Application of OsHIPP53 gene in regulation and control of cadmium tolerance of rice

Abstract

The invention provides application of an OsHIPP53 gene in regulation and control of cadmium tolerance of rice, and belongs to the technical field of gene engineering. According to the invention, a recombinant expression vector of OsHIPP53 gene mutation is constructed by virtue of a CRISPR / Cas9 technology, so that a homozygous rice strain of OsHIPP53 gene mutation is obtained; the root system of the obtained OsHIPP53 mutant homozygous strain is obviously shorter than that of a Nipponbare wild type plant under cadmium treatment, which indicates that the deletion of the OsHIPP53 gene makes the rice more sensitive to cadmium, and verifies that the OsHIPP53 gene plays a role in regulating and controlling the cadmium tolerance of the rice. In view of the function of the OsHIPP53 gene in regulating and controlling the cadmium tolerance of the rice, the gene can be considered to have potential application value in improving the cadmium tolerance of the rice, and meanwhile, the invention also lays a theoretical and application foundation for cultivating cadmium-tolerant rice varieties by utilizing the OsHIPP53 gene.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to application of the OsHIPP53 gene in regulating cadmium tolerance in rice. Background Art

[0002] Cadmium is widely present in the soil. It is a heavy metal with high biological toxicity and strong mobility. It not only has obvious toxic effects on plants, but also accumulates through the food chain, causing harm to human health.

[0003] In plants, metal homeostasis can also be regulated by a specialized class of metal-binding proteins called metallochaperones. Heavy metal-associated isoprenylation plant proteins (HIPPs) are a large family of metalloproteins. These proteins possess an HMA domain and a C-terminal isoprenylation motif, enabling them to bind to free metal ions within the plant and transport them. The HIPP family plays a significant role in regulating cadmium tolerance in rice.

[0004] However, there are currently no reports on the OsHIPP53 gene regulating cadmium tolerance in rice. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of the OsHIPP53 gene in regulating cadmium tolerance in rice, which has potential application value in constructing a cadmium-sensitive rice model.

[0006] The present invention provides an application of the OsHIPP53 gene in regulating cadmium tolerance in rice; the amino acid sequence encoded by the OsHIPP53 gene is shown in SEQ ID NO.1.

[0007] Preferably, the nucleotide sequence of the CDS sequence of the OsHIPP53 gene is shown as SEQ ID NO.2.

[0008] Preferably, the regulating cadmium tolerance of rice comprises knocking out or knocking down the OsHIPP53 gene to increase the cadmium sensitivity of rice.

[0009] The present invention also provides an sgRNA targeting the OsHIPP53 gene, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.3.

[0010] Preferably, the sgRNA includes sgRNA-S having a nucleotide sequence as shown in SEQ ID NO.4 and sgRNA-A having a nucleotide sequence as shown in SEQ ID NO.5.

[0011] The present invention also provides a recombinant vector for knocking out the OsHIPP53 gene, wherein the recombinant vector comprises the sgRNA described in the above scheme.

[0012] The present invention also provides a method for constructing a cadmium-sensitive rice model, comprising the following steps:

[0013] Using CRISPR / Cas9 gene editing technology, the recombinant vector described in the above scheme was transferred into the recipient rice to knock out the OsHIPP53 gene.

[0014] The present invention also provides OsHIPP53 gene mutants associated with rice cadmium tolerance, including an OsHIPP53-1 mutant and an OsHIPP53-5 mutant; the OsHIPP53-1 mutant is characterized by a C base deletion at the 319bp position of the OsHIPP53 gene fragment as shown in the nucleotide sequence of SEQ ID NO.2; the OsHIPP53-5 mutant is characterized by a G base mutation to a T base at the 318bp position of the OsHIPP53 gene fragment as shown in the nucleotide sequence of SEQ ID NO.2, and a C base deletion at the 319bp position.

[0015] The present invention also provides the use of the OsHIPP53 gene mutant described in the above scheme in regulating cadmium tolerance in rice.

[0016] The present invention also provides a primer set for identifying the OsHIPP53 gene mutant described in the above scheme, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.6 and a downstream primer as shown in SEQ ID NO.7.

