Application of gene GmLBMPs in regulation and control of soybean branching development function and method for editing and constructing high-yield soybean variety

Abstract

The invention relates to an application of a gene GmLBMPs in regulation and control of a soybean branching development function, in particular to an application of the gene GmLBMPs in improvement of soybean yield, the gene GmLBMPs comprises a gene GmLBMPa and / or a gene GmLBMPb, and the gene GmLBMPs comprises a gene GmLBMPa and / or a gene GmLBMPb. The sequence of the GmLBMPa gene is as shown in SEQ ID NO. 1, and the sequence of the GmLBMPb gene is as shown in SEQ ID NO. 2. The invention further provides a target for knocking out the gene, a Gmlbps mutant is constructed, and the target gene of GmLBMPs can be effectively knocked out by utilizing the target provided by the invention. The research finds that compared with a wild type, the Gmlbps mutant has a longer branch, and the total pod number of a single plant is greater than that of the wild type. In addition, the experimental result also shows that the knockout of the GmLBMPs can promote the development of lateral root branches, and is more beneficial to the absorption of soybean soil moisture and nutritional ingredients. Therefore, the GmLBMPs gene has good application prospect and application value in the aspect of creating high-yield soybeans and soybeans with excellent plant types.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and more specifically, relates to the application of the gene GmLBMPs in regulating the soybean branch development function and a method for editing and constructing high-yield soybean varieties. Background Art

[0002] Soybean is a crop whose seeds are rich in plant protein, with a protein content of up to 35%-40%, which is 2.5-8 times higher than that of cereals and potato foods. Except for the lower sugar content, other nutrients, such as fat, calcium, phosphorus, iron, and vitamin B1, vitamin B2 and other essential nutrients for the human body, are higher than those of cereals and potato foods. It also contains soy oligosaccharides, isoflavones, saponins, nucleic acids and other health factors that are extremely precious to human health. Soybean is an ideal high-quality plant protein food with wide application value in food, feed, industry and other aspects.

[0003] my country is a major importer and consumer of soybeans. The current annual demand has reached 113 million tons, while domestic soybeans only account for about 15% of the total soybean consumption, which is a drop in the bucket compared to the huge domestic demand. As the country of origin of soybeans, my country is rich in soybean germplasm resources, but the current soybean varieties have the problem of low yield. The yield level of my country's soybean varieties is far behind the international advanced level.

[0004] Soybean plant type is one of the important factors affecting yield. Breeders have proposed that cultivating varieties with ideal plant types can help increase soybean yield per unit area. The number of soybean branches, number of branch nodes, number of branch pods, and branch length are important traits affecting soybean plant type. Internationally, the technology of soybean genetic breeding is very advanced. Therefore, it is of great significance to find soybean genes related to plant type development and cultivate high-yield soybean varieties through genetic breeding. Summary of the invention

[0005] The present invention aims to overcome the insufficiency of existing gene resources for regulating soybean branch development, and provides the application of GmLBMPs gene in regulating soybean branch development and improving soybean yield.

[0006] The first object of the present invention is to provide application of GmLBMPs gene.

[0007] The second object of the present invention is to provide a target for knocking out the soybean GmLBMPs gene.

[0008] The third object of the present invention is to provide a method for breeding high-yield soybean varieties.

[0009] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0010] The present invention has found that the target provided by the present invention can effectively knock out the GmLBMPs target gene, wherein the number of branches, the number of branch pods, the total number of branch nodes, and the number of nodes of a single branch of the Gmlbmps mutant are significantly greater than those of the wild type. In addition, the lateral roots of the Gmlbmps mutant plants are more developed. Therefore, the present invention provides the following application schemes:

[0011] Application of GmLBMPs gene in improving soybean yield, wherein the GmLBMPs gene includes GmLBMPa gene and / or GmLBMPb gene; the sequence of GmLBMPa gene is shown in SEQ ID NO.1, and the sequence of GmLBMPb gene is shown in SEQ ID NO.2.

[0012] The application of the above-mentioned GmLBMPs gene in regulating soybean branch development includes any one or more of increasing soybean branch length, increasing soybean branch node number, and increasing soybean branch pod number.

[0013] Application of the above-mentioned GmLBMPs genes in promoting soybean lateral root development.

