A molecular marker for identifying the sex of Channa maculata and its application
By developing InDel markers closely linked to the sex gene of the phlegm and designing specific KASP primers, the problem of low accuracy of sex identification in the prior art is solved, efficient and rapid gender identification and breeding screening are achieved, and the efficiency of breeding of phlegm is improved.
Patent Information
- Application Number
- CN202411736490.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2044-11-29
AI Technical Summary
The existing genetic sex identification marking of phlegm is low, and the stability is poor, making it difficult to be used for large-scale molecular marker-assisted selection breeding, which affects the purification speed and breeding process of all male and female lines of phlegm and super male lines.
A InDel marker closely linked to the sex gene of phlegm was developed, and specific KASP primers were designed to achieve accurate identification of the sex of phlegm by PCR amplification and fluorescence detection.
High accuracy and high throughput detection of the sex of phlegm are achieved, and pseudo-female and supermale can be quickly screened, shortened breeding time and improved breeding efficiency.
Smart Images

Figure SMS_1 
Figure HDA0005161614620000011
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a molecular marker for identifying the sex of Channa maculata and an application thereof. Background Art
[0002] Snakehead Channa maculata) Belongs to the order Perciformes ( Anabantiformes )Channa Channidae )Snakehead ( Channa The snakehead fish (Snakehead croaker) is primarily found in the waters south of the Yangtze River, in areas such as Guangdong, Guangxi, Fujian, Yunnan, Hunan, and Hainan. Its delicate and delicious meat, high protein content, and few bones are its characteristics. Its rapid growth and high yield have made it an important economic freshwater aquaculture species in my country.
[0003] The snakehead fish (Canna scrofa) exhibits significant sexual dimorphism. Under identical culture conditions, males grow significantly faster than females. Therefore, establishing an all-male population through sex control can significantly increase aquaculture yields and improve profitability, which is of great economic significance. The sex ratio in a population of snakehead fish is approximately 1:1, and sex determination is genetically determined, with research suggesting an XY chromosomal pattern. During the establishment of an all-male population, sex differentiation is difficult based on appearance. Therefore, sex identification and screening for pseudo-females (genetically male but physiologically female, with an XY chromosome pattern) and super-males (female homogametic fish with a YY sex chromosome pattern) require the use of sex-linked molecular markers.
[0004] Some molecular markers related to the genetic sex of snakehead fish have been developed both domestically and internationally. However, existing markers for identifying the genetic sex of snakehead fish are either dominant markers with low accuracy and poor stability, making them unsuitable for large-scale molecular marker-assisted selection breeding. Alternatively, they rely on specific instruments and reagents, lacking versatility, flexibility, and ease of use. This has seriously impacted the purification speed of all-male and super-male lines of snakehead fish and the progress of variety selection. Summary of the Invention
[0005] The first aspect of the present invention provides an InDel marker tightly linked to the sex gene of Channa maculata, characterized in that the InDel marker is a nucleotide sequence located on chromosome 2 of the Channa maculata genome, containing a polymorphic "AAG / ---" site at positions 34302196 to 34302198, wherein "-" represents a base deletion.
[0006] The physical location of the InDel markers in the present invention is based on the Channa maculata genome (Channa maculata genome assembly ASM2049675v1).
[0007] In one or more embodiments of the present invention, the homozygous genotype with the polymorphic site base "---" corresponds to a female snakehead fish, the heterozygous genotype with the polymorphic site base "AAG / ---" corresponds to a male snakehead fish, and the homozygous genotype with the polymorphic site base "AAG" corresponds to a super male snakehead fish.
[0008] The second aspect of the present invention provides KASP primers for amplifying the InDel markers of the first aspect.
[0009] comprising a first primer, a second primer and a third primer;
[0010] The first primer contains the nucleotide sequence shown in SEQ ID NO.1;
[0011] The second primer contains the nucleotide sequence shown in SEQ ID NO.2;
[0012] The nucleotide sequence of the third primer is shown in SEQ ID NO.3;
[0013] SEQ ID NO. 1: ATTGGTATTGATTATGAAATCTGGCAAG (5' to 3');
[0014] SEQ ID NO. 2: ATTGGTATTGATTATGAAATCTGGCAAA (5' to 3');
[0015] SEQ ID NO. 3: ACCCTTTAAATGTCTCCTCTTACAGGTTATAA (5' end to 3' end).
