InDel marker related to millet green millet coloring, primer set and application
By developing InDel markers SiHC1-1329 and SiHC2-31 and primer sets, the problem of screening and breeding high-quality green millet in existing technologies has been solved, realizing rapid and accurate screening and identification of green millet, and meeting market demand.
Patent Information
- Application Number
- CN202510243346.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-03-03
AI Technical Summary
Current technologies lack effective molecular markers for screening and breeding high-quality green millet, making it difficult to meet market demand for functional, high-quality whole grains.
We developed InDel markers SiHC1-1329 and SiHC2-31 associated with the coloration of green millet, and used them for PCR amplification and sequencing in combination with primer sets to accurately screen and identify green millet. We also provide kits and application methods.
It enabled rapid and accurate screening of green millet, explained 90% of the phenotypic variation rate, met the market demand for high-quality green millet, and guided genetic selection and improvement.
Smart Images

Figure CN119955977B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of millet breeding technology, specifically relating to an InDel marker, primer set, and application related to the coloring of green millet. Background Technology
[0002] The color of millet is one of the important indicators for evaluating the nutritional quality and marketability of millet. Green millet has become the most valuable cereal crop after yellow millet.
[0003] Of the existing millet varieties, yellow millet accounts for 90.4%, while green and white millet account for less than 10% of the total. Green millet is a rare type, which severely restricts market demand for functional, high-quality grains. The invention and application of molecular markers for green millet is of great significance for producing high-quality green millet. Current technologies mainly focus on the development of molecular markers and assisted breeding targeting the genetic control sites and genes for the color of yellow millet. For example, the SiPSY1 gene, which is the main carotenoid control gene in yellow millet, has been used as a KASP marker for the breeding of carotenoid-rich yellow millet varieties. However, molecular marker technologies for the coloring of green millet remain to be explored. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides an InDel marker, primer set, and application related to the coloring of green millet.
[0005] The specific technical solution of the present invention is as follows.
[0006] The first aspect of the present invention provides an InDel marker related to the coloring of green millet, the InDel marker being composed of SiHC1-1329 and SiHC2-31;
[0007] The nucleotide sequence of SiHC1-1329 is shown in SEQ ID NO.1;
[0008] The nucleotide sequence of SiHC2-31 is shown in SEQ ID NO.2.
[0009] The SiHC1-1329 described in this invention is located between 34090588bp and 34090707bp on chromosome 6, and the SiHC2-31 is located between 28698874bp and 28699045bp on chromosome 6. Both SiHC1-1329 and SiHC2-31 are closely linked to the color of millet. The InDel marker in this invention can be used to screen for green millet, enabling more accurate screening of green millet, thus allowing for the selection of high-quality green millet with high identification efficiency and accuracy.
[0010] A second aspect of the present invention provides a primer set for amplifying the InDel marker associated with the coloration of millet, the primer set consisting of primer pair 1 for amplifying SiHC1-1329 and primer pair 2 for amplifying SiHC2-31, the upstream and downstream primer nucleotide sequences of primer pair 1 being shown in SEQ ID NO.3 and SEQ ID NO.4, and the upstream and downstream primer nucleotide sequences of primer pair 2 being shown in SEQ ID NO.5 and SEQ ID NO.6.
[0011] A third aspect of the present invention provides a kit comprising the aforementioned primer set.
[0012] In another preferred embodiment, the kit further includes reagents for PCR amplification.
[0013] A fourth aspect of the present invention provides the application of the kit in predicting the coloration of green millet.
[0014] The fifth aspect of the present invention provides a method for predicting the coloration of green millet, comprising using the primer set to perform PCR amplification on the genomic DNA of millet to be detected, obtaining amplification products, sequencing the amplification products, and when the amplification products are as shown in SEQ ID NO.1 and SEQ ID NO.2, they are green millet.
[0015] The sixth aspect of this invention provides the application of the InDel marker in predicting the coloration of millet green millet or in molecular-assisted screening breeding of millet.