[0014] The above-mentioned GmLBMPs genes are used as targets in constructing soybean lines with improved yield.

[0015] The above-mentioned GmLBMPs gene is used as a target in constructing soybean strains with increased branch length and node number.

[0016] The above-mentioned GmLBMPs gene is used as a target in constructing a soybean line with increased number of soybean branches and pods.

[0017] The above-mentioned GmLBMPs genes are used as targets in constructing soybean lines with well-developed lateral roots.

[0018] The above-mentioned GmLBMPs gene is used as a target in regulating soybean development, and the regulation of soybean development includes any one or more of increasing soybean branch length, increasing soybean branch node number, increasing soybean branch pod number, and promoting soybean lateral root development.

[0019] The use of the above-mentioned GmLBMPs gene or its protein inhibitor in constructing soybean strains with increased yield and / or branch length and node number.

[0020] Application of the above-mentioned GmLBMPs gene or its protein inhibitor in constructing soybean strains with increased number of soybean branches and pods.

[0021] The application of the above-mentioned GmLBMPs gene or its protein inhibitor in constructing soybean strains with well-developed lateral roots.

[0022] The use of the above-mentioned GmLBMPs gene expression inhibitor in constructing soybean strains with increased yield and / or branch length and node number.

[0023] The application of the above-mentioned GmLBMPs gene expression inhibitor in constructing a soybean strain with increased soybean branch pod number.

[0024] Specifically, the expression inhibitors include gene silencing, knockdown, and knockout agents.

[0025] The present invention provides a target for targeted knockout of soybean GmLBMPs gene, wherein the target comprises target T1 and / or target T2, the sequence of target T1 is shown as SEQ ID NO.3, and the sequence of target T2 is shown as SEQ ID NO.4.

[0026] The present invention also provides a method for constructing a high-yield soybean variety, characterized in that the GmLBMPs gene of soybean is silenced, knocked down or knocked out; the GmLBMPs gene includes GmLBMPa and / or GmLBMPb; the sequence of the GmLBMPa gene is shown in SEQ ID NO.1, and the sequence of the GmLBMPb gene is shown in SEQ ID NO.2.

[0027] As an optional implementation scheme, the method for breeding high-yield soybean varieties utilizes CRISPR / Cas9 technology to knock out the GmLBMPs gene at the above-mentioned target site.

[0028] The present invention has the following beneficial effects:

[0029] By utilizing the target provided by the present invention, the GmLBMPs target gene can be effectively knocked out to create different allele mutation types. The present invention has found that compared with wild-type soybeans, the Gmlbmps mutant has longer branches and the total number of pods per plant is more than that of the wild type. The increase in the total number of pods of the Gmlbmps mutant is mainly due to the increase in the number of nodes on the branches, which leads to an increase in the number of pods per plant. In addition, the experimental results also show that knocking out GmLBMPs can promote the development of lateral root branches, which is more conducive to the absorption of moisture and nutrients in soybean soil. Therefore, the GmLBMPs gene has a good application prospect and application value in creating high-yield soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The target information and protein domain of GmLBMPs (Figure A shows the two target sequences shared by GmLBMPs homologous genes; Figure B shows the GmLBMPs gene structure and the location of the target on the gene; Figure C shows the conserved domain of GmLBMPs protein, RPE: Retinal pigment epithelial membrane protein).

[0031] Figure 2 The results of screening transgenic soybeans using the transgenic pat / bar test strips (#1, #2, #3, #4, #5, and #6 are different plant numbers).

[0032] Figure 3 The results of editing detection of the GmLBMPa gene (Figure A shows the sequence information of the GmLBMPa wild type and lbmpa-1 mutant between target 1 and target 2; Figure B shows the lbmpa-1 mutant type and the sequencing chromatogram near the two targets; Figure C shows the sequence information of the lbmpa-2 mutant; Figure D shows the sequencing chromatogram near the two targets of the lbmpa-2 mutant; Figure E shows the comparison of the amino acid sequences of the wild type and the two allelic variants before target 2).

