Screening method for nitrogen-efficient utilization of oilseed rape germplasm and application thereof
By detecting the expression levels and biomass of specific nitrogen-responsive genes and using a weighted scoring method, rapeseed germplasm with high nitrogen utilization efficiency was screened, solving the problem of low nitrogen fertilizer utilization efficiency in existing technologies and achieving rapid and accurate germplasm screening and shortening the breeding cycle.
Patent Information
- Application Number
- CN202411518070.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-29
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-10-29
AI Technical Summary
Existing technologies make it difficult to effectively screen rapeseed germplasm with high nitrogen utilization efficiency, resulting in low nitrogen fertilizer utilization efficiency, increased agricultural production costs, and environmental burden.
By detecting the expression levels and aboveground biomass of specific nitrogen-responsive genes BnaA01G0394400ZS, BnaA09G0693100ZS, and BnaC08G0274600ZS, and combining weighted scoring or cluster analysis, rapeseed germplasm with high nitrogen utilization efficiency was screened.
It enables rapid and accurate screening of rapeseed germplasm with high nitrogen utilization efficiency, improves nitrogen fertilizer utilization, shortens the breeding cycle, and has high accuracy and specificity.
Smart Images

Figure CN119391892B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a screening method for nitrogen-efficient utilization of rapeseed germplasm and application thereof. BACKGROUND
[0002] Nitrogen is the most required mineral element for plants and is one of the most important factors for promoting crop yield. Large-scale application of nitrogen fertilizer not only increases the cost of agricultural production, but more importantly, leads to a series of environmental disasters including climate change (ammonia release), soil acidification, and water eutrophication. Therefore, improving the nitrogen utilization efficiency of crops has been an important topic in the research of crop genetic improvement.
[0003] Breeding nitrogen-efficient varieties is the most economical and effective way to improve the nitrogen utilization efficiency of crops. Previous studies have shown that there is a large genetic difference in nitrogen absorption and utilization efficiency among the same crops. Rapeseed is one of the most important oil crops in the world and also a crop with a large amount of nitrogen fertilizer application. However, there is a large difference in nitrogen absorption efficiency among different varieties. Therefore, clarifying the genetic difference in nitrogen utilization efficiency of different germplasm materials and developing molecular markers for nitrogen-efficient utilization are the basis for analyzing the molecular mechanism of nitrogen utilization in rapeseed and creating nitrogen-efficient utilization materials. It is of great significance to improve the nitrogen efficiency of rapeseed and improve the economic and ecological environmental benefits of rapeseed production. SUMMARY
[0004] In order to solve the above technical problems, the application provides a screening method for nitrogen-efficient utilization of rapeseed germplasm and application thereof, so as to improve the screening efficiency and shorten the breeding cycle.
[0005] To achieve the above purpose, the application first provides a screening method for nitrogen-efficient utilization of rapeseed germplasm, which comprises the following steps:
[0006] S1, planting the test seeds of the varieties to be tested in a substrate pot, placing the substrate pot in a tray, adding Hoagland nutrient solution to the tray, dividing the Hoagland nutrient solution into two culture groups of full nitrogen Hoagland nutrient solution and low nitrogen Hoagland nutrient solution, and culturing in a greenhouse for four weeks; in the second week, detecting the expression amount of nitrogen-efficient utilization marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS in the leaves of the full nitrogen culture group and the low nitrogen culture group by real-time fluorescent quantitative PCR technology; and in the fourth week, measuring the nitrogen application increment of the above-ground biomass;
[0007] The sequence of BnaA01G0394400ZS is shown in SEQ ID NO. 1;
[0008] The sequence of BnaA09G0693100ZS is shown in SEQ ID NO. 2;
[0009] The sequence of the BnaC08G0274600ZS is shown as SEQ ID NO. 3;
[0010] S2, screening of nitrogen-efficient Brassica napus germplasm: according to the nitrogen application increment of gene expression and aboveground biomass, comprehensive evaluation is carried out by using weighted scoring method or cluster analysis method, and the varieties meeting the following two conditions are nitrogen-efficient Brassica napus germplasm:
[0011] (1) Eave. = (1.2 x EBnaA01 + 1.4 x EBnaA09 + EBnaC08) / 3, Eave. ≥ 4;
[0012] EBnaA01 = Log2FoldChange (HN / LN), that is, the Log value with 2 as the base number of the gene expression (HN) of BnaA01G0394400ZS in the full nitrogen culture group / the expression (LN) in the low nitrogen culture group;
[0013] EBnaA09 = Log2FoldChange (HN / LN), that is, the Log value with 2 as the base number of the gene expression (HN) of BnaA09G0693100ZS in the full nitrogen culture group / the expression (LN) in the low nitrogen culture group;
[0014] EBnaC08 = Log2FoldChange (HN / LN), that is, the Log value with 2 as the base number of the gene expression (HN) of BnaC08G0274600ZS in the full nitrogen culture group / the expression (LN) in the low nitrogen culture group;
[0015] Eave. is the weighted average expression of the three genes;
[0016] (2) The nitrogen application increment of aboveground biomass > 100%, the nitrogen application increment = (biomass of full nitrogen culture group - biomass of low nitrogen culture group) / biomass of low nitrogen culture group.