[0016] The seventh aspect of this invention provides the application of the primer set in predicting the coloration of green millet or in molecular-assisted screening breeding of millet.
[0017] Compared with the prior art, the present invention has the following beneficial effects.
[0018] This invention discloses an InDel marker, primer set, and application related to green millet coloring, which can be used for screening for green millet color. Using the Heizhi millet and Changnong 35 RIL populations as experimental materials, a high-density genetic map was constructed through resequencing. Based on the beige phenotype from 2021 to 2023, the trait was re-localized, revealing two QTL loci, SiHC1 and SiHC2, for green millet coloring, with PVEs of 33.43% and 23.15%, respectively. Both are located on chromosome 6, indicating that two pairs of non-allelic genes on chromosome 6 of millet jointly control the formation of green millet beige. Genetic analysis showed that SiHC2 determines green millet beige, but SiHC1 exhibits an inhibitory effect on SiHC2 coloring (13:3). Tightly linked markers SiHC1-1329 and SiHC2-31 were developed for SiHC1 and SiHC2 loci. Genetic population analysis confirmed that SiHC1-1329... 108bp As a repression site, SiHC1-1329 97bp The site is a non-inhibitory site, SiHC2-31 131bp For chromogenic sites, SiHC2-31 151bp This is a non-chromogenic site. Therefore, the genotype combination for green millet is SiHC1-1329. 97bp and SiHC2-31 131bp The remaining genotype combinations were all non-green millet. These two marker combinations were used to identify 30 different beige germplasm materials, and the results showed that SiHC1-1329... 97bp and SiHC2-31 131bp The combination of loci can explain 90% of the phenotypic variation in green millet.
[0019] The InDel marker detection method of this invention can accurately determine whether millet is green millet, thus enabling rapid and accurate screening of green millet from millet. This has significant theoretical and practical guiding significance for accelerating the genetic selection and improvement of green millet varieties. The InDel marker in this invention can explain 90% of the phenotypic variation rate of green millet. The primer pair for detecting the InDel marker in this invention can detect the green color of millet, thereby obtaining high-quality green millet, meeting the market demand for functional high-quality coarse grains, and is of great significance for high-quality green millet. Attached Figure Description
[0020] Figure 1 The figure shows the results of DNA sequence difference analysis between SiHC1-1329 and SiHC2-31 from their parents.
[0021] Figure 2The image shows the PCR amplification bands of SiHC1-1329 and SiHC2-31 in some lines of the parents and RIL populations; the beige colors of each material are: HZG (cyan), CN 35 (yellow), RIL-1 (light yellow), RIL-2 (yellow), RIL-3 (yellow), RIL-5 (cyan), RIL-6 (yellow), RIL-7 (cyan), RIL-8 (yellow), RIL-9 (cyan), RIL-11 (yellow + cyan), RIL-13 (yellow), RIL-14 (cyan), RIL-15 (yellow + cyan), RIL-16 (yellow), RIL-17 (white), RIL-19 (yellow), RIL-20 (yellow), RIL-21 (white), RIL-22 (yellow), RIL-23 (yellow), RIL-25 (cyan), RIL-32 (yellow), and RIL-32 (yellow).
[0022] Figure 3 The images show the amplification results of the SiHC1-1329 and SiHC2-31 marker combinations in some natural germplasms; where A is a beige image of 6 natural germplasms used for InDel marker reaction system optimization; and B is a comparison of the co-resolution results of the two markers when the primer volume ratios of SiHC1-1329 and SiHC2-31 are 1:1, 7:3, and 3:7. Detailed Implementation
[0023] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings.
[0024] Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.
[0025] This invention uses the “Heizhigu × Changnong 35” RIL population (F2:7) as experimental material. A high-density genetic map was constructed through resequencing. Based on the beige phenotype of the three years from 2021 to 2023, the trait was relocated, and two QTL loci, SiHC1 and SiHC2, for green rice coloring were obtained, with phenotypic contribution rates of 33.43% and 23.15%, respectively. Both are located on chromosome 6, indicating that there are two pairs of non-allelic genes on chromosome 6 of millet that jointly control the formation of green rice color.
