InDel Molecular Markers for Identifying Yangguang No. 1 Orange Pomelo and Their Applications

Abstract

The present invention discloses an InDel molecular marker for identifying Sunshine No. 1 orange pomelo and its application. The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No. 1. The present invention successfully screens out the InDel molecular marker for identifying Sunshine No. 1 orange pomelo, develops a pair of primer pairs or a kit based on the InDel molecular marker, and can reduce the breeding workload and ensure the correctness of the seedling variety when applying it to the identification of Sunshine No. 1 orange pomelo seedlings.

Description

Technical Field

[0001] The present invention relates to the technical field of citrus molecular markers, and in particular to an InDel molecular marker for identifying Sunshine No. 1 tangerine and grapefruit and an application thereof. Background Art

[0002] Sunshine No. 1 tangerine and pomelo is a hybrid of Ehime 28 as the female parent and Chunxiang tangerine and pomelo as the male parent, and obtained the new plant variety rights in 2021. Sunshine No. 1 tangerine and pomelo has orange flesh, very thin and transparent valve membrane, crisp and tender flesh, strong flavor, sweet and sour taste, seedless, excellent quality, and extremely durable in storage and transportation after harvest. It is a "newcomer" among citrus varieties in recent years.

[0003] Sunshine No. 1 pomelo is very popular in the market due to its excellent quality and storage resistance, and the demand for seedlings is far greater than the supply of seedlings. Sunshine No. 1 pomelo belongs to the category of hybrid citrus in the citrus classification. Its leaves are very similar to those of varieties such as Nashi, Harumi, and Haruka. It is difficult to distinguish them from the morphology during the seedling stage. This gives some merchants an opportunity to pass off other hybrid citrus varieties as Sunshine No. 1 pomelo, which seriously damages the rights and interests of growers. If DNA molecular markers can be used to achieve early selection during the seedling stage, it will greatly reduce the losses of growers and reduce the occurrence of "inferior products as good ones" and seedling confusion. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an InDel molecular marker for identifying Sunshine No. 1 pomelo and its application. The present invention can effectively distinguish Sunshine No. 1 pomelo from other citrus varieties, and provide a simple, fast and effective auxiliary breeding method for the identification of early varieties of Sunshine No. 1 pomelo seedlings.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The present invention provides an InDel molecular marker for identifying Sunshine No. 1 pomelo, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID No.1.

[0007] The present invention also provides a primer pair for obtaining the above-mentioned InDel molecular marker, wherein the primer pair is:

[0008] Forward primer F: AGTTGTGTAGTGTTCAGGACGTAG,

[0009] Reverse primer R: CAAGTGTGATGGAGTCCTGATAGA.

[0010] The present invention also provides an application of the primer pair in identifying Sunshine No. 1 pomelo or in preparing a kit for identifying Sunshine No. 1 pomelo.

[0011] The present invention also provides a kit for identifying Sunshine No. 1 orange-grapefruit, and the kit contains the primer pair described above.

[0012] The present invention also provides a method for identifying Sunshine No. 1 orange-grapefruit, comprising the following steps:

[0013] 1) Extract genomic DNA of the sample to be tested.

[0014] 2) Using the above genomic DNA as a template, perform PCR amplification with the primer described in claim 2 or the kit described in claim 4 to obtain a PCR product.

[0015] 3) Detect the PCR product by electrophoresis, and the test results are analyzed as follows:

[0016] When a band 1 of 1231 bp is shown, and the band 1 contains an InDel molecular marker (the nucleotide sequence is as shown in SEQ ID No. 1), then the variety to be tested is Sunshine No. 1 orange-grapefruit.

[0017] Alternatively, when any one or two small fragment bands smaller than 500 bp are shown, the variety to be tested is other citrus varieties.

[0018] Further, in the step 2), the PCR amplification system is as follows:

[0019] Mix solution 7 μl Forward primer F (10 mmol / L) 0.3 μl Reverse primer R (10 mmol / L) 0.3 μl Genomic DNA 1.5 μl <![CDATA[dd H2O]]> 5.9 μl Total 15 μl

[0020] The PCR amplification program includes: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and the reaction is carried out for 35 cycles; extension at 72 °C for another 5 min.

[0021] When using the primer pair or kit of the present invention for variety identification, by using PCR amplification and agarose gel electrophoresis, when the primer with a clear gel image and a size exactly consistent with the prediction is retained (i.e., a band of 1231 bp, containing an InDel molecular marker, and its nucleotide sequence is as shown in SEQ ID No. 1), then the variety to be tested is Sunshine No. 1 orange-grapefruit; when one or two bands smaller than 500 bp are visible in the primer amplification, it indicates that the variety to be tested is other citrus varieties, and there are size differences that can be resolved in the gel image, and thus it can be determined as a marker with good effects that can be used. The agarose gel electrophoresis of the present invention preferably uses an agarose gel with a mass percentage of 2%, a voltage of 120 V, and electrophoresis for 15 - 20 min.

[0022] The present invention also provides an application of the above primer or the above kit in the early identification of Sunshine No. 1 orange-grapefruit.