[0017] Preferably, the varieties to be tested in step S1 are selected from Brassica napus.
[0018] Preferably, the medium in step S1 is quartz sand and vermiculite in a volume ratio of 1:1, the aboveground part includes leaves and stems, and the biomass is measured by dry weight.
[0019] Preferably, in step S1, the full nitrogen in the full nitrogen Hoagland nutrient solution is applied in the form of potassium nitrate, and the concentration of full nitrogen is 10 mM, and the low nitrogen in the low nitrogen Hoagland nutrient solution is applied in the form of potassium nitrate, and the concentration of low nitrogen is 1 mM.
[0020] As preferred, the conditions for the culture in the greenhouse in step S1 are 25℃, 20,000 lux light intensity for 18h, 6h darkness, and 70% humidity.
[0021] Based on the overall inventive concept, the application also provides an application of the screening method in the nitrogen utilization industry of oilseed rape.
[0022] The screening method of the application is as follows:
[0023] The application provides a method for rapidly screening oilseed rape germplasm with high nitrogen utilization efficiency by detecting the expression of specific nitrogen response genes and aboveground biomass. The screening method is to culture the oilseed rape to be tested using a mixture of quartz sand and vermiculite at a ratio of 1:1 to provide mechanical support and certain water retention and air permeability. The nitrogen treatment is carried out using Hoggland nutrient solution with different nitrogen contents. The correlation between the changes in the expression of nitrogen transport and utilization genes and the biomass is calculated.
[0024] Through transcriptome and population verification, three genes with significantly increased expression in all treatment groups and extremely significantly positively correlated with biomass are found. When the homogenized expression of the three nitrogen-efficient genes in the leaves of oilseed rape is increased by more than 4.00 times (high nitrogen / low nitrogen), and the aboveground biomass is higher than 100% of the control, the oilseed rape belongs to the nitrogen-efficient oilseed rape.
[0025] Compared with the prior art, the application has the following beneficial effects:
[0026] (1) The application finds three genes with significantly increased expression in all treatment groups and extremely significantly positively correlated with biomass through transcriptome and population verification, and determines that these genes are marker genes for efficient nitrogen utilization.
[0027] (2) This detection method combines molecular detection and biomass detection, has high accuracy and strong specificity, and can rapidly screen oilseed rape resources with efficient nitrogen utilization. BRIEF DESCRIPTION OF DRAWINGS
[0028] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiment or prior art description. Obviously, the drawings in the following description are some embodiments of the application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.
[0029] Figure 1 For the expression difference of marker genes in each line in Example 2;
[0030] Figure 2 For the expression difference of marker genes in different lines in Example 3. DETAILED DESCRIPTION
[0031] In order to make the technical problems, technical solutions and advantages to be solved by the present application more clear, the following will be described in detail in conjunction with the drawings and specific embodiments.
[0032] The following examples are used to illustrate the present application, but not to limit the scope of the present application. Modifications or replacements of the methods, steps or conditions of the present application, without departing from the spirit and essence of the present application, all belong to the scope of the present application.
[0033] If not specifically indicated, the technical means used in the examples are the conventional means known to those skilled in the art; if not specifically indicated, the reagents used in the examples are commercially available.
[0034] Example 1
[0035] Screening of marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS
[0036] Transcriptomes of high and low nitrogen efficient lines were determined, and genes (gene pool A) that were differentially expressed in both high and low nitrogen lines and had a greater change in expression (Log2FoldChange(HN / LN)) in the high nitrogen efficient line than in the low nitrogen efficient line were selected.
[0037] Ten high nitrogen efficient and ten low nitrogen efficient lines were selected, and a mixed pool was formed. BSR-seq was performed on the mixed pool to obtain genes (gene pool B) that were significantly up-regulated (Log2FoldChange(HN / LN)≥2) in HN / LN. 2 FoldChange(HN / LN)≥2) in HN / LN.