[0017] The present invention provides the use of the OsHIPP53 gene in regulating cadmium tolerance in rice; the amino acid sequence encoded by the OsHIPP53 gene is shown in SEQ ID NO. 1. The present invention constructs a recombinant expression vector for a mutant OsHIPP53 gene using CRISPR / Cas9 technology, thereby obtaining a homozygous rice strain carrying the OsHIPP53 gene mutation. The obtained homozygous OsHIPP53 mutant strain exhibits significantly shorter roots than wild-type Nipponbare plants under cadmium treatment, indicating that the loss of the OsHIPP53 gene renders rice more sensitive to cadmium and confirming the role of the OsHIPP53 gene in regulating cadmium tolerance in rice. Given the role of the OsHIPP53 gene in regulating cadmium tolerance in rice, it is believed that the gene has potential application value in improving cadmium tolerance in rice. The present invention also lays a theoretical and practical foundation for breeding cadmium-tolerant rice varieties using the OsHIPP53 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 This is the identification result of mutant plants of OsHIPP53 gene obtained by CRISPR / Cas9 technology;

[0020] Figure 2 This is the phylogenetic tree analysis result of OsHIPP53 gene;

[0021] Figure 3 The phenotype diagram of wild-type Nipponbare (nip), oshipp53-1, and oshipp53-5 under cadmium treatment provided in the embodiments of the present invention;

[0022] Figure 4 This is a graph showing the plant height and root length data of wild-type Nipponbare (nip), oshipp53-1, and oshipp53-5 under cadmium treatment provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0023] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention pertains. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. Reagents not specifically described herein are conventional reagents and are commercially available; methods not specifically described herein are conventional experimental methods and are known in the art.

[0024] The present invention provides an application of the OsHIPP53 gene in regulating cadmium tolerance in rice; the amino acid sequence encoded by the OsHIPP53 gene is shown in SEQ ID NO.1, specifically:

[0025] MASADAVSPAPATSAAAQQQLRTVVLRVSIHCLGCKKKVRKVLRSIEGVKDVKVDAAMHKVTVTGTVDGDTLVKRLYKSGKQAVPWQHPHVAPAPEAVKAIEAPQQPEAAPAGDDDGGKGSDAAAAAAKEAAAQAESSEEKKTEEKPEAEKEAEKKEEQEAKPSEAKPSDEAKKDAGGESEAPEAKAKGDDVGAEPAKEAVPAAAVKEASNDDEGAKDEKSKPKDAGDAAPPAAATTTERSLHFSPTPAAHKQHEEHYPYPYYGAPQPVMSYHMAQPTTSVSYYAPRPEAPAYSMQQHPPPPAYSAPPPQQQQYPPPSSPSPQPQQMQQQWSPSYLYMPYPHSSPDTYYRDYYSPPGTAHAPPLQDEYRMFDDENPNACSVM.

[0026]

[0027] The present invention also provides an sgRNA targeting the OsHIPP53 gene, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 3, specifically: 5'-CAGCAGCCTGAGGCTGCGCC-3'.

[0028] In the specific implementation process of the present invention, the sgRNA includes sgRNA-S and sgRNA-A. The nucleotide sequence of the sgRNA-S is shown in SEQ ID NO.4, specifically: 5'-ggcaCAGCAGCCTGAGGCTGCGCC-3'; the nucleotide sequence of the sgRNA-A is shown in SEQ ID NO.5, specifically: 5'-aaacGGCGCAGCCTCAGGCTGCTG-3'.

[0029] The present invention also provides a recombinant vector for knocking out the OsHIPP53 gene, comprising the sgRNA described in the above scheme. In specific implementations of the present invention, the base vector of the recombinant vector comprises SK-gRNA and pC1300-Cas9. Both pC1300-Cas9 and SK-gRNA are deposited at the Hangzhou Rice Research Institute in China and are disclosed in the article "Upgrading the genome of an elitejaponica rice variety Kongyu 131 for lodging resistance improvement," available at https: / / onlinelibrary.wiley.com / doi / 10.1111 / pbi.1396.

[0030] The present invention also provides a method for constructing a cadmium-sensitive rice model, comprising the following steps: using CRISPR / Cas9 gene editing technology to transfer the recombinant vector described in the above scheme into the recipient rice to knock out the OsHIPP53 gene.

[0031] The present invention also provides OsHIPP53 gene mutants related to rice cadmium tolerance, wherein the OsHIPP53 gene mutants include OsHIPP53-1 mutant and OsHIPP53-5 mutant;

[0032] The OsHIPP53-1 mutant has a C base deletion at position 319 bp of the OsHIPP53 gene fragment as shown in the nucleotide sequence of SEQ ID NO. 2;

[0033] The OsHIPP53-5 mutant is a mutant in which the G base is mutated to a T base at the 318 bp position of the OsHIPP53 gene fragment as shown in the nucleotide sequence of SEQ ID NO. 2, and the C base is deleted at the 319 bp position.

[0034] The present invention also provides the use of the OsHIPP53 gene mutant described in the above scheme in regulating cadmium tolerance in rice.

[0035] The present invention also provides a primer set for identifying the OsHIPP53 gene mutant described in the above scheme, characterized in that it includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.6 and a downstream primer as shown in SEQ ID NO.7.

