Indel marker for identifying dry matter yield of pennisetum americanum and application of indel marker

Abstract

The invention provides an indel marker for identifying the dry matter yield of Pennisetum americanum and application of the indel marker, and relates to a variation site related to the dry matter yield of the Pennisetum americanum, in particular to an SV site PGLA1534527 for the dry matter yield of the Pennisetum americanum, and the nucleotide sequence of the SV site PGLA1534527 is shown as SEQ ID No: 1. The invention further provides a detection primer of the site PGLA1534527 in the pennisetum americanum. By utilizing the method provided by the invention, the accuracy of predicting the dry matter yield per mu by the Pennisetum americana can be improved within a certain limit, so that Pennisetum americana materials or strains with high dry matter yield sites can be quickly screened out for breeding.

Description

Technical Field

[0001] The invention relates to molecular biology and crop genetic breeding, and in particular to an SV variation site related to the dry matter yield of Pennisetum americanum and application of the site. Background Art

[0002] Dry matter refers to the material content and composition of plants in a dry state, including the concentration and proportion of nutrients such as cellulose, lignin, protein, and carbohydrates. Dry matter is a key indicator for measuring plant production performance, nutritional value, and economic benefits, and is particularly important in grassland agriculture and forage cultivation. Plants with high dry matter not only provide more nutrients, but also improve soil quality and ecosystem stability. Plants with high dry matter usually have a higher accumulation of nutrients, such as protein and carbohydrates. These nutrients are essential for plant growth and development, and can support plant growth and physiological activities under adverse conditions. At the same time, plants with higher dry matter can more efficiently convert photosynthesis products into dry matter, thereby increasing overall biomass, and the increase in dry matter can enhance the plant's resistance to environmental stresses (such as drought, salinity, and disease). For example, plants with higher dry matter usually have stronger water retention and disease resistance, and can better adapt to harsh environmental conditions.

[0003] In forage cultivation, dry matter quality directly affects the nutritional value of forage. Forage with high dry matter quality usually contains higher protein and energy, which is essential for animal health and production performance. High-quality forage can increase the growth rate, milk production and meat quality of livestock. And plant residues with high dry matter quality have a positive effect on soil fertility. Plant residues release a large amount of organic matter and nutrients during decomposition, which can improve soil structure, increase soil organic matter content, and promote microbial activity, thereby improving soil productivity. It can also enhance the stability of the ecosystem. For example, good vegetation cover can prevent soil erosion, reduce soil and water loss, and maintain biodiversity. Dry matter quality has a profound impact on plant growth, nutritional value and ecosystem function. Therefore, in agricultural and ecological environmental management, paying attention to the improvement of dry matter quality has important practical significance and application prospects.

[0004] Pennisetum americanum is an important warm-season annual grass forage and one of the six major cereal crops in the world. It has the characteristics of high protein, high seed, high grass yield and strong stress resistance. It can grow and bear fruit normally in hot and arid areas and areas with poor land. Therefore, it is considered to be a high-quality forage resource and potential energy plant that can be planted in arid areas such as northwest my country. At present, the global planting area of ​​Pennisetum americanum is about 29 million hm2 (2017). In recent years, the per capita available land has decreased. How to harvest more high-quality forage on limited land to meet the survival needs of a large number of livestock has become the key to alleviating this contradiction. Among them, the amount of dry matter is a very important indicator and has received widespread attention from scientists. In-depth analysis of the molecular mechanism that affects the regulation of dry matter in plants will help the selection and breeding of new forage varieties and provide support for grassland animal husbandry.

[0005] In recent years, with the development of a large number of molecular markers and the rapid development of bioinformatics, the application of association analysis methods to discover plant quantitative trait genes has become one of the hot spots in international plant genomics research. Association analysis is based on linkage disequilibrium (LD), which is a non-random combination of alleles at different gene loci. It is a method for directly analyzing phenotypic and genotypic variations and further locating certain genes. However, this method has certain disadvantages because it mainly analyzes a single reference genome and single nucleotide polymorphisms (SNPs). Plant species have high polymorphism, and the reference genome of a single individual can no longer cover all the genetic information of the species. If only a single reference genome is used for studies such as genetic domestication variation, a lot of meaningful genetic code information may be lost because many unique sequences are not on the reference genome. At the same time, with the continuous development of genome sequencing technology, the application of pan-genome has become increasingly widespread. Pan-genome is the general term for all genes of a species, which has great advantages in studying different subspecies or variants with huge differences in the same species. In addition to providing SNPs (single nucleotide polymorphisms, SNPs), pan-genomes also provide a large amount of SV (genomic structural variation, Structural variation, referred to as SV) information. SV has a greater impact on the genome than SNP and can be better used to explain the characteristics of agronomic trait population diversity. Summary of the invention

[0006] The invention provides an SV variation marker for identifying the dry matter yield of Pennisetum americanum, characterized in that the marker is located at a structural variation site of chromosome 5, and its sequence is shown in SEQ ID No:1.

[0007] The invention provides a method for detecting dry matter yield of Pennisetum americanum, comprising the following steps: detecting a genotype based on a PGLA1534527 site in a Pennisetum americanum genome; when the PGLA1534527 site is present, the Pennisetum americanum to be tested is a candidate germplasm with a low dry matter yield characteristic; and when the PGLA1534527 site is missing, the Pennisetum americanum to be tested is a candidate germplasm with a high dry matter yield characteristic.

[0008] The present invention provides a primer set for identifying the target genotype of Pennisetum americanum:

[0009] PGL1534527_5:TGGGTCGTCCACCAAACTAA TACAGTGTCTTGTGTTGGTGTG

[0010] The present invention also provides a method for identifying the dry matter yield of Pennisetum americanum, comprising the steps of amplifying the PCR products of the above 11 corresponding primers:

[0011] (1) Extraction of Pennisetum genomic DNA.

