A nucleic acid molecule related to potato anthocyanin accumulation and its application
By identifying the StMYB200 and StMYB210 genes and inserting nucleic acid molecules into their promoter regions, the anthocyanin synthesis genes were activated, solving the problem of the lack of molecular markers for anthocyanin accumulation in potato flesh. This enabled efficient anthocyanin accumulation and variety screening, and promoted the breeding of colored potatoes.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2024-12-16
- Publication Date
- 2026-04-21
AI Technical Summary
The lack of molecular markers in existing technologies to regulate anthocyanin accumulation in potato flesh hinders the development of new anthocyanin-rich potato varieties.
The StMYB200 and StMYB210 genes were identified for the first time, and a 1.7kb nucleic acid molecule was inserted into their promoter region. Codominant marker primer pairs were developed to promote the accumulation of anthocyanins in potato flesh by activating the expression of StMYB210 protein.
It has achieved efficient and stable anthocyanin accumulation in potato flesh, providing a tool for screening anthocyanin-rich varieties in potato breeding and promoting the progress of colored potato breeding.
Smart Images

Figure CN119391705B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of plant breeding, specifically to a nucleic acid molecule associated with anthocyanin accumulation in potatoes and its applications. Background Technology
[0002] Anthocyanins are flavonoid compounds, currently considered the most effective antioxidants and free radical scavengers discovered by humankind, possessing anti-mutagenic properties. Because they meet people's demand for natural, safe, and healthy products, anthocyanin-rich products are highly sought after. In plants, the anthocyanin synthesis pathway is synergistically regulated by structural and regulatory genes. The main regulatory genes involved in anthocyanin synthesis are MYB transcription factors, bHLH transcription factors, and WD40 repeat proteins. They typically form the MBW complex to regulate the expression of structural genes in the anthocyanin pathway, thereby controlling anthocyanin synthesis in plants.
[0003] The potato (Solanum tuberosum L.) is one of the most important tuber crops. In nature, its tubers come in a variety of colors, ranging from white to deep purple-blue, mainly due to the accumulation of anthocyanins and carotenoids. However, cultivated varieties of potatoes are predominantly yellow and white. Although there are some red-skinned or purple-skinned potato varieties, the demand for potatoes is far from meeting the needs of consumers, as the edible part of the potato is the flesh.
[0004] Currently, three main loci have been reported for anthocyanin accumulation in potato tubers: Developer / Inhibitor (D / I), Red (R), and Purple (P). The R and P genes encode dihydroflavonol 4-reductase (DFR) and flavonoid 3',5'-hydroxylase (F3'5'H), located on chromosomes 2 and 11, respectively. The D / I locus, located on chromosome 10, encodes the R2R3-MYB transcription factor Solanum tuberosum anthocyanin 2 (Stan2), which regulates the specific accumulation of anthocyanins in the potato skin. However, the specific gene encoding the Pigmented tuber flesh (Pf) locus, which regulates the specific accumulation of anthocyanins in the flesh, remains unknown, and the lack of corresponding molecular markers hinders the development of new anthocyanin-rich potato varieties. Summary of the Invention
[0005] This application identifies for the first time two genes, StMYB200 and StMYB210, that regulate anthocyanin accumulation in potato flesh, which can be used to regulate anthocyanin accumulation in potato flesh. It also provides for the first time a 1.7kb Indel nucleic acid molecule from the promoter region of the StMYB210 gene, which has the function of regulating anthocyanin accumulation in potato flesh. Furthermore, this application develops a pair of highly efficient and stable co-dominant markers that can be used for screening disomyotrophic potato germplasm containing anthocyanins in the flesh.
[0006] To achieve the above-mentioned objectives, this application provides the following technical solution:
[0007] First, this application provides a nucleic acid molecule whose nucleic acid sequence is shown in SEQ ID NO:1.
[0008] The sequence contains 10 repeat segments, each approximately 100 bp in length, and contains multiple MBSs elements, including two types: MBS1 (CAACGG) and MBS2 (ACCAA / ATCAAA).
