CircRNA (Ribonucleic Acid) cyclized plasmid as well as construction method, kit and application thereof
By constructing the circRNA circularization plasmid, using the circcase2 gene circularization and UAS-Gal4 system, the circularization and specific expression of circRNA are achieved, solving the problem of uncontrolled circRNA expression in the prior art, and ensuring the linear RNA The expression level was not affected, which promoted the study of circRNA function and regulatory mechanism.
Patent Information
- Application Number
- CN202411493486.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-24
- Publication Date
- 2025-02-07
AI Technical Summary
It is difficult to realize the circularization and specific expression of circRNA in the prior art, and the expression level of corresponding linear RNA is affected.
By constructing the circRNA circularization plasmid, using the cyclization of the laccase2 gene and combining with the UAS-Gal4 system, the circularization and specific expression of circRNA are achieved to ensure that the expression level of linear RNA is not affected.
The circularization and specific expression of circRNA are achieved, helping to in-depth study of the functions and regulatory mechanisms of specific circRNAs without affecting the expression level of linear RNA.
Smart Images
Figure CN119391770A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a circRNA circularization plasmid and a construction method, a kit and applications thereof. Background Art
[0002] Circular RNA (circRNA) is a new type of circular non-coding RNA produced by pre-mRNA reverse splicing. Due to the special circular structure of circRNA, it has natural resistance to degradation by nucleases, and its stability is much higher than that of the corresponding linear mRNA. Studies have shown that circRNA accumulated in the cytoplasm can inhibit the binding between miRNA and target genes through the "sponge" effect of miRNAs, and regulate the occurrence and development of various diseases. In addition, circRNA can also participate in maintaining RNA stability, post-transcriptional modification, protein localization and other biological processes by binding to RNA / protein, which has important biological significance and research value. The present invention intends to develop a circRNA circularization plasmid to achieve circRNA circularization and specific expression in host cells. Summary of the invention
[0003] The object of the present invention is to provide a circRNA circularization plasmid and a construction method, a kit and an application thereof to solve the problems existing in the above-mentioned prior art. The circRNA circularization plasmid can realize the circularization and specific expression of circRNA, and the expression level of the corresponding linear RNA is not affected.
[0004] Different from the conventional linear splicing pattern of linear RNA, circRNA is formed by exon or intron reverse splicing, and the formation mode includes exon cyclization and intron cyclization. Studies have found that the Drosophila laccase2 gene can produce a large amount of circRNA in and outside the fruit fly. The repetitive sequence of the laccase2 intron has strong complementarity and forms cyclization through base pairing. This process is regulated by multiple hnRNPs and SR family proteins. At the same time, the DNAREP1_DM repetitive sequence in the laccase2 intron can also promote exon cyclization, producing only a minimum amount of linear RNA. The present invention utilizes the cyclization of laccase2 to construct a circRNA cyclization plasmid.
[0005] Based on this, the present invention provides the following solutions:
[0006] The present invention provides a method for constructing a circRNA circularization plasmid, comprising the steps of inserting a LaccaseF fragment and a LaccaseR fragment connected in sequence into an animal cell expression vector to construct the circRNA circularization plasmid;
[0007] The nucleotide sequence of the LaccaseF fragment is shown in SEQ ID NO.1;
[0008] The nucleotide sequence of the LaccaseR fragment is shown in SEQ ID NO.3.
[0009] Furthermore, the animal cell expression vector is a pUAS-attB vector.
[0010] The present invention also provides a circRNA circularized plasmid constructed according to the above construction method.
[0011] The present invention also provides use of the circRNA circularization plasmid in preparing a circRNA circularization kit.
[0012] The present invention also provides a circRNA circularization kit, comprising the above-mentioned circRNA circularization plasmid.
[0013] The present invention also provides the use of the above-mentioned circRNA circularization plasmid or circRNA circularization kit in achieving circular expression of RNA.
[0014] Furthermore, circular expression of RNA is achieved by transfecting the recombinant plasmid into animal cells;
[0015] The recombinant plasmid is constructed by inserting the cDNA of the target RNA between the LaccaseF fragment and the LaccaseR fragment of the circRNA circularization plasmid.
[0016] The present invention also provides a method for cyclizing expressed RNA, comprising the following steps:
[0017] Insert the cDNA of the target RNA between the LaccaseF fragment and the LaccaseR fragment of the circRNA circularization plasmid to construct a recombinant plasmid;
[0018] The recombinant plasmid is transfected into animal cells and cultured to express circRNA.
[0019] Furthermore, the animal cell is a Drosophila S2 cell.