[0033] Figure 4 The results of the editing status detection of the GmLBMPb gene (Figure A shows the sequence information of the GmLBMPb wild type and lbmpb mutant near target 1 and target 2; Figure B shows the lbmpb mutation type and the sequencing chromatogram near the two target sites; Figure C shows the amino acid sequence comparison results of the wild type and lbmpb allele before the target 2 site).

[0034] Figure 5 This is the electrophoresis diagram for Gmlbmpa-2 allelic variation detection (M: 2K DNA marker, A: GmLBMPa type, B: Gmlbmpa-2 type, H: heterozygous type).

[0035] Figure 6 Figure 2 is a phenotype diagram of the Gmlbmps mutant plants (Figure A is a phenotype diagram of the wild-type W82 and lbmpa-1 / 1bmpb mutant strains planted under short-day incubator conditions; Figure B is a comparison of the growth status of the wild-type and mutant plants 23 days after emergence).

[0036] Figure 7 The statistical results of yield-related traits of Gmlbmps mutant plants during the vegetative growth period (the related traits are plant height, number of main stem nodes, average node length, number of branches, number of nodes per branch, branch length, and total number of nodes per plant).

[0037] Figure 8 These are the statistical results of yield-related traits of Gmlbmps mutant plants at maturity (the related traits are number of main stem pods, number of main stem nodes, plant height, number of branches, total number of branch nodes, number of branch pods, number of nodes per branch, and branch length).

[0038] Fig. 9 Comparison results of lateral roots of wild-type plants and Gmlbmps mutant plants at the seedling stage. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0040] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0041] The Williams 82 soybean variety used for transgenic in the following examples was provided by the Molecular Genetics and Evolution Innovation Research Center of Guangzhou University.

[0042] The transgenic pat / bar test strips in the following examples were purchased from Boyuan Company with a product number of #RIA03.

[0043] The Taq enzyme used for PCR amplification was purchased from Kangwei Company.

[0044] The sgRNA vector and CRISPR / Cas9 vector (pGES401) were provided by the research group of Professor Guan Yuefeng of Guangzhou University. The pGES401 vector has been published in the document "Bai M, Yuan C, Kuang H, Sun Q, Hu X, Cui L, Lin W, Peng C, Yue P, Song S, Guo Z, Guan Y. Combination of two multiplex genome-edited soybean varieties enables customization of protein functional properties. Mol Plant. 2022.15(7):1081-1083."

[0045] The DNA extraction kit was purchased from Kangwei Century Company with the product number CW0531S.

[0046] Escherichia coli strain DH5α and Agrobacterium tumefaciens strain EHA101 were purchased from Kangti Life (catalog number: KTSM101L) and Shanghai Weidi Biotechnology Co., Ltd. (catalog number: AC1040M), respectively.

[0047] BsaⅠ restriction endonuclease and T4 ligase were purchased from TaKaRa, Inc. High-fidelity enzyme 2×Phanta FlashMaster Mix (Dye Plus)-P520 was purchased from Novazonics.

[0048] The PCR product recovery kit and plasmid extraction kit were purchased from Quanshijin Company with catalog numbers EG101-01 and EM101-02, respectively.

[0049] Other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50 μg / mL), and rifampicin (Rif, 100 μg / mL) were all domestic analytical grade reagents.

[0050] Primer synthesis and sequencing were performed by Qingke Biotechnology Co., Ltd.

[0051] Example 1 Soybean GmLBMPs Gene

[0052] GmLBMPs genes include GmLBMPa gene and GmLBMPb gene. GmLBMPa gene phytozome gene number: Glyma.04G084100, GmLBMPb gene phytozome gene number: Glyma.06G085800.

[0053] The sequence of the GmLBMPa gene is shown in SEQ ID NO.1.

[0054] SEQ ID NO.1:

[0055]

[0056] The sequence of the GmLBMPb gene is shown in SEQ ID NO.2.

[0057] SEQ ID NO.2:

[0058]

[0059] Example 2 CRISPR / Cas9 vector design and construction

[0060] The pLYCRISPR / Cas9 (pGES401) expression vector was selected as the backbone for gene editing, and a Cas9 sgRNA expression vector with the editing site sequence of the soybean GmLBMPs gene exon was constructed.