[0026] Genetic analysis showed that SiHC2 determines the beige color of green millet, but SiHC1 exhibited an inhibitory effect on the color formation of SiHC2 (13:3, F1 all non-green millet, F2 population showed 13 / 16 non-green millet and 3 / 16 green millet). Tightly linked markers for SiHC1 and SiHC2 sites were developed; the nucleotide sequences of the upstream and downstream primers for primer pair 1 for amplifying SiHC1-1329 are shown in SEQ ID NO. 3 and SEQ ID NO. 4:
[0027] SEQ ID NO.3: 5'-GGATAGGCCCGCGATGTA-3'; SEQ ID NO.4: 5'-CTTTGCTTTTGGACTTTGGCT-3'.
[0028] The nucleotide sequences of the upstream and downstream primers for primer pair 2, which amplifies SiHC2-31, are shown in SEQ ID NO. 5 and SEQ ID NO. 6:
[0029] SEQ ID NO.5: 5'-AAGGACCAGGATGAGAGTTCC-3'; SEQ ID NO.6: 5'-TTCTCTTGTGCCGAGAATGA-3'.
[0030] Genetic population studies confirmed that SiHC1-1329 120bp As a repression site, SiHC1-1329 109bp The site is a non-inhibitory site, SiHC2-31 152bp For chromogenic sites, SiHC2-31 172bp This is a non-chromogenic site. Therefore, the genotype combination for green millet is: SiHC1-1329. 109bp and SiHC2-31 152bp The remaining genotype combination is SiHC1-1329. 109bp and SiHC2-31 172bp SiHC1-1329 120bp and SiHC2-31 172bp and SiHC1-1329 120bp and SiHC2-31 152bp All were non-green millet. Thirty different beige germplasm materials were identified using the SiHC1-1329 and SiHC2-31 marker groups. The results showed that SiHC1-1329… 109bp and SiHC2-31 152bp The marker group can explain 90% of the phenotypic variation in green millet.
[0031] The nucleotide sequence of SiHC1-1329 is shown in SEQ ID NO.1: GGATAGGCCCGCGATGTACAAAACTTTTTCTTCTTAATACAAAGATACGCA GCTCTCCTGCG TATTAAAAAAAAAGGACTGCAAAGACAAGGAGGAAGCAGCCAAAGTCCAAAAGCAAAG; where the underlined part represents the InDel marker site.
[0032] The nucleotide sequence of SiHC2-31 is shown in SEQ ID NO.2:
[0033] AAGGACCAGGATGAGAGTTCCGAACAAGTTTAAGGATCACCGTGGGCATTTTGAGAGTACCTAGATGGGGATGAGAATTCAGGACAA GTTTACGACCGTAAAATTT GCTCATAGTTAATTGACTTCCATGAGCATGGAAATGCACATGAGATTCATTCTCGGCACAAGAGAA; where the underlined part represents the InDel marker site.
[0034] The nucleotide sequence of chromosome 6, from 34090588 bp to 34090707 bp, of the parental parent, Kuroshigaya, is shown in SEQ ID NO. 7:
[0035] GGATAGGCCCGCGATGTACAAAACTTTTTTCTTCTTAATACAAAGATACGCATATTAAAAAAAAAGGACTGCAAAGACAAGGAGGAAGCAGCCAAAGTCCAAAAGCAAAG.
[0036] The nucleotide sequences from 34090588 bp to 34090707 bp of the parent nucleotide Changnong 35 are identical to those of sequence SEQ ID NO.1.
[0037] The nucleotide sequence of chromosome 6, from 28698874 bp to 28699045 bp, of the parent gene, Kuroshigaya, is shown in SEQ ID NO. 8:
[0038] AAGGACCAGGATGAGAGTTCCGAACAAGTTTAAGGATCACCGTGGGCATTTTGAGAGTACCTAGATGGGGATGAGAATTCAGGACAGCTCATAGTTAATTGACTTCCATGAGCATGGAAATGCACATGAGATTCATTCTCGGCACAAGAGAA.