[0016] In one or more embodiments of the present invention,
[0017] The 5' end of the first primer is added with a tag sequence A corresponding to the A fluorescence;
[0018] The 5' end of the second primer is added with a tag sequence B corresponding to the B fluorescence;
[0019] The A fluorescence is different from the B fluorescence.
[0020] In one or more embodiments of the present invention, the A fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence, and the B fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence.
[0021] In one or more embodiments of the present invention, the 5' end of the first primer is added with a tag sequence corresponding to FAM fluorescence, SEQ ID NO. 4, and the nucleotide sequence of the first primer is shown in SEQ ID NO. 5;
[0022] The 5' end of the second primer is added with a tag sequence corresponding to HEX fluorescence, SEQ ID NO.6, and the nucleotide sequence of the second primer is shown in SEQ ID NO.7;
[0023] SEQ ID NO.4: GAAGGTGACCAAGTTCATGCT (5' to 3' end);
[0024] SEQ ID NO.5:
[0025] GAAGGTGACCAAGTTCATGCT ATTGGTATTGATTATGAAATCTGGCAAG (5' to 3' end);
[0026] SEQ ID NO.6: GAAGGTCGGAGTCAACGGATT (5' to 3' end);
[0027] SEQ ID NO.7:
[0028] GAAGGTCGGAGTCAACGGATT ATTGGTATTGATTATGAAATCTGGCAAA (5' to 3').
[0029] The third aspect of the present invention provides a detection reagent or kit containing the primer of the second aspect.
[0030] In one or more embodiments of the present invention, the detection reagent or kit further contains a probe, a DNA polymerase, dNTPs and MgCl2. The probe has a double-stranded structure and contains a complementary first and second strands. The probe includes a first probe and a second probe. The first strand of the first probe is at least partially complementary to the tag sequence A and is labeled with the A fluorescence. The second strand of the first probe is labeled with a quenched fluorescence corresponding to the A fluorescence. The first strand of the second probe is at least partially complementary to the tag sequence B and is labeled with the B fluorescence. The second strand of the second probe is labeled with a quenched fluorescence corresponding to the B fluorescence.
[0031] The fourth aspect of the present invention provides the use of any one of the InDel marker of the first aspect, the KASP primer of the second aspect, and the detection reagent or kit of the third aspect in any of the following aspects:
[0032] 1) Used to identify the sex of snakehead fish;
[0033] 2) Molecular marker-assisted breeding related to the sex of Channa maculatus;
[0034] 3) Used for genotyping of Channa maculata;
[0035] 4) Used to construct the DNA fingerprint of Channa macularia.
[0036] A fifth aspect of the present invention provides a method for identifying the sex of a snakehead fish, comprising the following steps:
[0037] 1) Extracting genomic DNA from the target snakehead;
[0038] 2) using the DNA as a template and performing PCR amplification using the KASP primers of the second aspect;
[0039] 3) Analyze the PCR amplification products and determine the sex of the snakehead fish based on the genotype of the polymorphic sites contained in the amplification products.
[0040] In one or more embodiments of the present invention, if fluorescence corresponding to fluorescence A is detected in the amplified product, the base at this site is a "---" homozygous genotype, and the corresponding snakehead fish is female; if two different fluorescences are detected in the amplified product, the base at this site is a "AAG / ---" heterozygous genotype, and the corresponding snakehead fish is male; if fluorescence corresponding to fluorescence B is detected in the amplified product, the base at this site is a "AAG" homozygous genotype, and the corresponding snakehead fish is super male.
[0041] The beneficial effects of the present invention are:
[0042] The invention provides a molecular marker closely linked to the sex gene of Channa maculata, which can accurately identify the genetic sex of Channa maculata.