[0061] 1. Obtain the SgRNA expression cassette

[0062] Target information and protein domains of GmLBMPs Figure 1 As shown in the figure, it can be seen from the conserved domain of the protein that both GmLBMPa and GmLBMPb homologous proteins contain the RPE65 domain and have carotenoid dioxygenase activity. According to the target T1 and target T2, two sgRNA tandem vector construction primers GmLBMPs-F1' and GmLBMPs-R1' were designed.

[0063] The target T1 sequence is: TGGACTTGCAACATTTGCCTTGG (SEQ ID NO. 3);

[0064] The target T2 sequence is: GAAGGAGAGTTACAAGTTCAAGG (SEQ ID NO. 4).

[0065] The sequence of GmLBMPs-F1'(5'-3') is:

[0066] TGGTCTCGTGCATGGACTTGCAACATTTGCCTGTTTTAGAGCTAGAAAT AGC (SEQ ID NO. 5).

[0067] The sequence of GmLBMPs-R1'(5'-3') is:

[0068] TGGTCTCGAAACTGAACTTGTAACTCTCCTTCTGCACCAGCCGGGAATCGAA (SEQ ID NO. 6).

[0069] Prepare the PCR amplification reaction system according to Table 1. After brief centrifugation, place the reaction on a PCR instrument for reaction. The PCR reaction program is: pre-denaturation at 98°C for 30s, denaturation at 98°C for 10s, annealing at 58°C for 5s, extension at 72°C for 5s, denaturation-annealing-extension for 35 cycles, and finally extension at 72°C for 1min. Cool down to 16°C for storage.

[0070] After the PCR amplification product was detected by agarose gel to contain the target fragment, the DNA fragment was recovered using a PCR product recovery kit (Beijing Quanshijin Biotechnology) according to the kit instructions. The specific steps were: add 50 μL GSB to the reaction system, centrifuge at 12000g / min for 1 min, discard the waste liquid, add 650 μL WB, centrifuge at 12000g / min for 1 min, discard the waste liquid and centrifuge, centrifuge at 12000g / min for 2 min, put the centrifuge column into a clean centrifuge tube, open the lid and let it stand for 5 min, add 30 μL 65°C H2O and centrifuge at 12000g / min for 2 min to obtain the DNA recovery product, that is, the SgRNA expression cassette.

[0071] Table 1 PCR amplification reaction system

[0072] pGES401 Vector (5ng / ul) 1μL GmLBMPs-F1' (10 μM) 1μL GmLBMPs-R1' (10 μM) 1μL 2X p520Mix 25μL <![CDATA[ddH2O]]> Make up to 50 μL

[0073] 2. Ligation of sgRNA expression cassette and pGES401 vector

[0074] The Golden Gate one-step method was used to construct the vector. The sgRNA expression cassette DNA fragment and the vector pGES401 were added to the reaction system at the same time. BsaI endonuclease and T4 ligase were added to allow the fragments to be cut and connected at the same time. The correctly connected fragments do not contain BsaI restriction sites and will not be cut again, while the incorrectly connected fragments can be cut by enzymes. Each round of enzyme cutting and connection will enrich the correctly connected fragments. The specific method is as follows:

[0075] The reaction system was prepared according to Table 2. After brief centrifugation, the reaction was placed on a PCR instrument for reaction. The reaction procedure was as follows: restriction digestion at 37°C for 5 min, connection at 16°C for 5 min, followed by 20 cycles, and then reaction at 37°C for 15 min, reaction at 85°C for 5 min, and storage at 4°C. The pGES401 vector with the sgRNA expression cassette connected was obtained.

[0076] Table 2 Reaction system

[0077] pGES401 Plasmid (≈200 ng / μL) 5μL T4 DNA Ligase Buffer (10X) 2μL T4 DNA Ligase 1μL BsaI-HFv2 2μL DNA recovery fragment 1 (≈100ng / μL) 1μL DNA recovery fragment 2 (≈100ng / μL) 1μL <![CDATA[ddH2O]]> 8μL

[0078] 3. Identification of pGES401 vector

[0079] The constructed pGES401 vector was transformed into the E. coli strain DH5α. Refer to the DH5α instruction manual for transformation. The specific steps are as follows:

[0080] Thaw the EP tube containing competent cells on ice for 5 minutes, then add the constructed pGES401 vector solution, gently flick to mix, and then place on ice for 30 minutes. After the ice bath, place the EP tube containing competent cells in a 42°C water bath for 1 minute, then immediately place on ice for 2 minutes. Add 500 μL of antibiotic-free LB liquid culture medium to the EP tube in a clean bench, incubate at 37°C shaker at 220 rpm for 1 hour, then centrifuge at 5000 rpm for 1 minute, pour out part of the supernatant, aspirate the resuspended bacterial solution, evenly spread it on the LB solid culture medium containing kanamycin, and place it in a 37°C incubator for overnight culture.