[0009] Inserting it into the promoter region of the StMYB210 gene can activate the expression of StMYB210.
[0010] This application provides the application of the above-mentioned nucleic acid molecules in regulating the accumulation of anthocyanins in potato flesh.
[0011] Specifically, the nucleic acid molecules bind to StMYB200 and / or StMYB210 proteins to promote the accumulation of anthocyanins in potato flesh.
[0012] Specifically, the nucleic acid molecule is located in the promoter region of the StMYB210 gene.
[0013] Both StMYB200 and StMYB210 proteins can activate the expression of StMYB210 by binding to the MBSs element in the aforementioned nucleic acid molecules, thereby activating the expression of the anthocyanin synthesis structure gene StDFR and accumulating anthocyanins in the potato flesh.
[0014] Specifically, the amino acid sequence of the StMYB200 protein is shown in SEQ ID NO:2, and the amino acid sequence of the StMYB210 protein is shown in SEQ ID NO:3.
[0015] This application provides a primer pair, the sequences of which are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0016] StMYB210pro-Indel-F:GATCGCACATTATATGGCCCT(SEQ NO:4),
[0017] StMYB210pro-Indel-R: GTCACCTCCTTGATATGTGGCC (SEQ NO: 5).
[0018] This primer pair is a codominant marker primer developed based on the above-mentioned nucleic acid molecule. It can determine the genotype of potato, such as homozygous insertion genotype, heterozygous genotype, or homozygous non-insertion genotype, by identifying the presence of the nucleic acid molecule.
[0019] This application also provides for the use of the above primer pairs in at least one of the following:
[0020] (1) Screening or identifying the genotype of potatoes based on the above nucleic acid molecules;
[0021] (2) Screening or identifying potato materials that contain or do not contain the above-mentioned nucleic acid molecules;
[0022] (3) Potato-assisted breeding or variety improvement, or preparation of related products;
[0023] (4) Cultivate potato varieties rich in or not rich in anthocyanins, or prepare related products.
[0024] Preferably, the product includes a reagent kit.
[0025] This application provides a kit containing reagents for detecting the aforementioned nucleic acid molecules.
[0026] Preferably, the reagent comprises the primer pair described above. The sequences of the primer pair are shown in SEQ NO:4 and SEQ NO:5.
[0027] This application provides a method for screening potato plants, the method comprising: identifying whether the genome of the potato plant contains the aforementioned nucleic acid molecules to screen the potato plant.
[0028] Preferably, the above primers are used to perform PCR amplification on the genome of potato plants, and the PCR amplification products are sequenced or electrophoresed to determine whether the potato plants to be tested contain the above nucleic acid molecules.
[0029] This application also provides a method for producing or cultivating potatoes with flesh rich in anthocyanins, the method comprising:
[0030] The recipient potato plant expressed StMYB200 and StMYB210 proteins, which were lacking the StMYB200 and / or StMYB210 proteins.
[0031] Preferably, the promoter region expressing the StMYB210 protein contains the aforementioned nucleic acid molecule.
[0032] In some embodiments, the method includes: introducing a StMYB200 protein expression vector into a recipient potato plant, the recipient potato plant being a potato plant lacking StMYB200 protein expression; and / or: introducing a StMYB210 protein expression vector into a recipient potato plant, the recipient potato plant being a potato plant lacking StMYB210 protein expression.
[0033] Specifically, the importation methods include importation using genetic engineering and / or importation using hybridization breeding.
[0034] In one embodiment, the promoter sequence of the StMYB210 protein containing the above-described nucleic acid molecule is shown in SEQ ID NO:6.
[0035] In one embodiment, the nucleic acid sequence encoding the StMYB200 protein is shown in SEQ ID NO:7, and the nucleic acid sequence encoding the StMYB210 protein is shown in SEQ ID NO:8.
[0036] This application also provides a method for producing or cultivating potatoes whose flesh does not contain anthocyanins, the method comprising:
[0037] Expression of StMYB200 and / or StMYB210 proteins in silencing receptor potato plants, wherein the amino acid sequence of StMYB200 protein is shown in SEQ ID NO:2 and the amino acid sequence of StMYB210 protein is shown in SEQ ID NO:3.