[0043] The present invention also provides specific KASP primers for amplifying molecular markers tightly linked to the sex gene of Channa maculata. These primers can be used to determine the genetic sex of Channa maculata. These primers are simple to use, offer high analytical throughput, and offer high accuracy, making them suitable for testing large numbers of samples. The molecular markers provided by this invention have important practical implications for rapidly and accurately screening for pseudo-female and super-male Channa maculata, shortening breeding time and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Figure 1 Results of marker detection of Cmhen 4 in 96 snakehead fish. DETAILED DESCRIPTION
[0045] The present invention is further described in detail below using specific examples. Unless otherwise specified, the raw materials, reagents, and apparatus used in the examples and comparative examples are available from conventional commercial sources or by conventional methods. Unless otherwise specified, all experimental and testing methods are conventional in the art, such as those described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2001) or according to the conditions recommended in the manufacturer's instructions.
[0046] Example 1: Development of a molecular marker (InDel marker Cmhen 4) tightly linked to the sex gene of Channa maculata
[0047] 1. High-multiplier resequencing of male and female snakehead fish
[0048] DNA was extracted from the caudal fins of 20 female and 20 male Channa maculata using the CTAB method. Paired-end sequencing was performed by BGI Biotechnology using the Illumina Xten platform, with a read length of 150 bp and a sequencing depth of 10×.
[0049] 2. Female and male specific sequence analysis
[0050] Sequencing data from 20 female and 20 male Channa maculata were aligned to the Channa maculata reference genome (Channa maculata genome assembly ASM2049675v1, published by Ou et al.; see www.ncbi.nlm.nih.gov / datasets / genome / GCA_020496755.1) using bwa software (v0.7.17-r1188). Based on the sequence alignment, a sequence specific to male Channa maculata (Chr2:34302105-34302472) was identified. Because the Y chromosome has an additional sequence compared to the X chromosome, high-multiplier sequencing was used to identify this sequence by comparing read coverage. This sequence was found to be unique to the Y gene. Based on this sequence, co-linked markers were identified around it.
[0051] 3. Development of KASP Marker
[0052] Based on the location of the male-specific sequence on the chromosome, InDel sites that differ between females and males were searched around it (Chr2:34302196 to 34302198).
[0053] The InDel site information of marker Cmhen 4 is as follows:
[0054] >C.maculata female
[0055] TTAAGTCATAAACCATAGATCAATAAAAGGGTGCACTTAAGGAAATGAGATAAAGGATTTATTTTTATTGGTATTGATTATGAAATCTGGCA --- AGAGAGAGAGCGGGAGATAAAGTATTGGATCCATATTACTCTTGTAAGAAGAAAGGGTTGGCAAAAAAGCAGATTTACGGATTGGCAAATGTTTCTATTTTGACTGTTAAGTTTTATTTAATGGTCCTTTTGTCAGTTT TTTATTTCTTATAACCTGTAAGAGGAGACATTTAAAGGGTGGGGTTTTCAGAGTAGAATGTTTGTTATAGCCCCTGCATTTAATAACATTGTGTATGTTGAGAAATATACTTTATTATTTATATTTGCGTTTGT (SEQID NO:8).
[0056] >C.maculata male
[0057] TTAAGTCATAAACCATAGATCAATAAAGGGTGCACTTAAGGAAATGAGATAAAGGATTTATTTTTATTGGTATTGATTATGAAATCTGGCA --- AGAGAGAGAGCGGGAGAGATAAAGTATTGGATCCATATTACTCTTGTAAGAAGAAAGGGTGGCAAAAAAGCAGATTTACGGATTGGCAAATGTTTCTATTTTGACTGTTAAGTTTTATTTAATGGTCCTTTTGTCAGTTTTTTATTTCTTATAACCTGTAAGAGGAGACATTTAAAGGGTGGGGTTTTCAGAGTAGAATGTTTGTTATAGCCCCTGCATTTAATAACATTGTGTATGTTGAGAAATATACTTTATTATTTATATTTGCGTTTGT (SEQ ID NO:8).
[0058] and TTAAGTCATAAACCATAGATCAATAAAGGGTGCACTTAAGGAAATGAGATAAAGGATTTATTTTTATTGGTATTGATTATGAAATCTGGCA AAG AGAGAGAGAGCGGGAGAGATAAAGTATTGGATCCATATTACTCTTGTAAGAAGAAAGGGTGGCAAAAAAGCAGATTTACGGATTGGCAAATGTTTCTATTTTGACTGTTAAGTTTTATTTAATGGTCCTTTTGTCAGTTTTTTATTTCTTATAACCTGTAAGAGGAGACATTTAAAGGGTGGGGTTTTCAGAGTAGAATGTTTGTTATAGCCCCTGCATTTAATAACATTGTGTATGTTGAGAAATATACTTTATTATTTATATTTGCGTTTGT (SEQ ID NO:9).
