Method for promoting sexual maturity of fish

Abstract

Provided is a method for promoting sexual maturity in fish, comprising a step for inhibiting functional expression of at least one of a leptin receptor and leptin in fish. The present invention addresses the problem of providing a method for promoting sexual maturity of a fish in order to obtain an individual fish capable of ovulating or spermising at an age of 1 more than under natural or conventional culture conditions.

Description

Technical Field

[0001] This specification discloses a method for promoting sexual maturity of fish. Background Art

[0002] Fish are supplied to the market through natural aquatic resources or aquaculture. It is reported that female fish, such as Japanese flounder, usually take more than 2 years to become sexually mature adults (Non-Patent Documents 1 and 2).

[0003] Prior art literature

[0004] Non-patent literature

[0005] Non-patent document 1: Takakazu Ozawa et al.; Nippon Suisan Gakkaishi 62(5), 733-739 (1996)

[0006] Non-patent document 2: Yamamoto Masayuki et al. Perfume Trial Research Report No. 11, 1-15 (2010) Summary of the invention

[0007] Problem that the invention aims to solve

[0008] If the sexual maturity of fish can be advanced under fish farming conditions, the fish yield under farming conditions can be increased and the farming cost can be reduced. In addition, the generation cycle, which is the rate-limiting step in breeding, can be shortened, thereby reducing the time and development cost required for producing superior varieties.

[0009] However, according to Non-Patent Document 1, very few female flounders can ovulate at one year old in nature. In addition, Non-Patent Document 2 states that sexual maturity of male and female flounders is achieved in almost all individuals over two years old, with the latest maturity age being 2 to 3 years old.

[0010] The object of the present invention is to provide a method for promoting sexual maturity of fish in order to obtain fish individuals that are more likely to ovulate or ejaculate at one year old than in nature or under conventional breeding conditions.

[0011] Solutions for solving problems

[0012] The present invention includes the following embodiments.

[0013] Item 1.

[0014] A method for promoting sexual maturity of fish, comprising the step of inhibiting the functional expression of at least one of a leptin receptor and leptin in the fish.

[0015] Item 2.

[0016] The method according to item 1, wherein the suppression of functional expression is performed by introducing a functionally defective mutation in at least one of the genes of the leptin receptor and leptin.

[0017] Item 3.

[0018] The method according to item 2, wherein the introduction of functional defect mutations is carried out using at least one genome editing system selected from the clustered regularly interspaced short palindromic repeats / CRISPR-associated protein 9 (CRISPR / Cas9) system, the CompoZr zinc finger nuclease (ZFN) system and the transcription activator-like effector nuclease (TALEN) system.

[0019] Item 4.

[0020] The method according to item 1, wherein the inhibition of functional expression is performed by inhibiting the expression of at least one of the genes of the leptin receptor and the leptin.

[0021] Item 5.

[0022] The method according to item 4, wherein the gene expression inhibition is performed by at least one selected from the group consisting of at least one RNA molecule selected from the group consisting of siRNA, shRNA and miRNA that targets the mRNA of at least one of leptin receptor and leptin, or a vector capable of expressing the RNA molecule.

[0023] Item 6.

[0024] The method according to item 1, wherein the inhibition of functional expression is performed by inhibiting the function of at least one of a leptin receptor and a leptin protein.

[0025] Item 7.

[0026] The method according to item 6, wherein the inhibition of the function of the protein is performed by at least one selected from the group consisting of antibodies that specifically bind to one of a leptin receptor and leptin and inhibit the expression of the function of the binding partner through the binding.

[0027] Item 8.

[0028] The method according to item 1, wherein the fish is a female individual.

[0029] Effects of the Invention

[0030] It is possible to obtain fish individuals that are more likely to ovulate or lay eggs, or ejaculate at one year old than in nature or under conventional breeding conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The temperature conditions during rearing are shown.

[0032] Figure 2 : Figure 2 (A) shows the presence or absence of ovulation and changes in body weight of female leptin receptor gene-deficient flounder at 5.1, 10.1, 12.4, 15.8, 16.1, and 16.8 months of age. Figure 2 (B) shows the changes in body weight of male flounder lacking the leptin receptor gene at 5.1, 10.1, 12.4, 15.8, 16.1, and 16.8 months of age, with or without ejaculation.

[0033] Figure 3 The figure shows the body weight changes of female flounder lacking the leptin receptor gene. Figure 3 (A) shows the group in which ovulation was observed, Figure 3 (B) shows the group in which ovulation was not observed.

[0034] Figure 4 The figure shows the body weight changes of male flounder lacking the leptin receptor gene. DETAILED DESCRIPTION

[0035] One embodiment of the present invention relates to a method for promoting sexual maturation of fish.

[0036] In this specification, "fish" is not particularly limited. In this specification, the above-mentioned fish may include marine fish, freshwater fish, saltwater fish, migratory fish, etc.

[0037] Examples of the fish include Paralichthys, Tetraodontidae (puffers), Ostraciidae (boxfishes), Sparidae (sea breams and porgies), Salmonidae, Cyprinidae, Ictaluroidea, Siluridea, Bagroidea, Serranidae (sea basses, Cichlidae, Oryziidae (medakas), Monacanthidae, Osmeridae, Scombridae, Pleuronectidae, Carangidae, Lateolabrax, Moronidae, Latidae, Rachycentridae, Cynoglossidae, Anguillidae, Congridae, etc.