[0012] (2) Design specific primers for the PGLA1534527 site for subsequent PCR amplification.

[0013] (3) Using the extracted genomic DNA as a template, perform PCR amplification using the designed specific primers to ensure that the amplified fragment contains the SV site. Optimize PCR conditions, such as annealing temperature and number of cycles, to ensure amplification efficiency and specificity. Use the PCR amplification product for genotyping.

[0014] (4) Collect and analyze the genotype data of germplasm, focusing on the genotype distribution of the SV locus; perform correlation analysis between the genotype data and the dry matter yield trait data to determine the relationship between different genotypes and dry matter yield.

[0015] The present invention can also provide a genotype product for detecting the PGLA1534527 site in the Pennisetum americanum genome. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Distribution of dry matter yield among different genotypes.

[0017] Figure 2 : PCR detection of PGLA1534527_5. In the figure, SEQ NO.1 is genotype I, and SEQ NO.2 is genotype II. DETAILED DESCRIPTION

[0018] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are based on conventional experimental conditions.

[0019] Example 1: PGLA1534527 is an SV associated with Pennisetum americanum dry matter yield

[0020] 1. Basic information of PGLA1534527 variant site

[0021] Through pan-genome sequencing analysis of Pennisetum fasciatum germplasm, a gene locus related to the dry matter yield of Pennisetum fasciatum was obtained, named PGLA1534527. This mutation site is located on chromosome 5 of the PI537069 genome, downstream of gene PMA5G01397.1, and is a large fragment deletion mutation. Its basic information is shown in Table 1.

[0022] Table 1. Basic information of PGLA1534527 variant sites

[0023] SV Marker chromosome Serial Number Chromosome location PGLA1534527 5 SEQ ID No:1 23，145，977

[0024] Example 2: Genotype detection and dry matter yield determination of Pennisetum fasciatum germplasm

[0025] The dry matter yield of 215 Pennisetum gracilis germplasms shown in Table 2 was detected. Combining the sequencing results of various plasmid genomes with the reference genome comparison, the results show (Table 2) that the varieties of Pennisetum gracilis with the PGLA1534527 locus have the characteristics of low dry matter yield, which is genotype I, and the varieties lacking the PGLA1534527 locus have the characteristics of high dry matter yield, which is genotype II. All varieties of Pennisetum gracilis of the present invention can be obtained from the germplasm collection of Sichuan Agricultural University.

[0026] Table 2. Genotypes of 215 Pennisetum fasciatum accessions based on the PGLA1534527 locus

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035] The results in Table 2 are as follows Figure 1The results showed that 142 varieties of 215 Pennisetum gracilis germplasms were of type I genotype based on the PGLA1534527 locus, and the average dry matter yield of these 117 germplasms was 3695.85; 73 germplasm varieties lacked the PGLA1534527 locus and were of type II genotype, with an average dry matter yield of 4144.99. This indicated that the type II genotype was a genotype with high dry matter yield, and the discovery of this locus provided a new research direction for the study and breeding of dry matter quality of Pennisetum gracilis.

[0036] Example 3: PCR detection based on PGLA1534527_5 marker combination

[0037] The genotype of Pennisetum fasciatum germplasm based on the PGLA1534527 locus was tested. Randomly select Pennisetum fasciatum varieties for testing (based on the genotype of PGLA1534527 locus as type I or genotype as type II), randomly select the fifth group of markers, and perform PCR testing. Considering the CG content and Tm value of the primers, the primers were combined, and the primer sequences are as follows:

[0038] Table 3. Primer sequences for detecting variant sites of PGLA1534527

[0039]

[0040] The results are as follows Figure 2 As shown in the figure, the PCR detection based on the marker combination PGLA1534527_5 successfully identified the target genotype in the Pennisetum truncatum samples, showing good specificity and stability. This marker combination can be used as an effective tool for identifying the grain yield-related traits of Pennisetum truncatum and has application potential in high-yield breeding.

Claims

1. A marker for identifying the dry matter yield of Pennisetum americanum, characterized in that: It is located at the structural variation site PGLA1534527 on chromosome 5, and its sequence is shown in SEQ ID No:

1.

2. A method for detecting the dry matter yield of Pennisetum americanum, characterized in that: The method comprises the following steps: detecting a genotype based on a PGLA1534527 site in a Pennisetum fasciatum genome, wherein the sequence of the site is shown in SEQ ID No: 1; when the PGLA1534527 site is present, the Pennisetum fasciatum to be tested is a candidate germplasm with a low dry matter yield characteristic; and when the PGLA1534527 site is missing, the Pennisetum fasciatum to be tested is a candidate germplasm with a high dry matter yield characteristic.

3. A set of primers for identifying a target gene of Pennisetum americanum based on the markers of claim 1, characterized in that: The primer is PGL1534527_5: TGGGTCGTCCACCAAACTAA TACAGTGTCTTGTGTTGGTGTG.

4. A method for identifying the dry matter yield of Pennisetum americanum based on the primers described in claim 3, characterized in that: Follow these steps: (1) Extracting Pennisetum genomic DNA; (2) Design specific primers for the PGLA1534527 site for subsequent PCR amplification; (3) Using the extracted genomic DNA as a template, PCR amplification was performed using the designed specific primers to ensure that the amplified fragment contained the PGLA1534527 site. The PCR conditions were optimized to ensure amplification efficiency and specificity, and the PCR amplification products were used for genotyping.

5. A genotype product for detecting the PGLA1534527 locus in the genome of Pennisetum americanum.

Images