[0038] In some embodiments, the method of silencing expression includes knocking out the gene encoding the StMYB200 and / or StMYB210 protein, its promoter region, etc.
[0039] In some implementations, the method for silencing expression includes gene editing technology, RNAi technology, etc.
[0040] The beneficial effects of this application are as follows: This application is the first to identify and prove that two R2R3-MYB transcription factor genes, DM8C10G21200 (StMYB200) and DM8C10G21210 (StMYB210 / Stan2 / StAN1), are genes encoded by the Pf site and are involved in the accumulation of anthocyanins in potato flesh; at the same time, the 1.7kb insertion fragment (SEQ ID NO:1) in the StMYB210 promoter provided in this application has been proven to be related to the expression of StMYB210. This insertion fragment is essential for the accumulation of anthocyanins in potato flesh. Potato materials with anthocyanin accumulation in the flesh must contain this insertion fragment, which can be applied to the breeding of anthocyanin-rich potato varieties and accelerate the breeding of colored potatoes. Attached Figure Description
[0041] Figure 1 Genome-wide association analysis of potato flesh color.
[0042] Figure 2 The gene distribution at the Pf site.
[0043] Figure 3 Expression patterns of candidate genes at the Pf locus in the skin and flesh of diploid potatoes 01-58 and RH were analyzed.
[0044] Figure 4 A schematic diagram of sequence mutations in the StMYB200 and StMYB210 knockout lines.
[0045] Figure 5 Phenotypic diagram of tuber of StMYB200 and StMYB210 knockout lines.
[0046] Figure 6 Expression analysis of structural genes in the anthocyanin synthesis pathway in StMYB200 and StMYB210 knockout lines.
[0047] Figure 7 This is a schematic diagram of the structure of two haplotypes of the StMYB210 gene in strain 01-58.
[0048] Figure 8 To identify white and red sweet potato flesh lines in the self-pollinated progeny of 01-58 and the 1.7 kb insertion in the StMYB210 promoter.
[0049] Figure 9 Expression levels of pf / pf and Pf / Pf lines were analyzed in the self-pollinated progeny of 01-58.
[0050] Figure 10 This is a schematic diagram of the structure of the 1.7kb insertion sequence of the StMYB210 promoter in the Pf haplotype.
[0051] Figure 11 The 1.7kb insertion sequence for the StMYB210 promoter in the Pf haplotype (the red-marked sequence is MYBbinding site 1 (MBS1), and the blue-marked sequence is MYB binding site 2 (MBS2)).
[0052] Figure 12 StMYB200 and StMYB210 expression were activated by a 1.7kb insert sequence that binds to the StMYB210 promoter.
[0053] Figure 13To identify the tuber phenotypes of 24 diploid potato materials and to identify and analyze the 1.7kb insertion of the StMYB210 gene.
[0054] Figure 14 Statistical analysis of the 1.7kb insertion of the StMYB210 gene in 354 diploid potato materials. Detailed Implementation
[0055] In some embodiments of this application, a genome-wide association study (GWAS) was conducted on 135 diploid potato materials, and a major site Pf regulating potato flesh color was identified at the end of chromosome 10. Combined with genome annotation and transcriptome analysis, it was speculated that two tandem R2R3-MYB transcription factors, DM8C10G21200 (StMYB200) and DM8C10G21210 (StMYB210), may be candidate genes for the Pf site.
[0056] In some embodiments of this application, gene editing technology was used to provide evidence that the two R2R3-MYB transcription factors mentioned above are involved in the accumulation of anthocyanins in potato flesh. These two transcription factors are essential for the accumulation of anthocyanins in potato flesh. Transcriptome sequencing analysis further showed that StMYB200 and StMYB210 are involved in the accumulation of anthocyanins in potato flesh.