[0020] The present invention discloses the following technical effects:
[0021] The present invention utilizes the cyclization of the laccase2 gene to construct a circRNA cyclization plasmid, and through the UAS-Gal4 system, the cyclization and specific expression of circRNA can be achieved, and the expression level of the corresponding linear RNA is not affected. The present invention is helpful for in-depth research on the function and regulatory mechanism of specific circRNA. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0023] Figure 1 This is the plasmid map of pUAS-attB-LaccaseF-circRNA-LaccaseR;
[0024] Figure 2 This is a statistical graph of the results of real-time fluorescence quantitative polymerase chain reaction (qRT-PCR) detection of circRNA expression levels in different groups;
[0025] Figure 3 This is a statistical graph of the results of qRT-PCR detection of linear RNA expression levels in different groups. DETAILED DESCRIPTION
[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.
[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0031] Example 1
[0032] The present invention constructs a pUAS-attB-LaccaseF-circRNA-LaccaseR plasmid and utilizes the UAS-Gal4 system to achieve the cyclization and specific expression of related circRNA.
[0033] (1) UAS-Gal4 system
[0034] The present invention uses the Drosophila UAS-Gal4 system and utilizes the widely expressed ub-Gal4 to drive the expression of the related pUAS-attB plasmid (disclosed in the document "Stem Cell Res Ther. 2022 Jul 26; 13 (1): 351. doi: 10.1186 / s13287-022-03025-5") to achieve the cyclization and specific expression of the related circRNA. At the same time, the pUAS-attB-LaccaseF-circRNA-LaccaseR plasmid designed by the present invention can continue to add tag protein (HA, Flag) sequences, which are further used to detect circRNAs with the function of encoding small peptides. Driving the expression of these tagged fusion proteins can be used for subsequent functional and mechanism studies.
[0035] (2) Plasmid construction
[0036] The Laccase2 sequence was tagged to both ends of the target circRNA to achieve circularization of the circRNA. The target sequence LaccaseF-circRNA-LaccaseR was cloned into the vector pUAS-attB through the 5'EcoRI and 3'KpnI restriction endonuclease sites by adding 5'(EcoRI) and 3'(KpnI) to construct the plasmid pUAS-attB-LaccaseF-circRNA-LaccaseR.
[0037] The construction method of plasmid pUAS-attB-LaccaseF-circRNA-LaccaseR is as follows: design primers, and add corresponding restriction sites and protective bases on the primers; agarose gel electrophoresis of PCR products and DNA gel recovery; enzyme digestion: digest the target sequence and empty plasmid, and unless there are special circumstances, 37°C is generally the optimal temperature, and the reaction time is 3 hours; ligation: ligation at room temperature for 1 hour or 16°C overnight; the ligation product is transformed and revived with DH5αE.coli competent cells, and the 10 μL of ligation product was added to 50 μL of DH5αE.coli competent cells. After 30 minutes on ice, heat shock was performed in a 42°C water bath for 60 seconds, followed by an ice bath for 2 minutes. 500 μL of preheated LB medium was added, and cultured at 37°C, 200 rpm, and shaking for 30 minutes. After centrifugation at 4000 g for 5 minutes, the bacterial precipitate was plated on an LB culture dish containing antibiotics and cultured at 37°C for 16 hours. Single clones were picked and cultured at 220 rpm at 37°C for 16 hours. Plasmid preparation was performed. Plasmid restriction enzyme digestion and sequencing were performed. Plasmid midi-preparation was performed.
[0038] The relevant nucleotide sequences are as follows:
[0039] LaccaseF (SEQ ID NO.1):