[0036] To further illustrate the present invention, the application of the OsHIPP53 gene provided by the present invention in regulating cadmium tolerance in rice is described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1

[0038] Sequence analysis of the OsHIPP53 gene

[0039] To obtain the full-length CDS coding sequence of the OsHIPP53 gene, total RNA from the wild-type rice variety Nipponbare was extracted and reverse-transcribed into cDNA. Using Nipponbare's total cDNA as a template, the CDS sequence of the OsHIPP53 gene was amplified using the following primers. Sequencing and analysis of the PCR product revealed the CDS coding sequence of the OsHIPP53 gene, as shown in SEQ ID NO. 1.

[0040] The amplification primer sequences are as follows:

[0041] Upstream primer: 5′-ATGGCGTCTGCGGATGCG-3′ (SEQ ID NO. 8);

[0042] Downstream primer: 5'-TCACATGACGCTGCAGGCGT-3' (SEQ ID NO. 9);

[0043] The PCR amplification system is shown in Table 1.

[0044] Table 1 PCR amplification system for amplifying the CDS sequence of the OsHIPP53 gene

[0045]

[0046] The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 40 s, with 29 cycles; and complete extension at 68°C for 10 min.

[0047] Analysis of the coding region of the OsHIPP53 gene revealed that it contains three exons and two introns. The cDNA sequence of the OsHIPP53 gene consists of 1,137 nucleotides encoding a total of 378 amino acids.

[0048] Phylogenetic analysis of the OsHIPP53 gene was performed using TB tools software. The results showed that the OsHIPP53 gene belongs to the HIPP family and has an HMA domain ( Figure 2 ).

[0049] Example 2

[0050] Obtaining the OsHIPP53 gene mutant lines OsHIPP53-1 and OsHIPP53-5 and identifying the homozygous mutant lines

[0051] Based on the coding sequence of the OsHIPP53 gene and the target design principles of CRISPR / Cas9, the sgRNA sequences for the mutant materials were designed and constructed as follows:

[0052] sgRNA: 5'-CAGCAGCCTGAGGCTGCGCC-3' (SEQ ID NO. 3).

[0053] After mixing at a volume ratio of sgRNA-S:sgRNA-A:ddH2O=5:5:15, the mixture was placed in a 95°C metal bath for 3 minutes and cooled naturally at room temperature for 10 minutes to obtain an oligo dimer for use; the SK-gRNA was digested with AarI restriction endonuclease at 50°C in a water bath for 1 hour; after the digestion was completed, the gel was recovered.

[0054] The oligo dimer and SK-gRNA digestion product obtained above were enzymatically linked using T4 enzyme, wherein the volume ratio of SK-gRNA digestion product, oligo dimer, T4 enzyme and T4 Buffer was 1:7:1:1. After mixing, the mixture was allowed to stand at room temperature for 4 hours. DH5α competent cells were transformed and positive monoclonal screening was performed using ampicillin-resistant culture medium. Positive monoclonal clones were detected by colony PCR, and the successfully constructed intermediate recombinant vector was obtained after sequencing.

[0055] The intermediate recombinant vector obtained above was digested with KpnI and BglII restriction endonucleases at 50°C in a water bath for 1 hour; the pC1300-Cas9 vector was digested with KpnI and BamHI restriction endonucleases at 50°C in a water bath for 1 hour; the vectors were connected using T4 enzyme at a volume ratio of SK-gRNA intermediate recombinant vector digestion product: pC1300-Cas9 vector digestion product: T4 enzyme: T4 Buffer = 4:4:1:1. After mixing, the mixture was allowed to stand at room temperature for 4 hours to obtain the recombinant vector.

[0056] The constructed recombinant vector was transformed into DH5α competent cells, and positive single clones were screened using kanamycin-resistant culture medium to obtain a positive clone solution. The recombinant plasmid was then extracted from the resulting positive clone solution. Subsequent transgenic work was then commissioned to Wuhan Boyuan Biotechnology Co., Ltd.

[0057] The transgenic plants obtained were identified. DNA was extracted from the wild-type Nipponbare and the plant samples to be identified. PCR amplification was performed using the mutant identification primers described below, followed by first-generation sequencing. The obtained sequencing results were compared with the PCR amplification sequencing results of Nipponbare to determine whether the OsHIPP53 gene was successfully mutated.

[0058] The identification primer sequences are as follows:

[0059] OsHIPP53-F:TTTTATGTTTGGTTTCAGGC (SEQ ID NO. 6);

[0060] OsHIPP53-R: TCTTCTCGTCCTTTGCTC (SEQ ID NO. 7).

[0061] The PCR amplification system is shown in Table 2.

[0062] Table 2 Identification primer PCR amplification system

[0063] Reagents 20μL system 2×RapidTaqMasterMix 10 μL OsHIPP53-F 1 μL OsHIPP53-R 1 μL Sample DNA 1 μL <![CDATA[ddH2O]]> 7μL

[0064] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 15 s, repeated for 32 cycles; and complete extension at 72°C for 5 min.