[0059] >C.maculata super-male
[0060] TTAAGTCATAAACCATAGATCAATAAAGGGTGCACTTAAGGAAATGAGATAAAGGATTTATTTTTATTGGTATTGATTATGAAATCTGGCAAAG AGAGAGAGAGCGGGAGATAAAGTATTGGATCCATATTACTCTTGTAAGAAGAAAGGGTTGGCAAAAAAGCAGATTTACGGATTGGCAAATGTTTCTATTTTGACTGTTAAGTTTTATTTAATGGTCCTTTTGTCAGTTT TTTATTTCTTATAACCTGTAAGAGGAGACATTTAAAGGGTGGGGTTTTCAGAGTAGAATGTTTGTTATAGCCCCTGCATTTAATAACATTGTGTATGTTGAGAAATATACTTTATTATTTATATTTGCGTTTGT (SEQID NO:9).
[0061] Sequence copy number and GC content analysis were performed on this development site to ensure that it met the high success rate for KASP markers. This site was then designed as a KASP marker. Based on the characteristics of the InDel mutation information, a set of competitive allele-specific PCR primers, including Primer X, Primer Y, and a reverse primer, was designed. Both forward primers terminated with the allelic variant bases AAG / ---. The reverse primer sequence was selected to ensure that the amplified fragment was between 60 and 120 bp.
[0062] The sequences of Primer X, Primer Y and reverse primer are shown in the table below:
[0063] Table 1
[0064]
[0065] The 5' end of the forward primer is connected to a fluorescent tag sequence, wherein the 5' end of Primer X is connected to the FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO: 4), and the 5' end of Primer Y is connected to the HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO: 6).
[0066] The above primer sequences were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. The KASP genotyping assay provided by this invention offers high throughput and simple operation. Simply add the specific KASP Primer mix and the universal KASP Master mix to a PCR microplate containing a DNA sample and perform PCR amplification. The final results are analyzed using a fluorescence detector.
[0067] KASP Master mix contains the following components: universal FRET cassette fluorescent primers, ROX internal reference dye, KlearTaq DNA polymerase, dNTPs, and MgCl2. The KASP Master mix is a product of LGC, a UK company, with the catalog number KBS-1016-002.
[0068] Example 2: InDel marker Cmhen 4 used in molecular marker-assisted selection breeding
[0069] 1. Extract genomic DNA from 96 snakehead fish;
[0070] 2. Dilute DNA to 18-22 ng / μL (preferably 20 ng / μL) as a template.
[0071] 3. PCR amplification reaction system: template DNA 5 μL, KASP Primer mix 5 μL, KASP Master mix 0.14 μL;
[0072] 4. PCR reaction conditions: 5 μL template DNA, 5 μL KASP Primer mix (Primer X concentration: 1 μM, Primer Y concentration: 1 μM, reverse primer concentration: 3 μM), 0.14 μL KASP Master mix. PCR program: 94°C for 15 min; 94°C for 20 sec, 65°C-56°C for 60 sec, with the annealing and extension temperature decreasing by 0.8°C each cycle, for 10 cycles; 94°C for 20 sec, 57°C for 60 sec, for 30 cycles.
[0073] 5. Fluorescence scanning of PCR amplification products: Use ARAYA to scan the fluorescence signal of the reaction system; then use INTELLICS for data analysis and genotyping;
[0074] 6. Result analysis: The genotype of female Channa maculata is XX, the genotype of male Channa maculata is XY, and the genotype of supermale Channa maculata is YY.
[0075] If the fluorescence corresponding to Primer X is detected in the amplified product, the base at that site is a homozygous genotype of "---", and the corresponding Channa maculata is female. If two different fluorescences are detected in the amplified product, the base at that site is a heterozygous genotype of "AAG / ---", and the corresponding Channa maculata is male. If the fluorescence corresponding to Primer Y is detected in the amplified product, the base at that site is a homozygous genotype of "AAG", and the corresponding Channa maculata is super male.