[0023] The present invention also provides an application of the primer or the kit in tangerine and pomelo breeding.

[0024] The primer pair or kit of the present invention can be applied to the early identification of Sunshine No. 1 tangerine pomelo, and the young leaves of young trees can be used, so the genomic DNA is preferably extracted from young leaves. The present invention does not specifically limit the method for extracting the genomic DNA, and preferably uses the CTAB method or the kit method.

[0025] Beneficial effects of the present invention:

[0026] The present invention successfully screened and obtained an InDel molecular marker for identifying Sunshine No. 1 pomelo, and developed a pair of primer pairs or a kit based on the InDel molecular marker. By using the identification of Sunshine No. 1 pomelo seedlings, the breeding workload can be reduced to ensure the correctness of the seedling variety. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The electrophoresis diagram of PCR products of 48 samples to be tested is shown in Figure 2.

[0028] Among them, 1 represents 439 orange; 2 represents Yuan Xiaochun; 3 represents seedless orange; 4 represents Asumimi; 5 represents Ehime 68; 6 represents Ehime 46; 7 represents Haruhime; 8 represents Ehime 28 (Sunshine No. 1 tangerine and grapefruit female parent); 9 represents Kiyomi; 10 represents Sunshine No. 1 tangerine and grapefruit; 11 represents Amakusa; 12 represents Tsu no Kaori; 13 represents Yang Kaori; 14 represents Nishi no Kaori; 15 represents Ganping; 16 represents Golden Autumn Sugar Mandarin; 17 represents Qiu Hui; 18 represents Nichi Hui; 19 represents W. Murcott; 20 represents Wogan; 21 represents Shiranui; 22 represents Harumi; 23 represents Ehime 34; 24 represents Haru Kaori tangerine and grapefruit (Sunshine No. 1 25 represents Ou orange; 26 represents Mandarin orange; 27 represents Mantouhong Zhu orange; 28 represents Rinan No. 1; 29 represents Four Seasons orange; 30 represents Hongguang; 31 represents Kishu; 32 represents Xingjin; 33 represents Miguang; 34 represents Zhuhong orange; 35 represents Yamashita red; 36 represents Sandang orange; 37 represents Oita No. 1; 38 represents Nangan No. 20; 39 represents Shuangjin No. 1; 40 represents Dapu No. 5; 41 represents Xinyu Mandarin orange; 42 represents Sanhu red orange; 43 represents Sanhu Huahong; 44 represents Ponkan; 45 represents Zhuju; 46 represents Jian orange; 47 represents Yangxiao 26; 48 represents Miyakawa. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0030] Example 1

[0031] Based on the whole-genome resequencing results, compared with the genomes of other varieties, a unique fragment with good polymorphism was found at 18,687,885 bp on chromosome 6 in the Sunshine No. 1 orange-grapefruit. This fragment was named the InDel molecular marker, and its nucleotide sequence is shown in SEQ ID No. 1:

[0032]

[0033] Example 2

[0034] The above-mentioned InDel molecular marker design primer pair:

[0035] Forward primer F: AGTTGTGTAGTGTTCAGGACGTAG, as shown in SEQ ID No. 2;

[0036] Reverse primer R: CAAGTGTGATGGAGTCCTGATAGA, as shown in SEQ ID No. 3;

[0037] The primers synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. were used to perform PCR amplification with the genome of Sunshine No. 1 orange grapefruit as the template. When the PCR product was detected by electrophoresis and showed a single band of 1231 bp, the band contained the InDel molecular marker (nucleotide sequence as shown in SEQ ID No. 1), and the nucleotide sequence of the band was as shown in SEQ ID No. 4:

[0038]

[0039] Example 3

[0040] A kit for identifying Sunshine No. 1 orange pomelo contains the primer pair of Example 2 above. The method for identifying Sunshine No. 1 orange pomelo based on the kit includes the following steps:

[0041] 1) Extract the genomic DNA of the sample to be tested,

[0042] 2) Using the above genomic DNA as a template, perform PCR amplification with the primer pair; obtain the PCR product; wherein,

[0043] The system for PCR amplification is as follows:

[0044]

[0045]

[0046] The procedure for PCR amplification includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and the reaction is carried out for 35 cycles; extension at 72°C for another 5 min;

[0047] 3) Electrophoresis detection of the PCR product (using a 2% agarose gel by mass percentage, voltage 120V, electrophoresis for 15 - 20 min), and the analysis of the detection results is as follows:

[0048] When a 1231bp band 1 is shown, and the band 1 contains an InDel molecular marker (the nucleotide sequence is as shown in SEQ ID No.1), then the variety to be tested is Sunshine No. 1 orange pomelo.