[0081] On the second day, bacterial monoclones were picked on LB solid medium containing kanamycin, colony PCR amplification was performed using screening primers, and monoclones containing the target fragment size (944 bp) were screened by electrophoresis. Monoclones containing the target fragment size (944 bp) were selected and sent to the company for sequencing. After confirming that the sequencing results were correct, the constructed pGES401 vector was obtained.

[0082] The sequences of the screening primers are (5'-3'):

[0083] TEST-F: TGCTACCCTCATCCATCAGTC (SEQ ID NO.7);

[0084] TEST-R: TGTTGTGTGGAATTGTGAGCG (SEQ ID NO. 8).

[0085] Example 3 Obtaining soybean transgenic plants and identifying mutant lines

[0086] 1. EHA101 Agrobacterium transformation

[0087] The pGES401 vector was extracted from the single clone verified to be correct by sequencing in Example 2 using a plasmid extraction kit. The pGES401 vector was transformed with EHA101 Agrobacterium tumefaciens, and the transformation was performed with reference to the EHA101 Agrobacterium tumefaciens instruction manual. The specific steps were as follows:

[0088] Take 5 μL of pGES401 vector and add it to the EP tube containing 50 μL of EHA101 competent cells, then put it in an ice bath for 30 minutes, put it in liquid nitrogen for 5 minutes, treat it at 37°C for 5 minutes, and then put it in an ice bath for 5 minutes. Then add 500 μL of non-resistant LB liquid culture medium to the PE tube and recover it at 28°C for 3-5 hours. The recovered bacterial solution is centrifuged at 4000 rpm for 30 seconds, and part of the supernatant is removed. The remaining 200 μL of bacterial solution is blown off the precipitated bacteria, and spread on the LB solid culture medium with kanamycin and rifampicin antibiotics, and placed in a 28°C incubator for 2 days.

[0089] Perform colony PCR on the single colonies on the plate to screen out the colonies with the target plasmid. Prepare the colony PCR reaction system according to Table 3 for PCR amplification. The PCR program is: 95℃ pre-denaturation for 2min; 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 90s, denaturation-annealing-extension for 35 cycles; 72℃ final extension for 2min.

[0090] The PCR amplification product was subjected to 1% agarose gel electrophoresis, and a gel imaging system was used to check whether a target band of about 944 bp appeared. The colonies with the target plasmid were picked, shaken and maintained.

[0091] Table 3 Colony PCR reaction system

[0092] Master Taq mix 5μL TEST-F 0.2μL TEST-R 0.2μL Bacterial liquid 1μL Sterile water 3.6μL

[0093] 2. Obtaining soybean transgenic lines

[0094] The bacterial solution containing the constructed pGES401 vector was sent to Weimi Biotechnology Co., Ltd. to complete the soybean transgenic process and obtain T0 generation transgenic plants. The soybean variety used was Williams 82.

[0095] 3. Screening of transgenic lines

[0096] Use the GMO pat / bar test strips to quickly screen GMO strains. Refer to the instructions for the pat / bar test strips for testing. The specific steps are as follows:

[0097] (1) Place the transgenic soybean leaf tissue between the lid and the body of a disposable 1.5 mL extraction tube, quickly close the lid, repeat twice to obtain two circular leaf tissues, place the leaf at the bottom of the extraction tube with a grinding rod, and mark the tube wall with a marker;

[0098] (2) Insert the grinding rod into the tube and rotate the grinding rod to grind and crush the leaves for 30 seconds;

[0099] (3) Add 0.2 mL (about 6 drops) of extract into the extraction tube;

[0100] (4) Take the test strip out of the reagent cartridge, insert it directly into the sample (MAX end), and start timing;

[0101] (5) Results are available in 5-10 minutes.