[0065] Analysis of the sequencing results of the transgenic plants revealed two homozygous mutant lines, named OsHIPP53-1 and OsHIPP53-5. Sequencing results revealed that the OsHIPP53-1 mutant harbored a single-base deletion, namely a C deletion at position 319 of the OsHIPP53 gene coding sequence. The OsHIPP53-5 mutant harbored a single-base change and a single-base deletion, namely a G mutation to a T at position 318 of the OsHIPP53 gene coding sequence, and a C deletion at position 319.

[0066] The results of identification of mutation sites in OsHIPP53 gene transgenic plants are as follows Figure 1 shown.

[0067] Example 3

[0068] Verification of the tolerance of OsHIPP53 gene mutants to Cd treatment

[0069] To determine the regulatory role of the OsHIPP53 gene in cadmium tolerance in rice, wild-type Nipponbare, OsHIPP53-1, and OsHIPP53-5 were simultaneously treated with Cd to observe phenotypic changes. Seven-day-old rice seedlings were cultured, and seedlings with consistent growth were selected and transferred to Kimura nutrient solution containing or without 1 μM Cd for further cultivation. After seven days of culture, phenotypic data, including plant height, root length, and biomass, were collected and measured.

[0070] Under cadmium-free conditions, the growth of OsHIPP53-1 and OsHIPP53-5 was basically the same as that of the wild-type Nipponbare. Under 1 μM Cd treatment, the growth of OsHIPP53-1 and OsHIPP53-5 was significantly weaker than that of Nipponbare. Figure 3 The plant height and root length of wild-type Nipponbare and mutant plants were measured under normal conditions and cadmium treatment conditions. Under normal conditions, there was no significant difference in plant height and root length between the mutant and Nipponbare. However, under cadmium treatment, the root length of the mutant plant was significantly shorter than that of Nipponbare. Figure 4 Based on the above results, it can be concluded that the mutants OsHIPP53-1 and OsHIPP53-5 are more sensitive to Cd, and the OsHIPP53 gene plays a regulatory role in cadmium tolerance in rice.

[0071] In summary, the present invention mutated the OsHIPP53 gene through genetic engineering techniques, resulting in screening of the mutant strains OsHIPP53-1 and OsHIPP53-5. Experimental verification showed that the mutant strains were more sensitive to cadmium treatment than the wild-type Nipponbare. This present invention experimentally confirms for the first time that the OsHIPP53 gene can enhance rice tolerance to cadmium. Given its application under cadmium stress, the gene is believed to have potential application value in improving rice resistance to cadmium stress. This invention also lays a solid theoretical and practical foundation for using the OsHIPP53 gene to cultivate cadmium-tolerant rice varieties.

[0072] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of OsHIPP53 gene in regulating cadmium tolerance of rice; the amino acid sequence encoded by the OsHIPP53 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the CDS sequence of the OsHIPP53 gene is shown in SEQ ID NO.

2.

3. The use according to claim 1 or 2, characterized in that: The regulation of rice cadmium tolerance includes knocking out or knocking down the OsHIPP53 gene to increase the cadmium sensitivity of rice.

4. A sgRNA targeting the OsHIPP53 gene, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

3.

5. The sgRNA according to claim 4, characterized in that The sgRNA includes sgRNA-S whose nucleotide sequence is shown in SEQ ID NO.4 and sgRNA-A whose nucleotide sequence is shown in SEQ ID NO.

5.

6. A recombinant vector for knocking out the OsHIPP53 gene, characterized in that: The recombinant vector comprises the sgRNA according to claim 4 or 5.

7. A method for constructing a cadmium-sensitive rice model, characterized in that: The following steps are involved: The CRISPR / Cas9 gene editing technology is used to transfer the recombinant vector of claim 6 into the recipient rice to knock out the OsHIPP53 gene.

8. A mutant of the OsHIPP53 gene associated with cadmium tolerance in rice, characterized in that: The OsHIPP53 gene mutants include OsHIPP53-1 mutant and OsHIPP53-5 mutant; The OsHIPP53-1 mutant is a mutant in which the C base is deleted at position 319 bp of the OsHIPP53 gene fragment as shown in the nucleotide sequence of SEQ ID NO.2; The OsHIPP53-5 mutant is a mutant in which the G base is mutated to a T base at the 318bp position of the OsHIPP53 gene fragment as shown in the nucleotide sequence of SEQ ID NO.2, and the C base is deleted at the 319bp position.

9. Use of the OsHIPP53 gene mutant according to claim 8 in regulating cadmium tolerance in rice.

10. A primer set for identifying the OsHIPP53 gene mutant according to claim 8, characterized in that: It includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.6 and a downstream primer as shown in SEQ ID NO.7.

Images