[0057] In some embodiments of this application, the promoter sequence of the StMYB210 gene is provided, and a 1.7kb insertion / deletion (Indel) is discovered for the first time in the promoter region of the StMYB210 gene. Based on the 1.7kb Indel fragment in the promoter region of the StMYB210 gene, a pair of efficient and stable codominant markers (marker primers are StMYB210pro-Indel-F / -R) were developed. These codominant marker primers can accurately identify the homozygous or heterozygous genotypes of the 1.7kb Indel in the StMYB210 promoter. Using these marker primers to amplify the self-pollinated progeny lines of 01-58, it was found that the white-fleshed lines all belonged to the pf / pf genotype without the 1.7kb insertion, while the red-fleshed lines all belonged to the Pf / Pf genotype with the 1.7kb insertion.
[0058] In some embodiments of this application, expression level analysis and biochemical assays are provided to demonstrate that StMYB200 and StMYB210 activate the expression of StMYB210 by binding to a 1.7kb insert fragment in the StMYB210 promoter, thereby affecting the accumulation of anthocyanins in potato flesh.
[0059] In some embodiments of this application, 24 diploid potato materials (including 4 wild species with white skin and white flesh, and 20 local varieties (11 with no anthocyanin accumulation in the flesh and 9 with anthocyanin accumulation in the flesh) were amplified using the provided codominant marker primers (marker primers were StMYB210pro-Indel-F / -R). At the same time, RNA was extracted from the flesh for semi-quantitative experiments, which confirmed that the 1.7kb insert in the StMYB210 promoter was associated with the expression of the gene and the accumulation of anthocyanins in the flesh. Potato materials with anthocyanin accumulation in the flesh must contain this insert. The StMYB210 promoter of 354 diploid potato materials (100 wild materials with colorless flesh, 211 local varieties with no anthocyanin accumulation in flesh, and 43 local varieties with anthocyanin accumulation in flesh) was amplified and identified using co-dominant marker primers (marker primers StMYB210pro-Indel-F / -R). This further demonstrated from the perspective of natural populations that the presence of the 1.7kb insert is associated with anthocyanin accumulation in potato flesh, and that potato materials with anthocyanin accumulation in flesh must contain this insert.
[0060] The nucleic acid molecule provided in this application includes the sequence shown in SEQ ID NO:1. According to a preferred embodiment of the present invention, the provided nucleic acid molecule is the sequence shown in SEQ ID NO:1. The provided nucleic acid molecule may also be a DNA fragment containing the nucleotide sequence shown in SEQ ID NO:1, that is, the nucleotide sequence other than the 5' end and / or 3' end of SEQ ID NO:1, or the sequence of the StMYB210 gene in the potato genome, for example, it may contain the upstream and downstream sequences of the 5' end and / or 3' end of SEQ ID NO:1 in the StMYB210 gene of the potato genome. Those skilled in the art will understand that as long as the sequence shown in SEQ ID NO:1 is amplified or detected in potato genomic DNA, only that nucleic acid molecule can be detected or amplified. The length of the DNA fragment is appropriate, but not particularly limited.
[0061] To better understand this application, the following embodiments are provided for further detailed description of this application, but they should not be construed as limiting this application. Any non-essential improvements and adjustments made by those skilled in the art based on the above-described invention are also considered to fall within the protection scope of this application.
[0062] In the embodiments, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.
[0063] Example 1: Discovery of potato flesh color regulating genes StMYB200 and StMYB210
[0064] This application aims to identify genetic loci regulating potato flesh color. 135 diploid potato accessions were selected and planted in an experimental field. Phenotypic evaluation of flesh color was conducted after tuber maturity. Of the 135 accessions, 26 had red or purple flesh, and 109 had white or yellow flesh. Using published genome resequencing data from these 135 accessions, GWAS analysis was performed on the flesh color trait, identifying a significant locus at the end of chromosome 10, such as… Figure 1 As shown. The pigmented tuber flesh (Pf) site, which was previously identified as a regulatory site for anthocyanins in potato flesh, is closely linked to the D / I site located on chromosome 10. Therefore, the site identified in this application is also named the Pf site.