[0102] The results of the GMO pat / bar test strips for screening GMO soybeans are as follows Figure 2As shown, the transgenic plants contain the Bar resistance gene and can express the resistance protein to the herbicide glufosinate ammonium. The positive result of transgenic soybeans presents two bands on the test paper. The results show that plants #1, #3, #5 and #6 are transgenic positive plants, and plants #2 and #4 are transgenic negative plants, indicating that the T0 generation transgenic positive plants were successfully obtained in this example.

[0103] 4. Detection of gene editing in mutant strains

[0104] 1. GmLBMPs gene editing detection method

[0105] DNA was extracted from the transgenic plants using a DNA extraction kit according to the kit instructions. Three leaves were selected from each transgenic plant and mixed into one tube for DNA extraction.

[0106] Using the extracted DNA as a template, the target site detection primers GmLBMPa-F, GmLBMPa-R and GmLBMPb-F, GmLBMPb-R were used to amplify the fragments containing the target region by PCR. The size of the target fragment amplified by the GmLBMPa-F / R primers was 605 bp, and the size of the target fragment amplified by the GmLBMPb-F / R primers was 758 bp. The primer sequences for target detection are shown in Table 4.

[0107] PCR reaction system: 15 μL 2×Master Taq mix, 0.3 μL each of forward primer and reverse primer, 2 μL DNA template, and ddH2O to make up to 30 μL.

[0108] The PCR program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 95°C for 30 s, Tm annealing for 30 s, extension at 72°C for 30 sec, denaturation-annealing-extension for 35 cycles; and finally at 72°C for 5 min.

[0109] The amplified PCR products were sequenced, and the sequencing sequences were aligned using BioEdit software. The editing effects of the targets were analyzed in combination with the sequencing chromatograms.

[0110] Table 4 Primer sequences for target detection

[0111]

[0112]

[0113] 2. GmLBMPs gene editing test results

[0114] The results of the GmLBMPa gene editing test are as follows Figure 3 As shown in Figure 2, the editing status of the GmLBMPb gene was detected as follows: Figure 4As shown, the results show that the two targets designed by the present invention can effectively knock out two GmLBMPs homologous genes, and two double mutant strains were successfully obtained in the self-pollinated progeny, named lbmpa-1 / lbmpb and lbmpa-2 / lbmpb. The mutation types of the GmLBMPa gene of the two strains are different, and the mutation types of the GmLBMPb gene are the same.

[0115] The two mutation types of the GmLBMPa gene are lbmpa-1 and lbmpa-2. lbmpa-1 has a 10bp deletion at the first target site and a 2bp deletion at the second target site. lbmpa-2 has a 148bp large fragment deletion between the first and second targets. Both mutation types lead to premature termination of amino-terminal translation and loss of the important RPE65 knot domain.

[0116] The mutation type of the GmLBMPb gene is recorded as lbmpb. lbmpb has a 1bp insertion at the first target site and a 5bp deletion at the second target site. At the same time, there is a 12-base substitution immediately following the PAM region of the second target site. The allelic variation of lbmpb also leads to premature termination of amino-terminal translation and the loss of the conserved domain of RPE65.

[0117] For large deletion alleles of lbmpa-2, genotyping of offspring can be performed by 2% agarose gel analysis ( Figure 5 ).

[0118] Example 4 Phenotypic observation of GmLBMPs homozygous mutant

[0119] 1. Experimental Methods

[0120] The T0 generation edited plants were self-pollinated to obtain offspring seeds with separated genotypes, and homozygous mutant strains were detected and numbered as lbmpa-1 / lbmpb strain and lbmpa-2 / lbmpb strain.

[0121] The wild-type material Williams 82 and two strains of the Gmlbmps double mutant were planted together in a short-day (12 h light / 12 h dark) incubator with the temperature set at 25°C. The plant type-related traits were investigated and statistically analyzed at the vegetative growth stage and the mature stage. The related traits included plant height, number of main stem nodes, average node length, number of branches, number of nodes per branch, branch length, total number of nodes per plant, number of main stem pods, total number of branch nodes and number of branch pods.