[0038] The intersection of gene pool A and pool B was obtained to form gene pool C. Specific genes were randomly selected from the gene pool as candidate genes. The expression of the candidate genes was detected by qRT-PCR in materials with known nitrogen utilization efficiency (dry weight increment of aboveground part), and it was determined that the increment of the expression of the gene (Log2FoldChange(HN / LN)) was positively correlated with the increment of dry matter of aboveground part ((HN-LN) / LN), i.e. the greater the increment of the aboveground part, the greater the increment of the expression of the gene. If this condition is met, the gene is determined as a marker gene for high nitrogen utilization efficiency.
[0039] Based on the above screening method, three marker genes were obtained: BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS.
[0040] The sequence of BnaA01G0394400ZS is shown in SEQ ID NO. 1.
[0041] ATGGAAAATTCTGCAAAGACCCAAATTAAATACGTGAAAGCCGAGGATTTTTTCACTTCCGGATTAAGCATCGCGGGAAACACCATAAACCGTGTCGGCTCCAACGTTACCAACGTCAACGTCAACGTCGACAAGATCCCTGGACTCAACACTCTCGGAGTTTCTCTTGTCCGTATTGACTTTGCCCCAGGGGGTCAAAAGAGGAATGATACATTTTCAAGTGAACGTTGGGAGGACGAACGCGGTTGCGTTTGCTGGTCTAGGAAGCCAGAACCCCGGTACAATCACAATCGCGGAAGCTGTTTTTGGTTCGAAGCCTTTGATCATGCCGGAGATTTTAGCGTTTCAGCTGGATGTCAACATGGTTAG (SEQ ID NO. 1);
[0042] The sequence of BnaA09G0693100ZS is shown as SEQ ID NO. 2:
[0043]
[0044] The sequence of BnaC08G0274600ZS is shown as SEQ ID NO. 3:
[0045] ATGACACAGTCTTCTCTATTAGGAGAACTTGAGGTTGAAGTCGAGATCAAATCTCCCGCGGAGAAGTTCTACCACATGTACGCCGGAAGACCGCATCATGTGGCCAAATCCACTCCACGCAATGTGCAGGCATGTGATCTGCACGAGGGAGAATGGGGCGAAGTTGGCAGTATTATATTTTGGAACTACGTTCATGGTATTTATGCTAGAATATTGTATACTATAGTTGGGAATACATGCATAATACTAACGAGGAATTTACCTATTGAATAAAACTCTTGGATCAGACACATAACTTTCTCGTCATTCAAAAAAATACATGCATAATATTGGTGTAATAAGATACAATATTTTGATCGGTAAACGGTTCGTTTTGGGTGTAGATGGACAAGCCAGAGTGGCGAAAGAGAGGATCGAAGTGGTGGAACCTGAGAAGAAAATTGTGAAGTTTAGGGTTTTAGAGGGAGATCTGATGGAAGAGTTCAAGAGCTTTGTGATTACGATTCAGGTAACCCCCAAGCAAGGAGGAAATGGAAGTATTGTGAAGTGGCACTTCGAGTATGAGAAGATTGATGAGAACATTTCTCACCCTGAGACTTTGCTCCCTTTCTTTGCTGATATGATCAAAGAGATCGACGAACACCTCTTGTCCGAGGAATAG (SEQ ID NO. 3);
[0046] Example 2
[0047] Feasibility of population validation marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS and establishment of screening method
[0048] S1, take 10 selfing different rapeseed lines seeds (plant in Hunan Crop Institute test field), using 75% ethanol to disinfect the surface of the seeds for 2 min, then soak in water for 24 hours. Using 5% ethanol to disinfect the surface of the seeds for 2 min, then soak in water for 24 hours.
[0049] S2, plant the treated seeds in the mixed quartz sand and vermiculite (1:1, V / V) square pots (10 cm x 10 cm), 2 seeds in each square pot, 3 square pots for each material and each treatment group. After the seeds germinate in the square pots, thinning is performed, and single plants with uniform growth are retained.
[0050] S3, seedling cultivation: place the planted square pots in a tray, the tray (15 cm) is higher than the square pot, add Hoagland nutrient solution to the tray, the nitrogen concentration in the nutrient solution of the high nitrogen (HN) treatment group is 10 mM, the nitrogen concentration in the nutrient solution of the low nitrogen (LN) treatment group is 1 mM, add the nutrient solution to about 5 cm, and place 3 x 5 = 15 square pots in the tray. Cover the square pots with the liquid surface to reduce evaporation.
[0051] S4, cultivate in a greenhouse environment, the environmental conditions are 25°C, 18h / 6h light / dark, 70% humidity, and the light intensity is 20,000 lux, replace the culture solution once a week, when replacing the culture solution, wash the tray with tap water, then rinse with ultrapure water, and then add the newly prepared Hoagland nutrient solution.