[0038] The fish of the family Oxyphyllum can include, for example, flounder (Temminck et Schlegel), flounder belonging to the genus Pseudorhombus (Pseudorhombus dupliciocellatus, Pseudorhombus oligodon, Pseudorhombus ctenosquamis, Pseudorhombus arsius, Pseudorhombus pentophthalmus, Pseudorhombus cinnamoneus, Pseudorhombus levisquamis, etc.), flounder belonging to the genus Tarphops (Tarphops oligolepis, etc.), flounder belonging to the genus Asterorhombus (Asterorhombus spp. intermedius), Japanese flounder (Lepidopsetta mochigarei) belonging to the genus Lepidopsetta, Japanese flounder (Taeniopsetta ocellata) belonging to the genus Taeniopsetta, etc. Preferably, Japanese flounder (TEMMINCKET SCHLEGEL) is used.

[0039] Examples of the fish of the family Pufferfish include fish of the genus Takifugu, such as the redfin pufferfish (Takifugu rubripes), the purple pufferfish (Takifugu porphyreus), and the spotted pufferfish (Takifugu niphobles); and fish of the genus Lagocephalus, such as the palefin pufferfish (Lagocephalus wheeleri).

[0040] The fish of the family Ostracionidae may include fish of the genus Ostracion, such as Ostracion immaculatus.

[0041] The fish of the Sparidae family may include, for example, Pagrus major, Pagrus auratus and other Pagrus genus; Acanthopagrus schlegelii, Acanthopagrus latus and other Acanthopagrus genus; Dentex tumifrons and other Dentex genus; Sparus aurata and other Sparus genus.

[0042] The fish of the family Salmonidae may include, for example, fish of the genus Salmon, such as Oncorhynchus mykiss, Oncorhynchus tshawytscha, Oncorhynchus masou, Oncorhynchus masou, Oncorhynchus kawamurae, Oncorhynchus gorbuscha, Oncorhynchus keta, etc.; fish of the genus Salmon, such as Salmo trutta, Oncorhynchus nerka, Oncorhynchus kisutch, and Atlantic salmon; fish of the genus Salmon, such as Salmo salar, etc.; and fish of the genus Salmon, such as Salvelinus malma, Salvelinus alpinus, and Salvelinus swinhoe's. leucomaenis), American trout (Salvelinusfontinalis), Salvelinus namaycush, etc.; Pacific taimen (Parahucho perryi), etc.; etc.

[0043] The fish of the family Cyprinidae may include, for example, Gnathopogon caerulescens, Hypophthalmichthys molitrix, Cyprinus carpio, Ctenopharyngodonidellus, Hypophthalmichthys nobilis, Carassius carassius, Cyprinus catla, Mylopharyngodon piceus, Cirrhinus molitorella, Cirrhinus cirrhosus, Catla catla, Labeo rohita, Megalobrama amblycephala and the like.

[0044] The fish of the superfamily Ictaluroidea may include, for example, Ictalurus punctatus, Ictalurus furcatus, and the like.

[0045] The fish of the Siluridea family may include, for example, Silurus asotus, Silurus biwaensis, Silurus lithophilus, Silurus glanis, Clarias fuscus, Clarias batrachus, and the like.

[0046] The fish of the family Bagroidea may include, for example, yellow catfish (Pseudobagrus fulvidraco), Mekong giant catfish (Pangasianodon gigas), Basa fish (Pangasius bocourti), and low-eye catfish (Pangasianodon hypophthalmus).

[0047] The fish of the family Serranidae may include, for example, seven-band grouper (Epinephelus septemfasciatus), brown-band grouper (Epinephelus bruneus), red-spot grouper (Epinephelus akaara), spotted grouper (Epinephelus malabaricus), bronze grouper (Epinephelus aeneus), amblycephalus (Epinephelus amblycephalus), jewel grouper (Epinephelus areolatus), orange-spot grouper (Epinephelus bleekeri), spotted grouper (Epinephelus bontoides), netted grouper (Epinephelus chlorostigma), coiodes (Epinephelus coiodes), fasciatus (Epinephelus fasciatus), brown-spot grouper (Epinephelus fuscoguttatus), California grouper (Epinephelus labriformis), saddle grouper (Epinephelus lanceolatus), spotted grouper (Epinephelus maculatus), spotted grouper (Epinephelus malabricus), blackfin grouper (Epinephelus marginatus), ripple grouper (Epinephelus ongus), clearwater grouper (Epinephelus polyphekadion), hawksbill grouper (Epinephelus quoyanus), six-band grouper (Epinephelus sexfasciatus), Nassau grouper (Epinephelus striatus), giant grouper (Epinephelus tauvina), blue grouper (Epinephelus tukula) and other groupers (Epinephelus), humpback perch (Cromileptesaltivelis) and other humpback perch (Plectropomus leopardus) and other species of Plectropomus and other species of Serranidae.

[0048] The fish of the family Cichlidae may include, for example, fish of the genus Oreochromis such as Nile tilapia (Oreochromis niloticus), tilapia (Oreochromis mossambicus), and Aureus tilapia (Oreochromis aureus).

[0049] The fish of the family Oryzidae may include, for example, fish of the genus Oryzias, such as Oryzias latipes, Oryzias sakaizumii, and Javan medaka (Oryzias javanicus).

[0050] The fish of the family Monochamus are, for example, fish of the genus Stephanolepis such as Stephanolepis cirrhifer and fish of the genus Thamnaconus such as Thamnaconus modestus.

[0051] The fish of the family Smelt can include, for example, sweetfish (Plecoglossus altivelis) and other fish of the subfamily Plecoglossinae, Pacific smelt (Hypomesus nipponensis), pond smelt (Hypomesus japonicus) and other fish of the subfamily Hypomesinae, Asian smelt (Osmerus mordax dentex), leaf smelt (Spirinchus lanceolatus), long-bodied oil smelt (Spirinchus lanceolatus) and other fish of the subfamily Osmerinae.