[0076] The marker typing of Cmhen 4 also has only three genotypes (such as Figure 1The results of the Cmhen 4 typing were consistent with those of the gonad examination, and the results showed that the Cmhen 4 marker can accurately distinguish female, male and super male Channa maculata with high speed and accuracy, and can therefore be used for molecular marker-assisted selection breeding.
[0077] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. An InDel marker tightly linked to the sex gene of Channa maculata, the InDel marker being a nucleotide sequence located at positions 34302196 to 34302198 on chromosome 2 of the Channa maculata genome containing the polymorphic "AAG / ---" site; wherein, - indicates a base deletion; the nucleotide sequence is as shown in SEQ ID NO: 9, and positions 92 to 94 of the nucleotide sequence shown in SEQ ID NO: 9 are the polymorphic "AAG / ---" sites; The reference genome of Channa maculata is Channa maculata genome assembly ASM2049675v1; The homozygous genotype with the polymorphic site base "---" corresponds to female Channa maculata, the heterozygous genotype with the polymorphic site base "AAG / ---" corresponds to male Channa maculata, and the homozygous genotype with the polymorphic site base "AAG" corresponds to super male Channa maculata.
2. KASP primers for amplifying the InDel-tagged KASP of claim 1, comprising a first primer, a second primer, and a third primer; The first primer contains the nucleotide sequence shown in SEQ ID NO.1; The second primer contains the nucleotide sequence shown in SEQ ID NO.2; The nucleotide sequence of the third primer is shown in SEQ ID NO.
3.
3. The KASP primer according to claim 2, characterized in that The 5' end of the first primer is added with a tag sequence A corresponding to the A fluorescence; The 5' end of the second primer is added with a tag sequence B corresponding to the B fluorescence; The A fluorescence is different from the B fluorescence.
4. The KASP primer according to claim 3, characterized in that The A fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence; and the B fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence.
5. A detection reagent or kit comprising the KASP primer according to claim 3 or 4.
6. The detection reagent or kit according to claim 5, characterized in that The detection reagent or kit further contains a probe, a DNA polymerase, dNTPs and MgCl2. The probe has a double-stranded structure and contains a complementary first and second strands. The probe includes a first probe and a second probe. The first strand of the first probe is at least partially complementary to the tag sequence A and is labeled with the A fluorescence. The second strand of the first probe is labeled with a quenched fluorescence corresponding to the A fluorescence. The first strand of the second probe is at least partially complementary to the tag sequence B and is labeled with the B fluorescence. The second strand of the second probe is labeled with a quenched fluorescence corresponding to the B fluorescence.
7. Use of any one of the InDel marker according to claim 1, the KASP primer according to any one of claims 2 to 4, and the detection reagent or kit according to claim 5 or 6 in any of the following aspects: 1) Identify the sex of snakehead fish; 2) Molecular marker-assisted breeding related to the sex of Channa maculatus; 3) Genotyping of Channa maculata; 4) Construct a DNA fingerprint of Channa maculata.
8. A method for identifying the sex of Channa macularis, comprising the following steps: 1) Extracting genomic DNA from the target snakehead; 2) using DNA as a template and performing PCR amplification using the KASP primers described in claim 3 or 4; 3) Analyze the PCR amplification products and determine the sex of the snakehead fish based on the genotype of the polymorphic sites contained in the amplification products.
9. The method according to claim 8, characterized in that If the fluorescence corresponding to fluorescence A is detected in the amplified product, the base at this site is the "---" homozygous genotype, and the corresponding snakehead fish is female; if two different fluorescences are detected in the amplified product, the base at this site is the "AAG / ---" heterozygous genotype, and the corresponding snakehead fish is male; if the fluorescence corresponding to fluorescence B is detected in the amplified product, the base at this site is the "AAG" homozygous genotype, and the corresponding snakehead fish is super male.
Citation Information
Patent Citations
Indel marker used for channa maculata sex identification and application
CN111394445A
Male molecular marker primers for channa maculata and application thereof
CN112746111A