[0122] 2. Experimental Results

[0123] The phenotype of Gmlbmps mutant is shown in Figure 2 Figure 6As shown in the figure, it can be seen that compared with the Gmlbmps mutant plants, the elongation of the axillary buds of the wild-type plants is shorter and obviously inhibited, indicating that the GmLBMPs gene inhibits the elongation growth of the axillary buds.

[0124] Soybean pods grow at the internodes. An increase in the number of internodes on a single plant often means an increase in the number of pods, which is beneficial to an increase in the yield of a single plant.

[0125] The statistical results of yield-related traits of Gmlbmps mutant plants during the vegetative growth period are as follows Figure 7 As shown, the results showed that during the vegetative growth period, the branch length of the Gmlbmps mutant was significantly longer than that of the wild type, and the number of nodes on the branches was also significantly higher than that of the wild type.

[0126] The statistical results of yield-related traits of Gmlbmps mutant plants at maturity are as follows Figure 8 The results showed that at maturity, the number of branches, branch pods, branch nodes and nodes per branch of the Gmlbmps mutant were significantly greater than those of the wild type. In addition, the length of branches of the Gmlbmps mutant was significantly longer than that of the wild type, and the development of long branches was more conducive to increasing the number of pods per plant in soybean.

[0127] Comparison of lateral roots between wild-type plants and Gmlbmps mutant plants at the seedling stage Fig. 9 The results showed that compared with wild-type plants, the lateral roots of Gmlbmps mutant plants were more developed and longer, and the number of branches on the lateral roots was also more and the branches were longer, indicating that knocking out GmLBMPs can promote the development of lateral root branches and is more conducive to the absorption of soil water and nutrients in soybeans.

[0128] The above experimental results prove that the GmLBMPs mutant has the characteristics of high-yield soybeans, and will provide genetic materials for further analyzing the mechanism of soybean branch development and exploring downstream genes related to regulating soybean plant type.

[0129] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. The application of GmLBMPs gene in increasing soybean yield is characterized in that: The GmLBMPs gene includes the GmLBMPa gene and / or the GmLBMPb gene; the sequence of the GmLBMPa gene is shown in SEQ ID NO.1, and the sequence of the GmLBMPb gene is shown in SEQ ID NO.

2.

2. The use of the GmLBMPs gene in claim 1 in regulating soybean branch development, characterized in that: The regulating soybean branch development includes any one or more of increasing the length of soybean branches, increasing the number of soybean branch nodes, and increasing the number of soybean branch pods.

3. Use of the GmLBMPs gene of claim 1 in promoting the development of soybean lateral roots.

4. Use of the GmLBMPs gene described in claim 1 as a target in constructing a soybean strain with improved yield, or in constructing a soybean strain with increased branch length and number of nodes, or in constructing a soybean strain with increased number of soybean branches and pods.

5. The use of the GmLBMPs gene as a target in regulating soybean development according to claim 1, characterized in that: The regulating soybean development includes any one or more of increasing soybean branch length, increasing soybean branch node number, increasing soybean branch pod number, and promoting soybean lateral root development.

6. Use of the GmLBMPs gene or its protein inhibitor according to claim 1 in constructing a soybean strain with improved yield and / or increased branch length and node number, or in constructing a soybean strain with increased number of soybean branches and pods.

7. Use of the expression inhibitor of the GmLBMPs gene according to claim 1 in constructing a soybean strain with increased yield and / or increased branch length and node number, characterized in that: The expression inhibitors include gene silencing, knockdown, and knockout agents.

8. A target site for knocking out soybean GmLBMPs gene, characterized in that: The targets include target T1 and / or target T2, the sequence of target T1 is shown as SEQ ID NO.3, and the sequence of target T2 is shown as SEQ ID NO.

4.

9. A method for constructing a high-yield soybean variety, characterized in that: Silencing, knocking down or knocking out the GmLBMPs gene of soybean; the GmLBMPs gene includes GmLBMPa and / or GmLBMPb; the sequence of the GmLBMPa gene is shown in SEQ ID NO.1, and the sequence of the GmLBMPb gene is shown in SEQ ID NO.

2.

10. The method according to claim 9, characterized in that: The GmLBMPs gene is knocked out at the target site described in claim 8 using CRISPR / Cas9 technology.

Images