[0052] The fish of the scombridae family may include, for example, Scombrini such as Japanese mackerel (Scomber japonicus), Atlantic mackerel (Scomberscombrus), Australian mackerel (Scomber australasicus), Pacific bluefin tuna (Thunnus orientalis), Atlantic bluefin tuna (Thunnus thynnus), southern bluefin tuna (Thunnusmaccoyii), bigeye tuna (Thunnus obesus), yellowfin tuna (Thunnus albacares), albacore tuna (Thunnus alalunga), bluefin tuna (Thunnus tonggol), etc., Euthynnus such as tuna (Euthynnus affinis), bluefin tuna (Euthynnus alletteratus), bonito (Katsuwonus pelamis) and other bonito (Katsuwonus), Scomberomorini, Auxis, Sardini, Gymnosarda, etc.

[0053] The above-mentioned fish of the family Plaiceidae may include, for example, sharp-nosed yellowtail flounder (Pseudopleuronectes herzensteini), blunt-nosed yellowtail flounder (Pleuronectes yokohamae), stone flounder (Kareius bicoloratus), narrow-scaled flounder (Hippoglossus stenolepis), striped star flounder (Verasper moseri) and the like.

[0054] The fish of the Carangidae family may include, for example, greater amberjack (Seriola dumerili), yellowtail amberjack (Seriola lalandi), longfin amberjack (Seriola rivoliana), five-line amberjack (Seriola quinqueradiata) and other amberjack genus (Seriola), horse mackerel (Trachurus japonicus), yellow-banded trevally (Pseudocaranx dentex) and other Pseudocaranx genus (Pseudocaranx), oval pomfret and other pomfret and other fish of the genus (Trachinotus).

[0055] The fish of the family Lateolabrax may include, for example, blackfin perch (Lateolabrax latus), Chinese perch (Lateolabrax maculatus), etc., and the fish of the family Moronidae may include European perch (Dicentrarchus labrax), etc.

[0056] The fish of the family Latidae may include, for example, fish of the genus Lates, such as Lates calcarifer and Lates niloticus.

[0057] The fish of the family Rachycentridae is, for example, Rachycentron canadum.

[0058] The fish of the family Cynoglossidae may include, for example, Cynoglossus joyneri, Cynoglossus semilaevis, and the like.

[0059] The fish of the Anguilla family may include, for example, Japanese eel (Anguilla japonica), European eel (Anguilla anguilla), and the like.

[0060] The fish of the family Congeridae may include, for example, Conger myriaster, Conger japonicus, and the like.

[0061] In the present specification, the fish may be pure strains or hybrid strains. The hybrid strains may include hybrids derived from intergeneric hybridization.

[0062] As the "fish", fish belonging to the family of flounder, pufferfish, sparidae, serranidae, pufferfish, cichlids, salmonidae, and smelts are preferred. More preferred are flounder, redfin pufferfish, pufferfish, sweetfish, Japanese mackerel, mackerel trout, tilapia, and red grouper.

[0063] As the "fish", farmed fish is preferred. In addition, "farmed fish" may include, for example, fish farmed for the purpose of eating, breeding, appreciation, etc.

[0064] In this specification, "sexual maturity" means confirmation of ovulation in female individuals, and confirmation of ejaculation in male individuals.

[0065] "Promoting sexual maturity" means being able to lay eggs (or ovulate) or ejaculate sperm earlier than the average shortest age of maturity of the same species in nature or conventional breeding.

[0066] When the shortest maturity age of the same individual is set to x months, for example, "earlier than the shortest maturity age" means [x months - 1 month] or less ("-" indicates subtraction). It means preferably [x months × 0.2] months to [x months × 0.8] months, more preferably [x months × 0.45] months to [x months × 0.75] months, and even more preferably [x months × 0.45] months to [x months × 0.6] months.

[0067] Specifically, according to non-patent literature 1, in the case of female individuals of Japanese flounder, except for very few individuals, they can ovulate at an age of more than 24 months. In addition, it is recorded in non-patent literature 1 that although it is confirmed that the individual with a mature ovary containing water-absorbing eggs (ovarian eggs) less than 24 months old and the individual with an ovary in the third yolk stage (tertiary yolk stage) are less than 24 months old, they are all about to be 2 years old. In addition, there is no report on the fertilized eggs that can be produced, so it cannot be said that the shortest mature age of the individual is represented. In summary, it is believed that the actual spawning period of these individuals exceeds 24 months old. Therefore, in this specification, in the case of Japanese flounder, "promoting sexual maturity" specifically refers to: when the fertilization day is set to the 0th day and the fertilization month is set to the 0th month age, the first ovulation can be performed at less than 24 months, preferably 10 months to 18 months, more preferably 11 months to 16 months, and further preferably 11 months to 12 months. In addition, the Japanese flounder is an asynchronous multi-spawning fish. Therefore, the first ovulation refers to the first day of ovulation when the individual enters the first spawning period. On the other hand, for male individuals, "promoting sexual maturity" means being able to ejaculate for the first time under 12 months, preferably 5 to 12 months, and more preferably 8 to 12 months. Here, "1 month" when calculating the age in months means starting from day 0 and counting the 30th day from day 0 as the last day.

[0068] Here, "ovulation" refers to the discharge of water-absorbing eggs from the ovary into the ovarian cavity, and refers to the state in which the eggs can be discharged when the abdomen is compressed. "Oviposition" refers to the discharge of eggs by a female individual during mating behavior.