[0052] S5, gene expression detection: collect rapeseed leaf samples in the second week of cultivation, use a puncher to take 5 mm diameter leaf discs at four positions (upper left, lower left, upper right, and lower right) of the second leaf, immediately place in liquid nitrogen, extract RNA, and reverse transcribe into cDNA, detect the expression of specific nitrogen response genes BnaA01G0394400ZS (BnaA01), BnaA09G0693100ZS (BnaA09), and BnaC08G0274600ZS (BnaC08) by real-time fluorescent quantitative PCR technology, and BnaC02G0037200ZS as an internal reference; compare the gene expression of the HN treatment group and the LN treatment group, and calculate the Eave. value:
[0053] Eave. = (1.2 x EBnaA01 + 1.4 x EBnaA09 + EBnaC08) / 3;
[0054] where EBnaA01 = Log2FoldChange (HN / LN), which is the logarithmic value with 2 as the base of the BnaA01G0394400ZS gene expression (HN) in the high nitrogen culture group and the expression (LN) in the low nitrogen culture group;
[0055] EBnaA09 = Log2FoldChange (HN / LN), that is, the logarithm value with 2 as the base number of the BnaA09 G0693100ZS gene expression amount (HN) of the full nitrogen culture group / the expression amount (LN) of the low nitrogen culture group;
[0056] EBnaC08 = Log2FoldChange (HN / LN), that is, the logarithm value with 2 as the base number of the BnaC08 G0274600ZS gene expression amount (HN) of the full nitrogen culture group / the expression amount (LN) of the low nitrogen culture group;
[0057] Eave. is the weighted average expression amount of the 3 genes;
[0058] S6, nitrogen increment determination: in the fourth week of culture, rapeseed plants were harvested, and the rhizome nodes were cut off at the time of harvesting. The aboveground parts were placed in 10 mL centrifuge tubes, and iron wires were used to burn 2-3 holes in the tube cap to facilitate water vapor discharge. The samples were then placed in a centrifuge tube rack and dried in an oven for 72 h. The weight was then determined as the dry weight. The nitrogen increment formula is: nitrogen increment = (HN biomass - LN biomass) / LN biomass.
[0059] This example determined the expression amounts of BnaA01G0394400ZS (BnaA01), BnaA09G0693100ZS (BnaA09) and BnaC08G0274600ZS (BnaC08) genes in a total of 10 strains, as shown in Table 1: Figure 1 The dry matter mass determination results are shown in Table 1:
[0060] Table 1 Dry weight of aboveground parts of different strains under different nitrogen treatments
[0061]
[0062]
[0063] Analysis Figure 1 According to the results in Table 1, it was found that the nitrogen increment index and the molecular index had a good linear relationship, and they could complement each other. BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS were determined as high-efficiency nitrogen utilization screening marker genes, which had high accuracy and convenience. The screening method for rapeseed germplasm with high-efficiency nitrogen utilization was set as:
[0064] When conditions A and B are met at the same time, it is a rapeseed germplasm with high-efficiency nitrogen utilization:
[0065] A: In the second week, the Log2FC ((HN expression level) / (LN expression level)) of the marker genes BnaA01G0394400ZS (BnaA01), BnaA09G0693100ZS (BnaA09), and BnaC08G0274600ZS (BnaC08) was measured, and the following conditions were met:
[0066] Eave.≥4
[0067] Eave. = (1.2 × EBnaA01 + 1.4 × EBnaA09 + EBnaC08) / 3, where EBnaA01 = Log2FoldChange
[0068] (HN / LN) is the logarithm of the expression level (HN) of the BnaA01G0394400ZS gene in the all-nitrogen culture group to the expression level (LN) in the low-nitrogen culture group, with the base 2.
[0069] EBnaA09 = Log2FoldChange(HN / LN), which is the logarithm of the expression level (HN) of the BnaA09G0693100ZS gene in the all-nitrogen culture group / the expression level (LN) in the low-nitrogen culture group, with the base 2.
[0070] EBnaC08 = Log2FoldChange(HN / LN), which is the logarithm of the expression level (HN) of the BnaC08G0274600ZS gene in the all-nitrogen culture group / the expression level (LN) in the low-nitrogen culture group, with the base 2.
[0071] Eave. represents the weighted average expression level of the three genes.
[0072] B: In the fourth week, the aboveground biomass was measured. The nitrogen application increment was greater than 100%. The nitrogen application increment formula is: nitrogen application increment = (HN biomass - LN biomass) / LN biomass.