[0065] Based on the genome annotation information of the potato reference genome DM (v8.1), a MYB gene cluster containing eight R2R3-MYB transcription factors was found near the Pf site identified in this application: StMYB120, StMYB130, StMYB170, StMYB180, StMYB200, StMYB210, StMYB240, and StMYB270. Figure 2 As shown. Meanwhile, this application performed transcriptome sequencing analysis on the skin and flesh of diploid potato material 01-58 (red skin, red flesh) and potato material RH89-039-16(RH) (white skin, white flesh), respectively. It was found that among the eight R2R3-MYB transcription factors, only StMYB200 and StMYB210 were highly expressed in red flesh, while they were almost not expressed in white flesh. Figure 3 As shown, StMYB200 and StMYB210 may be candidate genes at the Pf site, involved in the regulation of anthocyanin synthesis in potato flesh.
[0066] Example 2: Functional verification of StMYB200 and StMYB210 genes regulating anthocyanin accumulation in potato flesh
[0067] To verify whether StMYB200 and StMYB210 are involved in the regulation of anthocyanins in potato flesh, this application used DM (v8.1) as the reference genome and designed sgRNA targets for the StMYB200 and StMYB210 genes using the CRISPRdirect online analysis website (https: / / crispr.dbcls.jp / ), with two targets designed for each gene. The dual-target knockout vectors StMYB200Cas and StMYB210Cas for the StMYB200 and StMYB210 genes were constructed using the pCAMBIA2300MGFPuv-sgRNACas vector construction method (see Chinese Journal of Agricultural Science 2023, 56(11):2223-2236). The specific primer sequences for vector construction are as follows (bold and underlined sequences are sgRNA or their complementary sequences, and the rest are adapter sequences for vector construction):
[0068]
[0069] Plasmids StMYB200Cas and StMYB210Cas were transformed into red-skinned, red-fleshed diploid potato material 01-58 using Agrobacterium GV3101, and positive plants were screened. The initially screened positive plants were subjected to PCR amplification and sequencing, and the mutation type of each line was analyzed based on the sequencing results. Ultimately, one homozygous knockout mutant of StMYB200, StMYB200ko1, and two homozygous knockout mutants of StMYB210, StMYB210ko1 and StMYB210ko2, were obtained. Figure 4 As shown.
[0070] The mutants obtained above were propagated on a large scale and planted in the experimental base, while wild-type potato WT (non-GMO 01-58) was planted as a control. After the tubers matured, their phenotypes were investigated. Figure 5 As shown, compared with WT, the flesh of the StMYB200 knockout strain StMYB200ko1 and the StMYB210 knockout strains StMYB210ko1 and StMYB210ko2 changed from red to white, indicating that both StMYB200 and StMYB210 are involved in the regulation of anthocyanin accumulation in potato flesh. The lack of expression of either one will lead to the potato's inability to effectively accumulate anthocyanins, and the flesh will turn white.
[0071] Furthermore, RNA was extracted from the potato flesh of the 01-58, StMYB200ko1, and StMYB210ko1 lines for RNA-seq analysis. The results showed that knockout of StMYB200 and StMYB210 had varying degrees of impact on the expression of structural genes in the phenylpropane pathway. Figure 6In the knockout lines, except for F3'H, ANS-2, and ANS-3, the expression levels of structural genes related to the flavonoid metabolism pathway, such as CHS, CHI, F3H, F3'5'H, DFR, ANS-1, and ANS-4, as well as genes related to the anthocyanin metabolism pathway, were significantly downregulated. This further indicates that StMYB200 and StMYB210 are involved in the regulation of anthocyanin synthesis in potato flesh.
[0072] Example 3: Discovery of a 1.7kb Indel in the StMYB210 gene promoter
[0073] To further elucidate the specific regulatory mechanisms of StMYB200 and StMYB210, this application amplified the gene sequences of both genes from red-skinned, red-fleshed diploid potato material 01-58. The promoter sequence of the StMYB210 gene showed significant differences between the two haplotypes, with a 1757 bp (1.7 kb) insertion / deletion located 34 bp upstream of the start codon ATG. Figure 7 As shown. The specific 1757bp (1.7kb) insertion sequence is shown in SEQ ID NO.1.