[0069] In addition, as mentioned above, the age of fish can be calculated from the month of fertilization. If the month of fertilization is unknown, the age can also be determined based on the number of opaque zones on the surface of the otolith, assuming that January 1 is the age reference date. That is, according to this standard, the state of accelerated sexual maturity is less than 2 years old in the case of Japanese flounder, for example.

[0070] In the present specification, the method for promoting sexual maturation of fish includes the step of inhibiting the functional expression of at least one of a leptin receptor and leptin.

[0071] The leptin receptor or leptin mRNA of each fish is not limited as long as it is transcribed from the leptin receptor or leptin gene present in the genome of each fish. That is, the leptin receptor or leptin mRNA of each fish may include variants transcribed from the leptin receptor or leptin gene.

[0072] For example, the leptin receptor gene of brown flounder (Paralichthys olivaceus) is registered as Gene ID (NCBI): 109636534. The leptin gene of brown flounder is registered as Gene ID (NCBI): 109624291 and 109632763.

[0073] The mRNA sequence of the leptin receptor of the brown flounder is registered as NCBI Reference Sequence: XM_020098286.1. In addition, the mRNA sequence of leptin of the brown flounder is registered as reference sequences: NW_017859644 and NW_017859660. Specific examples of various fish include the leptin receptor genes shown in Table 1 below and the leptin genes shown in Table 2 below.

[0074]

Table 1

[0075]

[0076]

Table 2

[0077]

[0078] There is no limitation on the method for inhibiting the functional expression of at least one of the leptin receptor and leptin. For example, the functional expression can be inhibited by introducing a functional defect mutation of at least one of the leptin receptor and leptin, inhibiting the gene expression of at least one of the leptin receptor and leptin, or neutralizing the protein function of at least one of the leptin receptor and leptin.

[0079] The method of introducing a functional loss mutation into at least one of the leptin receptor and leptin is not limited as long as the functional loss mutation can be introduced into the target gene in the genome of the target fish. This method is well known. For example, as a method for introducing a functional loss mutation, site-directed mutagenesis methods such as genome editing methods and homologous recombination methods; random mutagenesis methods, etc. can be cited.

[0080] Genome editing methods include methods of introducing proteins and nucleic acids that constitute genome editing technology, or vectors encoding these. As the above-mentioned protein, for example, CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) enzymes can be mentioned. Specifically, examples of the CRISPR enzyme include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4. Examples of the nucleic acid include crRNA and tracrRNA, or single-stranded nucleic acids connected via linkers. At this time, about the above-mentioned nucleic acid, for example, the base sequence annealed with the target sequence in crRNA is designed to be complementary to the base sequence encoding the leptin receptor and the leptin gene. The above-mentioned nucleic acid can be used alone or in combination. As a genome editing system using CRISPR enzyme, a regularly clustered short palindromic repeat / CRISPR-associated protein 9 (CRISPR / Cas9) system can be cited. In addition, as other genome editing systems, at least one method selected from the CompoZr zinc finger nuclease (ZFN) system and the transcription activator-like effector nuclease (TAL effector nuclease, TALEN) system can be cited. It is preferred that Cas9 is introduced in the form of mRNA or protein, and gRNA is introduced in the form of sgRNA or crRNA and tracrRNA. The CRISPR / Cas9 system. In addition, in the CRISPR / Cas9 system using a vector, the nucleic acid encoding CRISPR and the nucleic acid encoding Cas9 can be on different vectors or on one vector. The promoter used to make CRISPR function is not particularly limited, preferably the U6 promoter. The promoter used to make Cas9 function is not particularly limited, and a promoter expressed in mammalian cells such as a cytomegalovirus promoter is preferred. As a CRISPR / Cas9 system, a commercially available vector such as pX330-U6-Chimeric_BB-CBh-hSpCas9 vector can be preferably used.

[0081] The sequence targeting the leptin receptor gene or leptin gene integrated into the CRISPR sequence (hereinafter also referred to as the "target sequence") is not limited as long as it is integrated into the guide RNA (also referred to as gRNA, sgRNA, crRNA) and transcribed by the CRISPR / Cas9 system, or introduced into the cell in the form of a guide RNA containing a sequence complementary to the target sequence and can recombinant the leptin receptor gene or leptin gene. It is reported that as the target sequence, a sequence of about 20 bases in the 5' upstream region of the base sequence "NGG" (PAM sequence: N is any one of nucleotides A, G, T, C) present in the leptin receptor gene or leptin gene can usually be selected. The target sequence can be designed using publicly known design tools disclosed in the optimized CRISPR design tool (Massachusetts Institute of Technology, ZhangLab webpage (http: / / crispr.mit.edu / )), E-CRISP (http: / / www.e-crisp.org / E-CRISP / (German Cancer Research Center)), ZiFiT Targeter (http: / / zifit.partners.org / ZiFit / (Zing Finder Consortium)), Cas9design (http: / / cas9.cbi.pku.edu.cn (Peking University)), CRISPRdirect (http: / / crispr.dbcls.jp (University of Tokyo)), CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / (Huazhong Agricultural University)), CRISPR RGEN Tools (http: / / www.rgenome.net / (Seoul National University)), etc.

[0082] Examples of sequences targeting the leptin receptor gene include 5′-CAGTGCGTCCTTCGGAGACTCGG-3′ (SEQ ID NO: 1).

[0083] In addition, when single nucleotide polymorphisms (SNPs) exist in the PAM sequence, it is preferred to avoid such sequences. Regarding the target sequence, when the SNPs of an individual are known, it is preferred to optimize the sequence according to each SNP.