[0073] Example 3
[0074] The nitrogen use efficiency of the known nitrogen-efficient line YL112 and the known nitrogen-inefficient line YL371 was determined using the method provided in Example 2. The expression levels of marker genes were measured in the second week using the method provided in Example 2. The results are as follows: Figure 2 As shown in Table 2, the dry matter mass was measured in the fourth week.
[0075] Table 2. Dry weight of aboveground parts of YL112 and YL371 under different nitrogen treatments.
[0076] HN dry weight (g) LN dry weight (g) Nitrogen application increment YL112 (high efficiency) 1.042909761 0.430718954 1.421323119 YL371 (low efficiency) 0.661197053 0.452036199 0.462708196
[0077] The analysis of the above results shows that the screening method designed in the scheme can well screen out nitrogen efficient utilization materials, and there are significant differences in expression amount and biomass data, and the screening method is effective.
[0078] The above only describes the preferred embodiments of the present application patent, and the protection scope of the present application patent is not limited to the above-mentioned embodiments. Improvements and changes made by those skilled in the art without departing from the technical concept of the present application patent should also be considered as the protection scope of the present application patent.
Claims
1. A method for screening nitrogen-efficient rapeseed germplasm, characterized in that, Includes the following steps: S1. The test seeds of the varieties to be tested were planted in substrate pots, the substrate pots were placed in trays, and Hoagland nutrient solution was added to the trays. The culture groups were divided into two groups: one with full nitrogen Hoagland nutrient solution and the other with low nitrogen Hoagland nutrient solution. The culture was carried out in the greenhouse for four weeks. In the second week, the expression levels of nitrogen-efficient use marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS in the leaves of the full nitrogen culture group and the low nitrogen culture group were detected by real-time fluorescence quantitative PCR. In the fourth week, the nitrogen application increment of the aboveground biomass was measured. The sequence of BnaA01G0394400ZS is shown in SEQ ID NO. 1; The sequence of BnaA09G0693100ZS is shown in SEQ ID NO. 2; The sequence of BnaC08G0274600ZS is shown in SEQ ID NO. 3; S2. Screening for nitrogen-efficient rapeseed germplasm: Based on gene expression levels and nitrogen application increments in aboveground biomass, a comprehensive evaluation is conducted using a weighted scoring method or cluster analysis. Varieties that simultaneously meet the following two conditions are considered nitrogen-efficient rapeseed germplasm: (1) Eave.=(1.2×EBnaA01+1.4×EBnaA09+EBnaC08) / 3, Eave.≥4; Where EBnaA01 = Log2FoldChange (HN / LN), which is the logarithm of the expression level (HN) of the BnaA01G0394400ZS gene in the all-nitrogen culture group / the expression level (LN) in the low-nitrogen culture group, with the base 2. EBnaA09 = Log2FoldChange (HN / LN), which is the logarithm of the expression level (HN) of the BnaA09G0693100ZS gene in the all-nitrogen culture group / the expression level (LN) in the low-nitrogen culture group, with the base 2. EBnaC08 = Log2FoldChange (HN / LN), which is the logarithm of the expression level (HN) of the BnaC08G0274600ZS gene in the all-nitrogen culture group / the expression level (LN) in the low-nitrogen culture group, with the base 2. Eave. represents the weighted average expression level of the three genes; (2) The nitrogen application increment of the aboveground biomass is >100%, wherein the nitrogen application increment = (biomass of the total nitrogen culture group - biomass of the low nitrogen culture group) / biomass of the low nitrogen culture group; In step S1, the variety to be tested is selected from Brassica napus.
2. The screening method according to claim 1, characterized in that, The substrate in step S1 is a mixture of quartz sand and vermiculite in a volume ratio of 1:
1. The aboveground parts include leaves and stems, and the biomass is measured by dry weight.
3. The screening method according to claim 1, characterized in that, In step S1, the total nitrogen in the Hogland nutrient solution is applied using potassium nitrate at a concentration of 10 mM, and the low nitrogen in the Hogland nutrient solution is applied using potassium nitrate at a concentration of 1 mM.
4. The screening method according to claim 1, characterized in that, The conditions for cultivation in the greenhouse in step S1 are 25°C, 20,000 lux light intensity for 18 hours, 6 hours in darkness, and 70% humidity.
5. The application of the screening method as described in any one of claims 1-4 in the rapeseed nitrogen utilization industry.
Citation Information
Patent Citations
Method for improving low nitrogen stress tolerance and nitrogen absorption and accumulation of rape
CN111394496A
Application of brassica napus BnaA01.SnRK1.1 gene
CN116004708A