[0040] CTCGAGGTCGACGGTATCGATAAGCTTGATATCACCCATTGAGAAATGACTGAGTTCCGGTGCTCTCAAGTCATTGATCTTTGTCGACTTTTATTTGGTCTCTGTAATAACGACTTCAAAAACATTAAATTCTGTTGCGAAGCCAGTAAGCTACAAAAAGAAAAAACAAGAGAGAATGCTATAGTCGTATAGTATAGTTTCCCGACTATCTGATACCCATTACTTATCTAGGGGGAATGCGAACCCAAAATTTTATCAGTTTTCTCGGATATCGATAGATATTGGGGAATAAATTTAAATAAATAAATTTTGGGCGGGTTTAGGGCGTGGCAAAAAGTTTTTTGGCAAATCGCTAGAAATTTACAAGACTTATAAAATTATGAAAAAATACAACAAAATTTTAAACACGTGGGCGTGACAGTTTTGGACGGTTTTAGGGCGTTAGAGTAGGCGAGGACAGGGTTACATCGACTAGGCTTTGATCCTGATCAAGAATATATATACTTTATACCGCTTCCTTCTACATGTTACCTATTTTTCAACGAATCTAGTATACCTTTTTACTGTACGATTTATGGGTATAATAATAAGCTAAATCGAGACTAAGTTTTATTGTTATATATATTTTTTTTATTTTATGCAGAAAGGTACCACCGGT。
[0041] cDNA of circRNA (SEQ ID NO.2):
[0042] GTTGCATGGATAAAATCTGATTCAAAGGCCATACTTGGTATACACACCCACATGGTCTCACTAAATCCAAGATTATCTGTAACACATAACGGCCACAATACTTGGAAACTCCATATATCTCGTGTACAGATAAACGACTCCGGAAGTTATATGTGCCAAGTAAATACAGATCCGATGAAGAGCCTTTCCGGATATTTAGATGTTGTTGTACCTCCAGATATTTTAAACCACCCAGAACATAATCCAGAGGACGGCGTCTGTCAAGAGGGTGGAAGTATTTCACTTATGTGCAGCGTGACAGGCGTTCCAAGACCAAAAGTACTGTGGCGACGTGAGGCGGGAAAGGAAATAATACTTCGCACGGATGGTAGAGATAAAACAG。
[0043] LaccaseR(SEQ ID NO.3):
[0044] GAGCTCAGCGTAAGTATTCAAAATTCCAAAATTTTTTACTAGAAATATTCGATTTTTTAATAGGCAGTTTCTATACTATTGTATACTATTGTAGATTCGTTGAAAAGTATGTAACAGGAAGAATAAAGCATTTCCGACCATGTAAAGTATATATATTCTTAATAAGGATCAATAGCCGAGTCGATCTCGCCATGTCCGTCTGTCTTATTATTTTATTACCGCCGAGACATCAGGAACTATAAAAGCTAGAAGGATGAGTTTTAGCATACAGATTCTAGAGACAAGGACGCAGAGCAAGTTTGTTGATCCATGCTGCCACGCTTTAACTTTCTCAAATTGCCCAAAACTGCCATGCCCACATTTTTGAACTATTTTCGAAATTTTTTCATAATTGTATTACTCGTGTAAATTTCCATCAATTTGCCAAAAAACTTTTTGTCACGCGTTAACGCCCTAAAGCCGCCAATTTGGTCACGCCCACACTATTGAACAATTATCAAATTTTTTCTCATTTTATTCCCCAATATCTATCGATATCCCCGATTATGAAATTATTAAATTTCGCGTTCGCATTCACACTAGCTGAGTAACGAGTATCTGATAGTTGGGGAAATCGACTTATTTTTTATATACAATGAAAATGAATTTAATCATATGAATATCGATTATAGCTTTTTATTTAATATGAATATTTATTTGGGCTTAAGGTGTAACCTCCTCGACATAAGACTCACATGGCGCAGGCACATTGAAGACAAAAATACTCATTGTCGGGTCTCGCACCCTCCAGCAGCACCTAAAATTATGTCTTCAATTATTGCCAACATTGGAGACACAATTAGTCTGTGGCACCTCAGGCGGCCGC。
[0045] Example 2
[0046] The target circRNA was overexpressed in Drosophila S2 cells using the plasmid pUAS-attB-LaccaseF-circRNA-LaccaseR prepared in Example 1. The expression of circRNA and the corresponding linear RNA was verified by qRT-PCR.
[0047] (1) Drosophila S2 cell culture and plasmid transfection
[0048] 1) Cell recovery: Quickly remove the frozen Drosophila S2 cells from liquid nitrogen, then place them in a 30°C constant temperature water bath, gently shake the cryotube to accelerate cell lysis, and try to melt all cells within one minute. Immediately spray with 75% alcohol after thawing, wipe the outer wall with sterile paper, and transfer to a 1.5mL Eppendorf tube. Centrifuge at 300g for 5 minutes, and aspirate the supernatant to remove DMSO. Resuspend the cells in 2mL of fresh culture medium (containing 10% fetal bovine serum) and transfer to a 6-well cell culture dish, and continue to culture at 28°C.
[0049] 2) Cell passaging: To obtain stable cell lines or to amplify a large number of cells of the same type in a short period of time and to maintain the continuity of the cell line. 6 / mL, the cells need to be passaged at a ratio of 1:1 to 1:3. After collecting the cells by centrifugation at 300g for 5 minutes, resuspend the cells in 1mL of culture medium and transfer them to another clean sterile culture dish, and then add 2mL of fresh culture medium to each dish. The passaged cells continue to be incubated at 28℃ and can be frozen or used for experiments.
[0050] 3) Cell cryopreservation: During the experiment, cells that have been passaged many times and are in good condition need to be cryopreserved to maintain the continuation of the cells. Collect 2 mL of cell fluid and transfer it to a clean sterile EP tube, centrifuge at 300g for 5 minutes, remove the supernatant and add 1 mL of freezing solution, resuspend the cell pellet, mix it by pipetting, and transfer it to a cryopreservation tube, and immediately put it into a program cooling box and store it at -80℃. After 24 hours, transfer it to liquid nitrogen for long-term storage.