[0074] Example 4: Development and validation of molecular markers for the 1.7kb Indel of the StMYB210 gene promoter region
[0075] Based on the differences in the StMYB210 gene promoter region between the two haplotypes 01-58, a pair of codominant marker primers were designed by selecting conserved regions flanking the 1.7kb Indel. The primer positions are as follows: Figure 7 As shown, the primer sequences are as follows:
[0076]
[0077] The specific genotyping methods are as follows:
[0078] (1) Extract genomic DNA from the lines to be tested;
[0079] (2) Using the DNA extracted in step (1) as a template, the codominant molecular marker (StMYB210pro-Indel-F / -R) and PCR amplification was performed using GXL DNA Polymerase (Takara, R050Q), and the specific reaction system is as follows:
[0080]
[0081]
[0082] The reaction procedure is as follows:
[0083]
[0084] (3) Electrophoresis was performed using 1% agarose gel. Homozygous lines with 1.7kb insertion showed a 2328bp band, homozygous lines without 1.7kb insertion showed a 570bp band, and heterozygous lines showed both 2328bp and 570bp bands.
[0085] The diploid potato material 01-58, with red skin and red flesh, contains the S-locus inhibitor (Sli) gene and can self-pollinate to produce a segregating F2 population. Within the F2 population, the flesh color segregates, with some lines having white skin and white flesh, and others having red skin and red flesh. Figure 8 a and Figure 8 As shown in b. Further genotyping was performed on the white-skinned, white-fleshed lines and red-skinned, red-fleshed lines in the 01-58_F2 population using the developed co-dominant molecular marker (StMYB210pro-Indel-F / -R) according to the above system. It was found that the StMYB210 promoter region of the white-skinned, white-fleshed lines did not contain a 1.7kb insertion, while the red-skinned, red-fleshed lines all contained a 1.7kb insertion. Some of these lines showed homozygous insertions, such as... Figure 8 c and Figure 8 As shown in d, the codominant molecular markers (StMYB210pro-Indel-F / -R) are a pair of efficient and stable markers that can accurately identify the homozygous or heterozygous genotypes of the 1.7kb Indel in the StMYB210 promoter; at the same time, it was found that the 1.7kb insertion in the 01-58_F2 population is essential for anthocyanin accumulation in potato flesh.
[0086] Example 5: StMYB200 and StMYB210 activate StMYB210 by binding a 1.7kb insert fragment in the StMYB210 promoter.
[0087] To further clarify whether the 1.7kb insertion in the StMYB210 promoter affects gene expression, this application used the aforementioned codominant molecular marker (StMYB210pro-Indel-F / -R) to identify homozygous pf / pf lines without the 1.7kb insertion and homozygous Pf / Pf lines with the 1.7kb insertion from the 01-58_F2 population. RNA was extracted from the potato flesh of these lines for RT-qPCR analysis. Figure 9As shown, the StMYB200 gene was expressed in both pf / pf and Pf / Pf lines, but its expression level was higher in the Pf / Pf line compared to the pf / pf line. The StMYB210 and StDFR genes were expressed normally in the Pf / Pf line, but almost not at all in the pf / pf line. This indicates that the 1.7kb insertion in the StMYB210 promoter may lead to high expression of the StMYB210 gene in potato flesh, thereby activating the expression of the anthocyanin synthesis structural gene StDFR and accumulating anthocyanins in the potato flesh.
[0088] This application analyzed the 1.7kb insertion sequence in the StMYB210 promoter and found that the sequence contains 10 repeat segments, each approximately 100bp in length and containing one MYB binding site (MBS2, ACCAA / ATCAAA). Simultaneously, this application identified four other different types of MYB binding sites (MBS1, CAACGG) in the 1.7kb insertion sequence. Figure 10 and Figure 11 As shown in the figure. Therefore, it is speculated that StMYB200 and StMYB210 may activate the expression of StMYB210 by binding to these MBSs elements.