[0084] The 5' terminal region of the target sequence may be truncated by 1, 2, 3, or 4 bases, preferably 1, 2, or 3 bases.

[0085] In addition, the CRISPR / Cas9 system can be used to introduce genes into cells in the form of vectors, and gRNA, crRNA, trans-activating crRNA (tracrRNA) and RNA encoding Cas9 can be introduced into cells in combination with artificial synthesis or in vitro transcription. Alternatively, the Cas9 protein and guide RNA can be combined and introduced into cells.

[0086] Furthermore, the above genome editing system can co-introduce donor oligo DNA such as single-stranded oligomers (ssODNs). ssODNs can be designed according to known methods.

[0087] The genome editing system can be injected into the cytoplasm of a fertilized egg, preferably a fertilized egg in the single-cell stage, by microinjection. For example, when the Cas9 protein is introduced, it can be injected in a range of about 5pg to 100pg, preferably 10pg to 80pg, and more preferably 10pg to 50pg per fertilized egg. At this time, the guide RNA can be injected in a range of about 0.1pg to 50pg, preferably 0.5pg to 20pg, and more preferably 1pg to 5pg.

[0088] For the method of introducing mutations using genome editing technology, for example, reference can be made to Example 1 described below.

[0089] Examples of random mutagenesis methods include radiation irradiation with α-rays, β-rays, γ-rays, X-rays, and the like; chemical substance treatment using mutagens such as ethyl methanesulfonate (EMS) and ethynylnitrosourea (ENU); and heavy ion beam treatment.

[0090] As a method for inhibiting the gene expression of at least one of the leptin receptor and leptin, at least one method selected from the group consisting of an RNA molecule with an mRNA selected from at least one of the leptin receptor and leptin as a target or a vector capable of expressing the RNA molecule can be cited. "An RNA molecule with an mRNA selected from at least one of the leptin receptor and leptin as a target" is not limited as long as it targets the leptin receptor or leptin mRNA and can inhibit the expression of the leptin receptor or leptin protein. For example, siRNA, shRNA, dsRNA, miRNA, etc. can be cited as substances that have the effect of decomposing the target mRNA and / or inhibit the translation of the target mRNA. The sequences of these RNA molecules can be appropriately designed by methods known to those skilled in the art based on the base sequence information of the above-mentioned genes as targets. In addition, the RNA molecule can also be made based on a known method, or it can be obtained and used by those circulated on the market. As the above-mentioned RNA molecules, siRNA, shRNA and miRNA are preferred, and siRNA and shRNA are particularly preferred. The above-mentioned vector capable of expressing an RNA molecule targeting a leptin receptor or leptin mRNA is not particularly limited as long as it can express an RNA molecule that inhibits the expression of the leptin receptor or leptin protein in the body or cells of an individual. For example, a hairpin RNA expression vector can be cited. The hairpin RNA expression vector contains at least, for example: a sense strand DNA base sequence having the same sequence as the sense strand of the target mRNA (wherein the uracil of the mRNA is changed to thymine) downstream of a promoter base sequence suitable for expressing short-chain RNA such as a U6 promoter; a loop base sequence that forms a loop structure after transcription; an antisense strand DNA base sequence that can be complementary to the above-mentioned sense strand DNA base sequence in whole or in part; and a terminator sequence. The vector can exemplify a plasmid vector, an adenovirus vector, a retrovirus vector, a lentivirus vector, and the like.

[0091] At least one RNA molecule selected from the group consisting of siRNA, shRNA and miRNA can be injected into each fertilized egg by microinjection in a range of about 5pg to 100pg, preferably 10pg to 80pg, and more preferably 10pg to 50pg. At least one RNA molecule selected from the group consisting of siRNA, shRNA and miRNA or a vector capable of expressing the RNA molecule can be injected into each fertilized egg by microinjection in a range of about 5pg to 100pg, preferably 10pg to 80pg, and more preferably 10pg to 50pg. The vector can be linearized as needed.

[0092] The inhibition of the function of the protein can be performed by at least one selected from the group consisting of the following antibodies, which specifically bind to one of the leptin receptor and leptin and inhibit the functional expression of the binding partner through the binding. The antibody can be any of a polyclonal antibody and a monoclonal antibody. Both polyclonal antibodies and monoclonal antibodies can be appropriately prepared by methods known to those skilled in the art. In addition, the above-mentioned antibody can be an antibody fragment such as Fab, F(ab)2, diabody, scFv, small antibody, peptide antibody, and mimetic antibody.

[0093] The antibody can be injected in an amount ranging from about 5 pg to 100 pg, preferably 10 pg to 80 pg, and more preferably 10 pg to 50 pg per fertilized egg.

[0094] For the fry and small fish hatched from fertilized eggs, they are raised for 1 to 5 months, and the individuals with induced mutations in the leptin receptor gene are selected by mutation analysis methods, such as heteroduplex mobility analysis, Cel 1 test, T7 endonuclease test sequencing analysis, etc. At the age of 5 to 16 months, they are raised at a water temperature of about 15.0 to 22.0°C. Regarding the sunshine time, it can be carried out under natural conditions. Regarding other feeding conditions, it can be carried out according to the usual fish farming conditions. In addition, regarding the bait, the bait usually used in farming can be used.