[0039] The nucleotide sequence of chromosome 6, from 28698874bp to 28699045bp, of the parent genotype Changnong 35 is identical to that of sequence SEQ ID NO.2.
[0040] The following is a detailed explanation of the InDel markers, primer sets, and applications related to the coloring of millet.
[0041] Example 1: Sequencing and InDel molecular marker information analysis.
[0042] Using Heizhigu as the female parent and Changnong 35 as the male parent, a recombinant inbred line population (RIL population) was obtained by continuous self-pollination of the true hybrid F1. The 122 lines in the recombinant inbred line were resequencing, and a high-density genetic map containing 3795 Bin markers, with a total map distance of 3164.72 cM and an average map distance of 0.88 cM was constructed.
[0043] The beige color of 122 strains was investigated, with phenotypes categorized as follows: green rice beige assigned a value of 0, non-green rice beige assigned a value of 2, and mixed rice beige assigned a value of 1. Results showed that 30 strains exhibited green rice beige, 85 strains exhibited non-green rice beige, and 7 strains exhibited mixed rice beige. Using a high-density genetic map and the R / qtl composite region mapping (CIM) method, the green rice beige gene was mapped to two loci on chromosome 6 of millet: SiHC1 (region Chr6: 33947999–34373810) and SiHC2 (region Chr6: 28176324–29379085), explaining phenotypic variation rates of 33.4% and 23.15%, respectively. Both are major-effect QTL loci.
[0044] Based on the previous RIL population mapping of beige QTLs, and according to the parental resequencing analysis results, the differences in the InDel sequences of the parents within the range of 34090588 bp to 34090707 bp and 28698874 bp to 28699045 bp on chromosome 6 were used to further analyze the population. Figure 1 As shown, tightly linked InDel molecular markers SiHC1-1329 and SiHC2-31 were developed in the SiHC1 and SiHC2 regions, respectively. Genotyping of lines in the RIL population that exhibited beige color (i.e., green rice and non-green rice) was performed, resulting in six heterozygous recombinant single plants at different loci: RHL162, RHL2642, RHL3, RHL57, ZCF7-57-1,5 and ZCF7-57-7,8. These were used to analyze the genetic regulation of beige color in green rice by SiHC2 and SiHC1, as shown in Table 1.
[0045] Table 1. Statistical analysis of segregating phenotypes and genotypes of offspring from parents and heterozygous lines at different loci.
[0046]
[0047] Note: SiHC1-1329 120bp This indicates that the SiHC1 site is dominant homozygous; SiHC1-1329 109bp This indicates a recessive homozygous SiHC1 site; SiHC1-1329 109bp / 120bp Indicates SiHC1 site heterozygosity; SiHC2-31152bp This indicates that the SiHC2 site is dominant homozygous; SiHC2-31 172bp Indicates a recessive homozygosity at the SiHC2 site; SiHC2-31 152bp / 172bp This indicates that the SiHC2 site is heterozygous.
[0048] Genetic analysis showed that the genotype of both parents, Kuroshigaya, was SiHC1-1329. 109bp and SiHC2-31 152bp The genotype of Changnong 35 is SiHC1-1329. 120bp and SiHC2-31 172b .
[0049] When SiHC1 is heterozygous and SiHC2 is dominant homozygous, the secondary segregating populations of RHL162 and RHL31 show a non-rice:rice ratio of 3:1; when SiHC2 is heterozygous and SiHC1 is recessive homozygous, the secondary segregating population of RHL57 shows a non-rice:rice ratio of 1:3; when both SiHC1 and SiHC2 are heterozygous, the secondary segregating population of RHL3 shows a rice:non-rice ratio of 13:3.