[0089] To demonstrate this hypothesis, this application amplified the promoter of the StMYB210 gene from the pf / pf and Pf / Pf lines of the 01-58_F2 population, respectively, and recombined it with the pGreenII0800-LUC vector as a reporter gene vector. Simultaneously, the coding regions of the StMYB200 and StMYB210 genes were amplified from the potato flesh of the Pf / Pf line of the 01-58_F2 population, respectively, and overexpression vectors were constructed as effectors. These vectors were transformed into Agrobacterium GV3101, and transiently co-transformed into Nicotiana benthamiana for Dual-LUC experiments. The results showed that the Pf-StMYB210 promoter containing the 1.7kb insertion could be activated by either StMYB200 or StMYB210, but neither could activate the pf-StMYB210 promoter without the 1.7kb insertion. Figure 12 a and Figure 12 As shown in b. The promoter sequence of the StMYB210 gene in the Pf / Pf strain is shown in SEQ ID NO:6. The coding region sequence of StMYB200 is shown in SEQ ID NO:7, and its amino acid sequence is shown in SEQ ID NO:2. The coding region sequence of the StMYB210 gene is shown in SEQ ID NO:8, and its amino acid sequence is shown in SEQ ID NO:3.
[0090] This application amplifies sequences containing MBS1 and MBS2 elements from a 1.7kb insert fragment and recombines them with the pAbAi vector; simultaneously, the coding regions of the StMYB200 and StMYB210 genes are constructed into the pGADT7 vector for yeast one-hybrid assays. The results show that both StMYB200 and StMYB210 can bind to the 1.7kb insert sequence in the StMYB210 promoter, such as... Figure 12 c and Figure 12 As shown in d. Furthermore, this application synthesized probes based on the sequences of MBS1 and MBS2 elements, respectively, and simultaneously recombined the coding regions of the StMYB200 and StMYB210 genes into the prokaryotic expression vector pET-30a(+), inducing the expression of these two proteins for EMSA assays. The results showed that StMYB200 can bind to the MBS1 element, and StMYB210 can bind to both MBS1 and MBS2 elements, as shown in d. Figure 12 As shown in the figure above, the preliminary results confirm that StMYB200 and StMYB210 activate the expression of StMYB210 by binding to a 1.7kb insert in the StMYB210 promoter, thereby significantly increasing the accumulation of anthocyanins in potato flesh and thus obtaining red-fleshed potatoes.
[0091] Example 6: Association analysis of flesh color of 24 diploid potato germplasms with the 1.7kb insertion fragment of the StMYB210 gene.
[0092] This application selected 24 diploid potato materials, including 4 wild varieties with white skin and white flesh, 11 local varieties with yellow or white flesh, and 9 local varieties with purple or red flesh. Figure 13 As shown in Figure a. Using the co-dominant molecular marker (StMYB210pro-Indel-F / -R) developed above, the StMYB210 promoter of these 24 materials was amplified according to the above system. It was found that the StMYB210 promoters of 4 wild-type species did not contain a 1.7 kb insert; among the 11 local varieties with yellow or white flesh, 5 materials contained a 1.7 kb insert, and 6 materials did not contain a 1.7 kb insert; all 9 local varieties with purple or red flesh contained a 1.7 kb insert, of which 2 materials had a homozygous 1.7 kb insert, as shown in Figure a. Figure 13 As shown in b. Furthermore, semi-quantitative RNA was extracted from the potato flesh of these 24 materials, and it was found that StMYB210 was expressed in all materials containing the 1.7kb insert fragment, as shown in b. Figure 13As shown in c. Therefore, it is believed that the 1.7kb insertion in the StMYB210 promoter is associated with the expression of this gene and the accumulation of anthocyanins in potato flesh, and potatoes with anthocyanin accumulation in the flesh must have this insertion fragment. Potatoes containing the 1.7kb insertion fragment but with white or yellow flesh may be due to the loss of expression of StMYB200 or other anthocyanin synthesis pathway genes.