[0095] For example, in the case of the Japanese flounder, the fry and small fish hatched from the fertilized eggs are raised at a water temperature of about 14.4 to 16.4°C until they are 2.6 months old. Individuals in which mutations are induced in the leptin receptor gene are selected by heteroduplex mobility analysis. They are raised at a water temperature of about 16 to 19.3°C until they are 5.8 months old, and then raised at a water temperature of about 14.3 to 20.6°C until they are 14.7 months old. From 14.7 months old, they are raised at a water temperature of about 15.6 to 22.2°C. Regarding the daylight hours, it can be carried out under natural conditions. Regarding other rearing conditions, it can be carried out according to normal fish farming conditions. In addition, regarding bait, the bait usually used in farming can be used.

[0096] [Example]

[0097] Although the embodiment of the present invention is described in more detail below with reference to the following examples, the present invention should not be construed as being limited to the examples.

[0098] 1. Preparation of flounder with leptin receptor gene deficiency

[0099] The researchers created flounder in which part of the leptin receptor gene was deleted, and compared it with wild-type flounder, they investigated whether sexual maturity was promoted.

[0100] (1) Preparation of fertilized eggs

[0101] The eggs (unfertilized eggs) and sperms of sexually mature male and female flounders were collected by squeezing the abdomen, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0102] (2) Introduction of mutations

[0103] The mutation was introduced using Cas9 protein and guide RNA. The sequence of the target gene was 5'-CAGTGCGTCCTTCGGAGACTCGG-3' (SEQ ID NO: 1), and RNA synthesis was performed by Fasmac.

[0104] A solution adjusted to 10 to 50 pg of Cas9 protein and 1 to 5 pg of guide RNA is introduced into the cytoplasm of the fertilized egg at the one-cell stage obtained in (1) above by microinjection, thereby introducing a mutation into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under normal feeding conditions to obtain the F0 generation.

[0105] (3) Production of F1 generation

[0106] The F0 individuals obtained in (2) were sexually matured to obtain homozygous and heterozygous individuals of the leptin receptor gene in the F1 generation. The modified sequence of the target gene was the 8 bases (5'-TCGGAGAC-3' deletion) of (1) above, resulting in functional deficiency of the leptin receptor gene.

[0107] 2. Observation on the growth and maturity of flounder with leptin receptor gene deficiency

[0108] (1) Rearing conditions

[0109] The hatched fry of the F0 generation of the above (2) were raised in a 0.5t water tank at a water temperature of 14.4-16.4°C until 2.6 months of age. Individual identification was performed at 2.6 months of age, and individual identification tags were marked on each individual. 34 individuals with induced mutations in the leptin receptor gene were selected by heteroduplex mobility analysis. They were raised in a 1t water tank at a water temperature of 16-19.3°C until 5.8 months of age, and then raised in a 3t water tank at a water temperature of 14.3-20.6°C until 14.7 months of age. From 14.7 months of age, they were raised in a 10t water tank at a water temperature of 15.6-22.2°C. Regarding the daylight hours, it was carried out under natural conditions.

[0110] The temperature conditions during the feeding are shown in Figure 1 .

[0111] (2) Results

[0112] Figure 2(A) shows the presence or absence of ovulation and the changes in body weight of female flounders with leptin receptor gene deficiency at 5.1, 10.1, 12.4, 15.8, 16.1, and 16.8 months of age in the F0 generation. Half of the 16 individuals were confirmed to have ovulated at 15.8 to 16.1 months of age. The eggs were confirmed to be fertilized, developed, and hatched normally.

[0113] Figure 2 (B) shows the presence or absence of ejaculation and the weight changes of male flounders with leptin receptor gene deficiency in the F0 generation at 5.1, 10.1, 12.4, 15.8, 16.1, and 16.8 months of age. Ejaculation was confirmed in 13 of the 15 individuals at 10.5 months of age. It was confirmed that the sperm could move normally.

[0114] Figure 3 The figure shows the body weight changes of female individuals of the F0 generation of flounder lacking the leptin receptor gene. Figure 3 (A) is the group in which ovulation was confirmed. Figure 3 (B) is the group in which ovulation was not confirmed.

[0115] Figure 4 The figure shows the body weight changes of male individuals of F0 generation Japanese flounder lacking the leptin receptor gene.

[0116] It is reported that it usually takes two years for female flounders to reach sexual maturity and ovulate, and one year for males to reach sexual maturity and ejaculate.

[0117] It was confirmed that by making the leptin receptor gene defective, both female and male individuals can reach sexual maturity in a shorter time than the time generally reported to be required for reaching sexual maturity.

[0118] This result indicates that the effect of promoting sexual maturation of Japanese flounder can be obtained by inhibiting the signal transmission caused by the binding of leptin receptor and leptin, which is its ligand, in Japanese flounder.

[0119] 3. Sexual maturity of male individuals in the F1 generation of leptin receptor homozygous individuals

[0120] The sexual maturity of males in the F1 generation of leptin receptor homozygous individuals (offspring individuals of the fish of the embodiment) was confirmed. Six of the six male individuals were confirmed to have ejaculated. It was confirmed that their sperm could move normally. The time was 5 months old, which was significantly shorter than the 10-month-old ejaculation of the flounder prepared in 1. above.

[0121] 4. Sexual maturation of F1 females with leptin receptor heterozygosity

[0122] The sexual maturity of the F1 generation leptin receptor heterozygous individuals (offspring individuals of the fish of the example) was confirmed. Among the 26 female individuals, one was confirmed to have laid eggs at 358 days old, which is significantly shorter than the 1.4 days old of the flounder prepared in 1. above.

[0123] 5. Production of redfin pufferfish with leptin receptor gene deficiency and observation of sexual maturity

[0124] We created redfin pufferfish with a defect in the leptin receptor gene and compared it with wild-type redfin pufferfish to study whether sexual maturity is promoted.

