuge for 5 minutes to obtain the supernatant which is the crude PLP synthase enzyme solution.

[0045] Determination of PLP synthase activity:

[0046] Substrate solution preparation: 1mM R5P + 1mM G3P + 5mM glutamine dissolved in 50mM Tris-HCl, pH 9.0; Reaction system: Take 1mL of substrate solution into a 1.5mL centrifuge tube, preheat at 37°C for 5min, add 100μL of the obtained crude PLPase enzyme solution, and react for 30min; add 8% TCA to terminate the reaction, centrifuge at 10,000xg for 1min, and detect the amount of PLP produced by HPLC.

[0047] Enzyme activity definition: One unit (U) is defined as the amount of enzyme required to produce 1 nmol / min of PLP.

[0048] Example 3:

[0049] Preparation of PLP synthase mutants:

[0050] A site-directed mutagenesis strategy was used to design point mutation primers according to the amino acid site to be mutated. The 50th threonine of the PLP synthase small subunit PdxT was mutated to tryptophan. The base encoding the 50th amino acid of PdxT was split into two parts, and the PLP synthase mutant sequence was obtained by PCR.

[0051] Specifically, the pHY-pdxST constructed in Example 1 was used as a template, primers T50W-F and T50W-R were designed, and whole-plasmid PCR amplification was performed to obtain the linearized pHY-pdxST with P43 promoter and amylase TamyL terminator. T50W vector, and then the linearized vector pHY-pdxST T50W The recombinant plasmid pHY-pdxST was obtained by backbone self-ligation. T50W Then, the competent E. coli was transformed and coated with a selection plate containing tetracycline. The recombinant plasmid mutant containing a specific mutation site was screened and sequenced to confirm. The mutant plasmid was named pHY-pdxST T50W .

[0052] T50W-F:GAAAGCTGGACGATGAGGCGCCTCATCGATACG

[0053] T50W-R:CCTCATCGTCCAGCTTTCCCCTCCCGGC

[0054] According to the above method, the applicant also constructed pHY-pdxST M16Y , pHY-pdxST M16W , pHY-pdxST M16L , pHY-pdxST E48R Plasmids used as mutant controls:

[0055] pHY-pdxST M16Y This is an expression plasmid prepared by mutating the methionine at position 16 of the PdxS subunit of PLP synthase to tyrosine;

[0056] pHY-pdxST M16W This is an expression plasmid prepared by mutating the 16th methionine of the PdxS subunit of PLP synthase to tryptophan;

[0057] pHY-pdxST M16L This is an expression plasmid prepared by mutating the methionine at position 16 of the PdxS subunit of PLP synthase to leucine;

[0058] pHY-pdxST E48R This is an expression plasmid prepared by mutating the 48th glutamic acid of the PdxT subunit of PLP synthase to arginine.

[0059] Example 4:

[0060] Preparation of PLP synthase mutant engineered strains and enzyme activity determination:

[0061] The mutant plasmid sequenced correctly in Example 3 was transformed into Bacillus licheniformis DW2, wherein pHY-pdxST E48R The plasmid was transformed into Bacillus licheniformis DW2 and named as recombinant Bacillus licheniformis DW2 / pHY-pdxST E48R After selecting and verifying the correct transformants, inoculate them into LB medium and culture at 37°C for 12 hours. Then transfer them into TB liquid medium with an inoculum size of 5% and culture at 37°C for 24 hours.

[0062] The enzyme activity of the recombinant strain was detected according to the method in Example 2. The experimental results showed that compared with the control strain, the enzyme activity of the T50W mutant was 10.11 U / mL, which was 2.4 times that of the control strain. However, the enzyme activities of the other mutants were all lower than those of the control group under the same conditions (Table 1).

[0063] Table 1: Comparison of PLP synthase activity between mutants and wild-type control group under fermentation conditions

[0064]

[0065] Example 5:

[0066] Recombinant strains expressing wild-type and mutant PLP synthases produce PLP using glucose fermentation

[0067] The recombinant Bacillus licheniformis DW2 / pHY-pdxST obtained in Example 4 T50W Fermentation was performed with recombinant Bacillus licheniformis of other mutants, and the recombinant strain DW2 / pHY-pdxST obtained in Example 2 was used as a control.

[0068] The specific steps of seed fermentation are: first, recombinant Bacillus licheniformis DW2 / pHY-pdxST T50W , DW2 / pHY-pdxST M16Y , DW2 / pHY-pdxST M16W , DW2 / pHY-pdxST M16L , DW2 / pHY-pdxST E48R and DW2 / pHY-pdxST from glycerol tubes containing 20 μg mL -1 Activate by streaking on LB solid medium containing tetracycline and invert the medium at 37°C for 20-24 hours. Pick the colony and inoculate it into a medium containing 20 μg·mL-1 5 mL of LB medium containing tetracycline, 230 r·min -1 , temperature 37 ℃, culture for 10-12h. Then inoculate the activated bacterial solution with 3% (v / v) inoculation volume to contain 20μg·mL -1 In 50 mL of LB liquid medium containing tetracycline, 37°C, 230 r·min -1 Culture for 10-12h, and obtain the seed solution (OD 600 4.0-5.0).

[0069] The specific steps of production and fermentation are as follows: 50 mL of PP liquid culture medium was added to a 250 mL triangular flask, the seed liquid was transferred to the PP liquid culture medium at a 3% (v / v) inoculum, and the mixture was incubated at 37°C and 230 r·min. -1 After culturing for 60 h, the fermentation broths of the control group and the experimental group were obtained, with 3 replicates in each group.

[0070] The PLP production of the fermentation broth of the experimental group and the control group was detected. The test results are shown in Table 2. T50W The yield of the control strain DW2 / pHY-pdxST was 140.53 mg / L, while the yield of the mutant engineered strain DW2 / pHY-pdxST was 102.30 mg / L. T50W The yield increased by 37.4% compared with the control bacteria.

[0071] Table 2: PLP production by mutant engineered bacteria and wild-type control group

[0072]

Claims

1. A pyridoxal 5'-phosphate synthase mutant T50W, the amino acid sequence of the mutant being shown in SEQ ID NO.

4.

2. A gene encoding the protein shown in SEQ ID NO.

4.

3. An expression vector containing the gene according to claim 2.

4. A recombinant microorganism expressing the protein represented by SEQ ID NO.

4.

5. The recombinant microorganism according to claim 4, wherein the microorganism is Bacillus licheniformis ( Bacillus licheniformis ), the Bacillus licheniformis has the ability to metabolize and produce 5'-pyridoxal phosphate. The recombinant microorganism according to claim 5 , wherein the Bacillus licheniformis is Bacillus licheniformis DW2.

7. Use of the mutant according to claim 1, the gene according to claim 2, the expression vector according to claim 3 or the recombinant microorganism according to claim 5 in the preparation of pyridoxal 5'-phosphate synthase.

8. The use according to claim 7, wherein when the gene according to claim 2 is used to prepare 5'-pyridoxal phosphate synthase, the process is to insert the gene encoding the protein shown in SEQ ID NO. 4 into an expression vector, transform it into Bacillus licheniformis DW2 and express it by fermentation.

9. Use of the mutant according to claim 1, the gene according to claim 2, the expression vector according to claim 3 or the recombinant microorganism according to claim 5 in the preparation and production of 5'-pyridoxal phosphate.

Images