[0093] Example 7: Identification and analysis of a 1.7kb insert fragment in the StMYB210 gene promoter in diploid potato germplasm.
[0094] This application utilizes the aforementioned codominant molecular marker (StMYB210pro-Indel-F / -R) to perform genotyping on 354 diploid potato materials (100 wild materials with colorless flesh, 211 local varieties with no anthocyanin accumulation, and 43 local varieties with anthocyanin accumulation) according to the above-described system. The results showed that the StMYB210 promoters of the wild materials did not contain a 1.7 kb insert; while in the local varieties with no anthocyanin accumulation, more than half of the StMYB210 promoters contained a 1.7 kb insert; and the StMYB210 promoters of the 43 local varieties with anthocyanin accumulation all contained a 1.7 kb insert. Figure 14 As shown. These results further demonstrate from the perspective of natural populations that the presence of the 1.7kb insert in the StMYB210 promoter is associated with anthocyanin accumulation in potato flesh. Potatoes with anthocyanin accumulation in the flesh must contain this insert, which can serve as a reference for breeding anthocyanin-rich potato germplasm. Similarly, local varieties containing the 1.7kb insert but without anthocyanin accumulation in the flesh may be due to the loss of expression of StMYB200 or other anthocyanin synthesis pathway genes.
[0095] It should be noted that the specific parameters or reagents in the above embodiments are specific or preferred embodiments under the concept of this application, and not limitations thereof; those skilled in the art can make adaptive adjustments within the concept and protection scope of this application.
Claims
1. A nucleic acid molecule, characterized in that, The nucleic acid sequence of the nucleic acid molecule is shown in SEQ ID NO:
1.
2. The application of the nucleic acid molecule described in claim 1 in assisting in the determination of anthocyanin accumulation in potato varieties, characterized in that, The potato variety that accumulates anthocyanins in its flesh contains the nucleic acid molecule described in claim 1.
3. A primer pair, characterized in that, The sequences of the primer pairs are shown in SEQ ID NO:4 and SEQ ID NO:
5.
4. The use of the primer pair according to claim 3 in at least one of the following: (1) Screening or identifying the genotype of potatoes based on the nucleic acid molecules described in claim 1; (2) Screening or identifying potato materials that contain or do not contain the nucleic acid molecules described in claim 1.
5. A reagent kit, characterized in that, The kit contains reagents for detecting the nucleic acid molecule of claim 1, wherein the reagents include the primer pair of claim 3.
6. A method for assisting in the screening of potato plants with anthocyanin accumulation in the flesh, characterized in that, The method includes: identifying whether the genome of the potato plant contains the nucleic acid molecule of claim 1; and that the potato variety with anthocyanin accumulation in the flesh contains the nucleic acid molecule of claim 1.
7. A method for producing potatoes with flesh rich in anthocyanins, characterized in that, The method includes: The StMYB200 and StMYB210 proteins are expressed in recipient potato plants, wherein the amino acid sequence of the StMYB200 protein is shown in SEQ ID NO:2 and the amino acid sequence of the StMYB210 protein is shown in SEQ ID NO:3; the promoter region expressing the StMYB210 protein contains the nucleic acid molecule described in claim 1. The recipient potato is a potato lacking the expression of StMYB200 and / or StMYB210 proteins and whose flesh is not rich in anthocyanins.
8. A method for producing potatoes with anthocyanin-free flesh, characterized in that, The method includes: Expression of StMYB200 and / or StMYB210 proteins in anthocyanin-rich recipient potato plants with silent flesh, wherein the amino acid sequence of the StMYB200 protein is shown in SEQ ID NO:2 and the amino acid sequence of the StMYB210 protein is shown in SEQ ID NO:3.
Citation Information
Patent Citations
Application of potato StMYB117 gene in anthocyanin synthesis regulation
CN115725645A
Screening and application of MYB transcription factor capable of responding to low-temperature regulation and control of color potato anthocyanin synthesis
CN118127032A