[0125] (1) Preparation of fertilized eggs

[0126] The eggs (unfertilized eggs) and sperms of sexually mature male and female redfin pufferfish were collected by squeezing the abdomen, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0127] (2) Introduction of mutations

[0128] Cas9 mRNA and guide RNA were used to introduce mutations. The sequence of the target gene is 5'-GTAGATGGAACAGCACACAGTGG-3' (sequence number 2). A solution adjusted to 2-10 pg of Cas9 RNA and 1-5 pg of guide RNA was introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with Cas9 mRNA and guide RNA were raised and hatched under normal feeding conditions to obtain the F0 generation.

[0129] (3) Production of strains

[0130] The individuals obtained in (2) above are made sexually mature, and offspring individuals with homologous leptin receptor gene deletion are obtained. The modified sequence of the target gene is the 4-base deletion of (1) above, and the functional defect of the leptin receptor gene occurs. The deletion sequence is 5'-GTAGATGGAACAG----CAGTGG-3' (sequence number 3).

[0131] (4) Observation of sexual maturity

[0132] The F2 generation leptin receptor gene homozygous deficient individuals of (4) above were raised in a natural water temperature and natural daylight hours until they were 2 years old. Only during the ripening period, they were raised in a water temperature of 17°C and a daylight hour of 14 hours in the light period and 10 hours in the dark period, and it was confirmed that the female individuals laid eggs at the age of 2 years.

[0133] 6. Production of sexually mature pufferfish lacking the leptin receptor gene and observation of their maturity

[0134] A pufferfish lacking the leptin receptor gene (the gene sequence is not known, and the nucleotide sequence is described below) was prepared, and compared with the wild-type pufferfish, it was examined whether sexual maturation was promoted.

[0135] (1) Preparation of fertilized eggs

[0136] The eggs (unfertilized eggs) and sperms of sexually mature male and female pufferfish were collected by squeezing the abdomen, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0137] (2) Introduction of mutations

[0138] The introduction of mutations uses Cas9 protein and guide RNA. The sequence of the target gene is 5'-CCCTCACGCAGTTCCTGAACGCG-3' (sequence number 4). A solution adjusted to 10-50pg of Cas9 protein and 1-5pg of guide RNA is introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under conventional feeding conditions to obtain the F0 generation.

[0139] (3) Screening of mutation introduction and observation of promotion of sexual maturity

[0140] The target sequence vicinity was amplified by PCR for the individuals obtained in (2) above, and the promotion of sexual maturation was observed for the individuals into which the mutation was introduced.

[0141] 7. Production of sexually mature sweetfish with leptin receptor gene deficiency and observation of maturity

[0142] Ayu with a leptin receptor gene deficiency (the gene sequence is not known, but the nucleotide sequence is described below) was prepared and compared with wild-type redfin pufferfish to examine whether sexual maturation was promoted.

[0143] (1) Preparation of fertilized eggs

[0144] The abdomen of sexually mature male and female sweetfish was squeezed to collect eggs (unfertilized eggs) and sperms, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0145] (2) Introduction of mutations

[0146] The introduction of mutations uses Cas9 protein and guide RNA. The sequence of the target gene is 5'-AAAGTGTCCAATCAGGAAGGAGG-3' (sequence number 5). A solution adjusted to 10-50pg of Cas9 protein and 1-5pg of guide RNA is introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under conventional feeding conditions to obtain the F0 generation.

[0147] (3) Screening of mutation introduction and observation of promotion of sexual maturity

[0148] The target sequence vicinity was amplified by PCR for the individuals obtained in (2) above, and the promotion of sexual maturation was observed for the individuals into which the mutation was introduced.

[0149] 8. Production of sexually mature Japanese mackerel with leptin receptor gene deficiency and observation of maturity

[0150] Japanese mackerel lacking the leptin receptor gene (the gene sequence is not known, but the nucleotide sequence is described below) was prepared, and compared with wild-type Japanese mackerel, it was examined whether sexual maturity was promoted.

[0151] (1) Preparation of fertilized eggs

[0152] The abdomen of sexually mature male and female Japanese mackerels was squeezed to collect eggs (unfertilized eggs) and sperms, respectively, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0153] (2) Introduction of mutations

[0154] The introduction of mutations uses Cas9 protein and guide RNA. The sequence of the target gene is 5'-TTCTGGTCTGCTGAGATATGAGG-3' (sequence number 6). A solution adjusted to 10-50pg of Cas9 protein and 1-5pg of guide RNA is introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under conventional feeding conditions to obtain the F0 generation.

[0155] (3) Screening of mutation introduction and observation of promotion of sexual maturity

[0156] The target sequence vicinity was amplified by PCR for the individuals obtained in (2) above, and the promotion of sexual maturation was observed for the individuals into which the mutation was introduced.

[0157] 9. Production of sexual maturity of leptin receptor gene-deficient trout and observation of maturity

[0158] We created munchkin trout with a defect in the leptin receptor gene and compared it with wild-type munchkin trout to investigate whether sexual maturity was promoted.

[0159] (1) Preparation of fertilized eggs

[0160] The eggs (unfertilized eggs) and sperms of sexually mature male and female trout were collected by squeezing the abdomen, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0161] (2) Introduction of mutations

[0162] The introduction of mutations uses Cas9 protein and guide RNA #1 or guide RNA #2. The sequence of the target gene is 5'-CCCTGCTCTGCCTCACCTGTGGA-3' (sequence number 7) or 5'-AGGGAGAGTTGATTCTGAGCTGG-3' (sequence number 8). A solution adjusted to 10 to 50 pg of Cas9 protein and 1 to 5 pg of guide RNA is introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under conventional feeding conditions to obtain the F0 generation.

