SNP site related to millet bristle length, molecular marker and application thereof

By developing SNP sites and molecular markers related to the length of millet bristles, the problem of lacking effective markers in existing technologies has been solved, enabling precise identification and improvement of millet bristle length, and promoting the refinement of breeding and the cultivation of superior varieties.

CN119391889BActive Publication Date: 2025-10-21ZHANGJIAKOU ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411276524.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-12
Publication Date
2025-10-21
Estimated Expiration
2044-09-12

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for identifying and improving the length of millet bristles has affected the optimization breeding process of millet varieties.

Method used

SNP sites and molecular markers associated with the length of millet bristles were developed. Specific probes or primers were used for genome detection and PCR amplification to predict or identify the length of millet bristles for use in breeding.

Benefits of technology

By accurately identifying and improving the length of millet bristles, the precision and efficiency of breeding have been enhanced, providing directional guidance for breeding and promoting the cultivation of superior varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391889B_ABST
    Figure CN119391889B_ABST
Patent Text Reader

Abstract

The application discloses SNP sites related to the length of foxtail millet bristles, molecular markers and application of the SNP sites. The SNP sites comprise a first SNP site and a second SNP site. The first SNP site is located at the 38241023th position of a first chromosome of the foxtail millet, and the allelic variation is T / C. The second SNP site is located at the 35484548th position of a fifth chromosome of the foxtail millet, and the allelic variation is A / G. When the first SNP site shows the C allelic variation and the second SNP site shows the A allelic variation, the length of the foxtail millet bristles is longer. The SNP marker provided by the application is significantly related to the bristle trait (length), and the SNP marker is used to connect the genomic DNA sequence with the foxtail millet bristle trait gene, thereby being beneficial to the establishment of a foxtail millet molecular marker assisted breeding system and providing a direction and basis for more fine positioning and foxtail millet breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of biomolecules, and particularly relates to SNP sites and molecular markers related to foxtail millet bristle length and applications thereof. Background Art

[0002] Millet (Setaria italica), formerly known as millet or millet, is an annual herbaceous crop native to China. It is one of China's important food crops and plays an irreplaceable role in the sustainable development of dryland agriculture. Millet is highly drought-tolerant and water-efficient, and is considered a strategic reserve crop for future droughts and climate change. Millet has a spike-shaped panicle inflorescence consisting of a main axis, branches, spikelets, and flowers, with bristles at the base of the spikelets. Research has shown that the long bristles of millet help mitigate and prevent insect and bird damage. These long bristles hinder pest alighting, egg-laying, and pathogen adhesion, reducing the risk of pests and diseases. Furthermore, the long bristles can reduce millet losses due to bird feeding. As a diploid, self-pollinated crop, millet has a small genome, is easy to manipulate, has a short reproductive cycle, and is relatively genetically simple. A high-quality reference genome sequence is now available, and the publication of a millet SSR genetic linkage map has laid a solid foundation for genetic analysis. Although the whole genome sequence of millet has been sequenced, there are few reports on the genetic association studies of the bristle trait; therefore, it is necessary to develop, utilize and identify molecular markers of the bristle trait in millet to breed better varieties. Summary of the Invention

[0003] Based on the above background, the present invention provides SNP sites, molecular markers and applications thereof related to millet bristle length to breed better varieties.

[0004] The technical solution of the present invention is:

[0005] One of the objects of the present invention is to provide:

[0006] The SNP site associated with the length of millet bristles is characterized in that the SNP site includes a first SNP site and a second SNP site, the first SNP site is located at position 38241023 of the first chromosome of millet, and its allelic variation is T / C; the second SNP site is located at position 35484548 of the fifth chromosome of millet, and its allelic variation is A / G.

[0007] Furthermore, when the first SNP site shows a C allele variation and the second SNP site shows an A allele variation, the bristle length of the millet is relatively long.

[0008] Based on the same inventive concept, the present invention also provides the use of a substance for detecting the polymorphism or genotype of SNPs in a millet genome in any of the following applications, including:

[0009] 1) Application in predicting the length of millet bristles;

[0010] 2) Application in identification or auxiliary identification of millet bristle length traits;

[0011] 3) Application in related breeding or auxiliary breeding for improving the bristle length of millet.

[0012] The SNP sites include a first SNP site and a second SNP site. The first SNP site is located at position 38241023 of the first chromosome of millet, and its allele variation is T / C; the second SNP site is located at position 35484548 of the fifth chromosome of millet, and its allele variation is A / G.

[0013] Based on the same inventive concept, the present invention also provides molecular markers associated with foxtail millet bristle length, the molecular markers comprising a first molecular marker and a second molecular marker, the first molecular marker comprising position 38241023 of the first chromosome of foxtail millet, and the second molecular marker comprising position 35484548 of the fifth chromosome of foxtail millet;

[0014] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the details are as follows:

[0015] CATCACTGGTTGTTCATCCACTGTTATTCTTACTGCATCCTGAAGTAAATTTCTCTCACACGGTTCATCCC, the allele variation at base 36 is C or T;

[0016] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2, and the details are as follows:

[0017] TCTCTGCGGCTTTCAGAGAAGCTGTTGAGTGGCACAGGATCGCGAAGGAGAATTAAACTAGTACAGATGCC, the allele variation at base 36 is A or G.