[0050] Because the SiHC1 site inhibits the colorimetric effect of the SiHC2 site, SiHC1-1329 109bp / 120bp and SiHC2-31 152bp / 172bp The color is not cyan, and it is also SiHC1-1329. 109bp / 120bp and SiHC2-31 152bp It also does not exhibit a cyan color. In ZCF7-57-7,8, SiHC1-1329 109bp and SiHC2-31 172bp Although SiHC1-1329 109b It does not have an inhibitory effect, but SiHC2-31 172bp It also cannot cause the deposition of millet green pigment, therefore it is not green. Only SiHC1-1329 109bp and SiHC2-31 152bp It appears bluish-green. The above results indicate that SiHC2 determines the bluish-beige color of rice, but SiHC1 exhibits an inhibitory effect on the coloration of SiHC2 (13:3).
[0051] Example 2: Verification of the InDel marker.
[0052] First, the genetic effects of the two major QTL loci, SiHC2 and SiHC1, in the RIL population were validated using two tightly linked molecular markers, SiHC1-1329 and SiHC2-31. Figure 2 As shown in Table 2, the results indicate that SiHC1 also exhibits an inhibitory effect on SiHC2 blue pigment deposition in the RIL population.
[0053] Table 2 Genotypic and phenotypic analysis of each line in the RIL population.
[0054]
[0055] Secondly, considering the relatively cumbersome operation of the two InDel markers during detection, the reaction system for the two InDel markers, SiHC1-1329 and SiHC2-31, was optimized using multiplex PCR technology. Three primer pairs were set with volume ratios (1:1, 7:3, 3:7) for amplifying SiHC1-1329 and SiHC2-31. The PCR reaction system (operated on ice) is shown in Table 3. The PCR amplification program was 95℃ for 3 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 45 s, for 35 cycles; 72℃ for 10 min, and storage at 4℃. The PCR amplification products were separated by electrophoresis using an 8% non-denaturing polyacrylamide gel, and the bands were analyzed after silver staining.
[0056] Table 3 PCR reaction system
[0057]
[0058] Thirty germplasm materials from the Millet Microcore Germplasm Bank, which differ in color and can be broadly categorized into yellow, white, gray, and green millet (as shown in Table 4), were used. The results showed that when the volume ratio of the primer pair SiHC1-1329 and SiHC2-31 was 7:3, both markers exhibited good resolution in a multiplex PCR system. These markers can be used as a basis for molecular screening in future breeding of green millet varieties. The results are as follows: Figure 3 As shown.
[0059] Table 4 Information on different beige germplasm materials
[0060]
[0061] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0062] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. The application of a reagent kit in predicting the green coloration of millet, characterized in that, The kit contains a primer set consisting of primer pair 1 for amplifying SiHC1-1329 and primer pair 2 for amplifying SiHC2-31; The nucleotide sequences of the upstream and downstream primers in primer pair 1 are shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequences of the upstream and downstream primers in primer pair 2 are shown in SEQ ID NO.5 and SEQ ID NO.
6. The millet mentioned is from the "Black Branch Millet × Changnong 35" RIL population; When the amplification products of the primer set are as shown in SEQ ID NO.1 and SEQ ID NO.2, then it is green millet.
2. A method for predicting the coloration of green millet, characterized in that, The primer set described in claim 1 was used to perform PCR amplification on the genomic DNA of millet to be detected, and the amplification product was obtained. The amplification product was sequenced. When the amplification product is as shown in SEQ ID NO.1 and SEQ ID NO.2, it is green millet. The millet in question is from the "Black Branch Millet × Changnong 35" RIL population.
3. The application of the primer set described in claim 1 in predicting or molecularly assisted screening breeding of green millet color, characterized in that, The millet mentioned is from the "Black Branch Millet × Changnong 35" RIL population; When the amplification products of the primer set are as shown in SEQ ID NO.1 and SEQ ID NO.2, then it is green millet.
Citation Information
Patent Citations
SNP markers linked with color of husked millet, and primers and application thereof
CN106939342A
InDel marker related to corn kernel color and application of InDel marker
CN114480717A