[0051] 4) Plasmid transfection: Specific circRNA sequences are expressed under the drive of UAS-Gal4. The plasmid pUAS-attB-LaccaseF-circRNA-LaccaseR (0.8 μg per well) was transfected into S2 cells using a highly efficient transfection reagent (Qiagen). The plasmid was diluted to 100 μL using EC buffer, and 6.4 μL Enhancer reagent was added, vortexed and incubated at room temperature for 5 minutes. Then, a lipid complex was formed by adding 20 μL Effectene Transfection Reagent and incubated for 10 minutes. Subsequently, 600 μL opti-MEM reagent was added to the lipid complex, mixed with S2 cells, and transfected. Subsequent experiments were performed 48 hours after transfection.
[0052] (2) Real-time quantitative polymerase chain reaction (qRT-PCR)
[0053] 1) Extraction of total RNA from Drosophila S2 cells: Collect the cell suspension, centrifuge at 300g for 5min at 4℃, and discard the supernatant. Then, add 1mL Trizol reagent to each sample, blow and dissolve thoroughly until there is no obvious precipitation, and let it stand at room temperature for 5min. Then, add 200μL chloroform to each sample, shake vigorously for 20s using an oscillating instrument, let it stand at room temperature for 3min, and centrifuge at 16000g for 15min. Collect the upper aqueous phase, add 500μL isopropanol to each sample, let it stand for 20min, centrifuge at 16000g for 15min, and discard the supernatant. Then add 75% ethanol (prepared with DEPC water) to wash the precipitate, centrifuge at 7500g for 5min, and discard the supernatant. After drying the precipitate, add 20μL DEPC water to dissolve the precipitate and detect the RNA concentration.
[0054] 2) Reverse transcription: The extracted RNA was reverse transcribed into cDNA using the Invitrogen reverse transcription kit. The specific experimental process strictly followed the experimental method attached to the kit.
[0055] 3) qRT-PCR: Using cDNA as a template, qRT-PCR was performed to detect the expression levels of circRNA and linear RNA in the control group (i.e., transfected with pUAS-attB plasmid) and circRNA transfection group (i.e., transfected with pUAS-attB-LaccaseF-circRNA-LaccaseR plasmid) to verify the circularization and specific expression efficiency of circRNA. The expression level detection results of circRNA and linear RNA are shown in Figure 2 and Figure 3The results showed that the expression level of circRNA in the circRNA transfection group was significantly higher than that in the control group, while the expression level of linear RNA was not significantly different from that in the control group.
[0056] Example 3
[0057] A method for constructing a circRNA circularization plasmid: The method is the same as the "(2) Plasmid construction" section of Example 1, except that the target sequence LaccaseF-LaccaseR is cloned into the vector pUAS-attB through the 5'EcoRI and 3'KpnI restriction endonuclease sites.
[0058] The circRNA circularization plasmid constructed in this example is suitable for RNA circularization expression, which is specifically achieved by the following steps: inserting the cDNA of the target RNA between the LaccaseF fragment and the LaccaseR fragment of the circRNA circularization plasmid to construct a recombinant plasmid, and then transfecting the recombinant plasmid into animal cells to achieve RNA circularization expression.
[0059] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A method for constructing a circRNA circularized plasmid, characterized in that: The method comprises the steps of inserting the sequentially connected LaccaseF fragment and the LaccaseR fragment into an animal cell expression vector to construct the circRNA circularization plasmid; The nucleotide sequence of the LaccaseF fragment is shown in SEQ ID NO.1; The nucleotide sequence of the LaccaseR fragment is shown in SEQ ID NO.
3.
2. The construction method according to claim 1, characterized in that: The animal cell expression vector is a pUAS-attB vector.
3. A circRNA circularized plasmid constructed according to the construction method according to claim 1 or 2.
4. Use of the circRNA circularization plasmid as claimed in claim 3 in preparing a circRNA circularization kit.
5. A circRNA cyclization kit, characterized in that: Including the circRNA circularization plasmid described in claim 3.
6. Use of the circRNA circularization plasmid according to claim 3 or the circRNA circularization kit according to claim 5 in achieving circular expression of RNA.
7. The use according to claim 6, characterized in that: RNA circularization expression is achieved by transfecting the recombinant plasmid into animal cells; The recombinant plasmid is constructed by inserting the cDNA of the target RNA between the LaccaseF fragment and the LaccaseR fragment of the circRNA circularization plasmid according to claim 3.
8. A method for circularizing expressed RNA, characterized in that: The following steps are involved: Inserting the cDNA of the target RNA between the LaccaseF fragment and the LaccaseR fragment of the circRNA circularization plasmid according to claim 3 to construct a recombinant plasmid; The recombinant plasmid is transfected into animal cells and cultured to express circRNA.
9. The method according to claim 8, characterized in that The animal cells are Drosophila S2 cells.