[0018] Based on the same inventive concept, the present invention also provides the use of molecular markers related to foxtail millet bristle length in any of the following applications, including:

[0019] 1) Application in predicting the length of millet bristles;

[0020] 2) Application in identification or auxiliary identification of millet bristle length traits;

[0021] 3) Application in related breeding or auxiliary breeding for improving the bristle length of millet.

[0022] Based on the same inventive concept, the present invention also provides a method for predicting the length of foxtail millet bristles, using a specific probe or chip for detecting the above-mentioned SNP site to detect the foxtail millet genomic DNA to obtain the base conditions of the allelic variant sites of the SNP site, and predicting the length of foxtail millet bristles based on the base conditions;

[0023] Alternatively, a single leaf of millet is used as a DNA template, and primers corresponding to the above molecular markers are used for PCR amplification. The amplified products are sequenced and identified, and the length of the millet bristles is predicted based on the identification results.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides SNP sites that are significantly associated with the length of millet bristles, and develops molecular markers related to the length of millet bristles based on this, thereby linking the genomic DNA sequence with the millet bristle length trait, which is conducive to the establishment of a millet molecular marker-assisted breeding system and can provide direction and basis for more precise positioning and millet breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the millet population structure analysis of Example 1 of the present invention;

[0027] Figure 2 This is the LD attenuation distribution diagram of Example 1 of the present invention. DETAILED DESCRIPTION

[0028] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] Example 1: Determination of SNP sites and molecular markers associated with foxtail millet bristle length

[0032] In this example, 230 millet materials provided by Zhangjiakou Academy of Agricultural Sciences were selected, and the varieties of the millet materials included the following: Xiaofannuo, Sugu, Hongguzi, Dogtail Millet, Huangxu, Longzhuahuang, Xiangyanggu, Huanggu, Dahuanggu, Maomaohuang, Longgu 26, Longgu 30, Longgu 31, Longgu 17, Longgu 18, Longgu 19, Henggu 10, Henggu 11, Henggu 12, Henggu 21 varieties from various provinces across the country, and Liuwahonggu × Henan 4·2SE165. A total of 230 millet accessions, including hybrids of 5·Xiaomaohuang·Xia1, Chaoxianggu x Xuandasui 5·2SE Hybrid·8, Liuwahonggu x Henan 4·2SE1655·Xiaomaohuang·Xia1, and Liuwahonggu x Henan 4·2SE1655·Xiaomaohuang·Xia1, were sown in the experimental fields of Zhangjiakou Academy of Agricultural Sciences in mid-May 2023. Field trials were conducted, with each accession planted in two rows, with a row length of 2 m, a row spacing of 50 cm, and a plant spacing of 3–5 cm. Field traits of each accession were measured at the heading stage according to local management practices.

[0033] DNA samples were extracted from 230 foxtail millet accessions (leaves). After passing DNA quality testing, quantitative and qualitative analysis was performed using a NanoDrop ND-2000 (Thermo Scientific), and DNA integrity was verified by gel electrophoresis. DNA amplification, fragmentation, precipitation, resuspension, microarray hybridization, and washing were performed according to standard microarray procedures.

[0034] 1) Original millet chip data processing

[0035] First, the raw data scanned by the GeneTitan system was imported into Affymetrix Power Tools, where clustering and genotyping were performed. Finally, the data were exported to PLINK format using Affymetrix Power Tools for subsequent data analysis. The PLINK data were then converted to SNP-specific VCF format using the PLINK program for further analysis.

[0036] 2) Conversion of chip SNP data

[0037] The total SNP VCF files above were screened and the VCF files of SNPs related to heading period traits were obtained according to the number of samples with phenotypes at different periods.

[0038] 3) Sample population structure analysis

[0039] ADMIXTURE program was used to perform principal component analysis to obtain the clustering of samples.

[0040] 4) Linkage disequilibrium (LD) analysis

[0041] The linkage disequilibrium coefficient (r²) measures the level of linkage disequilibrium between SNP loci on a chromosome. When r² = 0, the population is in linkage equilibrium or lacks LD. The larger the r², the closer the SNP loci are. Generally, when r² is greater than or equal to 0.8, the two loci are considered to be in linkage disequilibrium. The distance between loci corresponding to the point at which r² decays to half is used as the linkage disequilibrium decay distance. VCFtools software is used to calculate the linkage disequilibrium decay value, and a nonlinear regression model is used to plot the trend of r² decay as the physical distance between SNP loci increases.