[0049] When any small fragment band or two small fragment bands are shown, the variety to be tested is other citrus varieties; among them, the two small fragment bands are a 298bp band 2 and a 350bp band 3 respectively;

[0050] The nucleotide sequence of the 298bp band 2 is as shown in SEQ ID No.5:

[0051] AGTTGTGTAGTGTTCAGGACGTAGAAAGTTTTGTTCAGGATTTTGGCTAACCGCACCATTTTTTTTTTCAAAAATCATTTCACAAGATAAATGCCCCATTTTGGATTTTCAAAAAATTAAAATAATACTTTTGATTTTGGTCAAACACGGTCAAAATAAAATTCCTATCATAATATTTGTGACTGAGTTAATTACTATCATACACATATTATAAATTCTTGATATATAAATATTCTATCACAAGTACATCATTAATCGTTTGATAGACAACAATTCTATCAGGACTCCATCACACTTG;

[0052] The nucleotide sequence of band 3 with a size of 350 bp is shown in SEQ ID No. 6:

[0053] AGTTGTGTAGTGTTCAGGACGTAGAAAGTTTTGTTCAGGATTTTGGCTAACCGCACCATTTTTTTTTTCAAAAATCATTTCACAAGATAAATGCCCCATTTTGGATTTTCAAAAAATTAAAATAATACTTTTGATTTTGGTCAAACACGGTCAAAATAAAATTCCTATCATAATATTTGTGACTGAGTTAATTACTACATGGTCAAAATAAAATTCCTATCATAATATTTTTGACTGAGTTAATTACTATCATACACATATTATAAATTCTTGATATATAAATATTCTATCACAAGTACATCATTAATCGTTTGATAGACAACAATTCTATCAGGACTCCATCACACTTG。

[0054] Example 4

[0055] The kit of Example 3 was used to detect Sunshine No. 1 orange-grapefruit and other citrus varieties. The specific steps are as follows:

[0056] 1) Extract the genomic DNA of the leaves of Sunshine No. 1 orange-grapefruit, other hybrid citrus varieties, and common citrus.

[0057] 2) Using the above genomic DNA as a template, perform PCR amplification with primer pairs to obtain PCR products. Among them,

[0058] The system for PCR amplification is as follows:

[0059] Mix solution 7 μl Forward primer F (10 mmol / L) 0.3 μl Reverse primer R (10 mmol / L) 0.3 μl Genomic DNA 1.5 μl <![CDATA[dd H2O]]> 5.9 μl Total 15 μl

[0060] The procedure of PCR amplification includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles of reaction; re-extension at 72°C for 5 min;

[0061] 3) Electrophoresis detection of PCR products (using 2% agarose gel by mass percentage, voltage 120 V, electrophoresis for 15 - 20 min), and the analysis of detection results is as follows:

[0062] The results are as Figure 1 shown: The bands of PCR products in other lanes are all bands of 298 bp and / or 350 bp, which correspond to other varieties (including hybrid citrus varieties and common citrus), and only in lane 10, a 1231 bp fragment band is amplified, which is Sunshine No. 1 orange-grapefruit, so it can be determined as a marker with good effect that can be used.

[0063] Other parts not described in detail are all prior arts. Although the above embodiments have made a detailed description of the present invention, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. Use of a kit for identifying Sunshine No. 1 orange pomelo in the early identification of Sunshine No. 1 orange pomelo, characterized in that: The kit contains a pair of primer pairs, and the primer pairs are as follows: Forward primer F: AGTTGTGTAGTGTTCAGGACGTAG, Reverse primer R: CAAGTGTGATGGAGTCCTGATAGA; The electrophoresis identification standard of the kit is as follows: When a 1231bp band is shown, and this band 1 contains an InDel molecular marker, then the variety to be tested is Sunshine No. 1 orange pomelo; among them, the nucleotide sequence of this band 1 is as shown in SEQ ID No. 4, and the nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No. 1; Or, when a 298bp band 2 and / or a 350bp band 3 are shown, the variety to be tested is other citrus varieties; among them, the nucleotide sequence of the 298bp band 2 is as shown in SEQ ID No. 5: the nucleotide sequence of the 350bp band 3 is as shown in SEQ ID No.

6.

2. A method for identifying Sunshine No. 1 orange pomelo, characterized in that: It includes the following steps: 1) Extract the genomic DNA of the sample to be tested, 2) Using the above genomic DNA as a template, perform PCR amplification with the kit described in claim 1; obtain a PCR product; among them, the primer pairs in the kit are: Forward primer F: AGTTGTGTAGTGTTCAGGACGTAG, Reverse primer R: CAAGTGTGATGGAGTCCTGATAGA; 3) Electrophoresis detection of the PCR product, and the detection results are analyzed as follows: When a 1231bp band is shown, and this band 1 contains an InDel molecular marker, then the variety to be tested is Sunshine No. 1 orange pomelo; among them, the nucleotide sequence of this band 1 is as shown in SEQ ID No. 4, and the nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No. 1; Or, when a 298bp band 2 and / or a 350bp band 3 are shown, the variety to be tested is other citrus varieties; among them, the nucleotide sequence of the 298bp band 2 is as shown in SEQ ID No. 5: the nucleotide sequence of the 350bp band 3 is as shown in SEQ ID No.

6.

3. The method according to claim 2, wherein: In the step 2), the PCR amplification system is as follows: The PCR amplification program includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and the reaction is carried out for 35 cycles; then extension at 72°C for 5 min.

Images