[0042] 5) GWAS analysis of chip data and prediction of candidate genes

[0043] Based on a customized SNP chip (Affymetrix chip) with 82,738 sites, SNP sites that appeared in at least 95% of the samples were further screened, and a total of 54,975 SNP sites were obtained at the heading stage. Entering the formal GWAS analysis, the R package GWASpoly analysis process was used to conduct various phenotypic association analyses at different developmental stages. Under the 1-dom and additive modes, the mixed linear Q+K algorithm (population structure + kinship) was used to find genes within 10kb upstream and downstream of the significant SNPs associated with the phenotypic association, and the SNP sites were functionally annotated. The results showed that the significant SNPs associated with the length of millet bristles were most highly associated with chromosome 1 (1_38241023) and chromosome 5 (5_35484548), namely the first SNP site and the second SNP site, respectively. The polymorphism of the first SNP site is T / C, and the polymorphism of the second SNP site is A / G. The additive of the first SNP site is 7.22, and the additive of the second SNP site is 6.02. And by Figure 1 It can be seen that the clustering of ADMIXTURE requires calculating the CV error (correlation error) under different K values. The trend of K value is to decrease first and then increase ( Figure 1 ), the K value at the beginning of the rise is the number of ancestral groups with the best genetic background. This experiment can be divided into approximately 35 ancestral groups. Figure 2 It can be seen that the LD decay distance of the foxtail millet genome in this embodiment is 9 M. A smaller LD decay distance is beneficial for narrowing down the candidate regions for subsequent association analysis and improving the accuracy of the association results.

[0044] Example 2: Based on the above SNP sites, this example develops molecular markers associated with foxtail millet bristle length, the molecular markers comprising a first molecular marker and a second molecular marker, the first molecular marker comprising site 38241023 on the first chromosome of foxtail millet, and the second molecular marker comprising site 35484548 on the fifth chromosome of foxtail millet;

[0045] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the details are as follows:

[0046] CATCACTGGTTGTTCATCCACTGTTATTCTTACTGCATCCTGAAGTAAATTTCTCTCACACGGTTCATCCC, the allele variation at base 36 is C or T;

[0047] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2, and the details are as follows:

[0048] TCTCTGCGGCTTTCAGAGAAGCTGTTGAGTGGCACAGGATCGCGAAGGAGAATTAAACTAGTACAGATGCC, the allele variation at base 36 is A or G.

[0049] The above molecular markers can be used to predict the length of millet bristles. Specifically, according to conventional procedures, molecular primers corresponding to the molecular markers are designed using Primer Premier (this is a conventional technique and will not be described in detail here). The millet genome, specifically the DNA of millet leaves, is used as a template. PCR amplification is performed using the primers. The amplified products are sequenced and identified, and the length of the millet bristles is predicted based on the identification results. If the identification results show that millet carries the first molecular marker and the second molecular marker, and the site corresponding to position 38241023 of the first chromosome in the first molecular marker exhibits a C allele variation, and the site corresponding to position 35484548 of the fifth chromosome in the second molecular marker exhibits an A allele variation, the length of the millet bristles will be longer.

[0050] Example 3: SNP marker verification

[0051] The length of the bristles of the 230 materials in Example 1 was measured after heading, among which the average length of the bristles of 65 materials was 5 mm or more, the average length of the bristles of 159 materials was 3 mm, the average length of the bristles of 1 material was 2 mm, and the average length of the bristles of 5 materials was 1 mm. According to the detection results of the SNP sites of the 230 materials on the chip, the 38241023rd position on the first chromosome of the 65 materials with an average bristle length of 5 mm or more showed a C allele variation, and the 35484548th position on the fifth chromosome showed an A allele variation.

[0052] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a SNP molecular marker associated with foxtail millet bristle length in any of the following, characterized in that: The applications include: 1) Application in predicting the length of millet bristles; 2) Application in identification or auxiliary identification of millet bristle length traits; 3) Application in related breeding or auxiliary breeding for improving bristle length in millet; The SNP molecular marker includes a first molecular marker and a second molecular marker, wherein the first molecular marker is located on the first chromosome of millet, and the second molecular marker is located on the fifth chromosome of millet; The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1: CATCACTGGTTGTTCATCCACTGTTATTCTTACTGCATCCTGAAGTAAATTTCTCTCACACGGTTCATCCC, the allele variation at base 36 is C or T; The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2: TCTCTGCGGCTTTCAGAGAAGCTGTTGAGTGGCACAGGATCGCGAAGGAGAATTAAACTAGTACAGATGCC, the allele variation at base 36 is A or G.

2. Use of the SNP molecular marker associated with foxtail millet bristle length according to claim 1 in any of the following applications, characterized in that: When the 36th base allele variation of the first molecular marker is C and the 36th base allele variation of the second molecular marker is A, the bristles of the millet are relatively long.

3. A method for predicting the length of millet bristles, characterized in that: Using a specific probe or chip for detecting the SNP molecular marker described in claim 1, the genomic DNA of the millet to be predicted is detected to obtain the base situation of the allelic variation site of the SNP molecular marker described in claim 1, and the length of the millet bristles is predicted based on the base situation; Alternatively, a single leaf of millet is used as a DNA template, and primers corresponding to the SNP molecular marker of claim 1 are used for PCR amplification. The amplified product is sequenced and identified, and the length of the millet bristles is predicted based on the identification results.

Citation Information

Patent Citations

  • SNP marker related to ear diameter character of millet, and detection primers and application thereof

    CN108774646A

  • Molecular marker related to seta length of foxtail millet, related biological material and application

    CN116219060A