[0163] (3) Screening of mutation introduction and observation of promotion of sexual maturity

[0164] The vicinity of the target sequence was amplified by PCR for the individuals obtained in (2) above, and the promotion of sexual maturation was observed for the individuals into which the mutation was introduced.

[0165] 10. Production of sexually mature tilapia with leptin receptor gene deficiency and observation of maturity

[0166] Tilapia with a defective leptin receptor gene were created and compared with wild-type tilapia to investigate whether sexual maturity was promoted.

[0167] (1) Preparation of fertilized eggs

[0168] The abdomen of sexually mature male and female tilapia was squeezed to collect eggs (unfertilized eggs) and sperms, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0169] (2) Introduction of mutations

[0170] The introduction of mutations uses Cas9 protein and guide RNA #1 or guide RNA #2. The sequences of the target genes are 5'-CTCTCTGCGTTCAGGTGCCGTGG-3' (sequence number 9), 5'-CCTTCAGCCCACCTTGGTGTGGA-3' (sequence number 10). A solution adjusted to 10 to 50 pg of Cas9 protein and 1 to 5 pg of guide RNA is introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under conventional feeding conditions to obtain the F0 generation.

[0171] (3) Screening of mutation introduction and observation of promotion of sexual maturity

[0172] The target sequence vicinity was amplified by PCR for the individuals obtained in (2) above, and the promotion of sexual maturation was observed for the individuals into which the mutation was introduced.

[0173] 11. Production of sexually mature red-spotted grouper with leptin receptor gene deficiency and observation of maturity

[0174] Red-spotted grouper lacking the leptin receptor gene (the sequence of this gene is not known, and the nucleotide sequence is described below) was prepared, and compared with wild-type red-spotted grouper, it was examined whether sexual maturity was promoted.

[0175] (1) Preparation of fertilized eggs

[0176] The abdomen of sexually mature male and female red-spotted groupers was squeezed to collect eggs (unfertilized eggs) and sperms, respectively. The obtained eggs and sperms were artificially inseminated to obtain fertilized eggs.

[0177] (2) Introduction of mutations

[0178] The introduction of mutations uses Cas9 protein and guide RNA. The sequence of the target gene is 5'-TCCACTCCTGAGTGCACTGCAGG-3' (sequence number 11). A solution adjusted to 10-50pg of Cas9 protein and 1-5pg of guide RNA is introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under conventional feeding conditions to obtain the F0 generation.

[0179] (3) Screening of mutation introduction and observation of promotion of sexual maturity

[0180] The target sequence vicinity was amplified by PCR for the individuals obtained in (2) above, and the promotion of sexual maturation was observed for the individuals into which the mutation was introduced.

[0181] 11. Production and Observation of Sexual Maturity of the Dark-colored Goby (Gnathopogon caerulescens) with Leptin Receptor Gene Defect

[0182] A dusky goby lacking the leptin receptor gene (the gene sequence is not known, but the nucleotide sequence is described below) was prepared and compared with the wild-type red-spotted grouper to investigate whether sexual maturation was promoted.

[0183] (1) Preparation of fertilized eggs

[0184] The eggs (unfertilized eggs) and sperms of sexually mature male and female dark-colored goby were collected by squeezing the abdomen, and artificial insemination was performed on the obtained eggs and sperms to obtain fertilized eggs.

[0185] (2) Introduction of mutations

[0186] The introduction of mutations uses Cas9 protein and guide RNA #1 or guide RNA #2, guide RNA #3. The sequences of the target genes are 5'-GACTGAATGGCTCTGGATACTGG-3' (sequence number 12), 5'-AAGATTAAGCACCAGGCCTCAGG-3' (sequence number 13), and 5'-ACTCGGCTTCACCTGAGGCCTGG-3' (sequence number 14). A solution adjusted to 10 to 50 pg of Cas9 protein and 1 to 5 pg of guide RNA is introduced into the cytoplasm of a fertilized egg in the one-cell stage by microinjection, thereby introducing mutations into the leptin receptor gene. The fertilized eggs introduced with the Cas9 protein and guide RNA are raised and hatched under conventional feeding conditions to obtain the F0 generation.

[0187] (3) Screening of mutation introduction and observation of promotion of sexual maturity

[0188] The target sequence vicinity was amplified by PCR for the individuals obtained in (2) above, and the promotion of sexual maturation was observed for the individuals into which the mutation was introduced.

[0189] <Leptin receptor gene sequence>

[0190] · Stephanolepis cirrhifer

[0191]

[0192] ·Smoky fish (Plecoglossus altivelis)

[0193]

[0194] Japanese mackerel (Scomber japonicus)

[0195]

[0196] Red-spotted grouper (Epinephelus akaara)

[0197]

[0198] ·Gnathopogon caerulescens

[0199]

[0200] CAGGCCTCTTCTGGAAGGCAAAAATTCCACAGACGTCGATTCCAATAA

[0201] TGTATCTCACAGCGTTCCGCTTTATCTGCCTCAGTTTCGAACTGAATGC

[0202] ATCAATCCACCATGA (SEQ ID NO: 19)

Claims

1. A method for promoting sexual maturity of fish, comprising the step of inhibiting the functional expression of at least one of a leptin receptor and leptin in fish.

2. The method according to claim 1, wherein: The functional expression is suppressed by introducing a functionally defective mutation in at least one of the genes of the leptin receptor and leptin.

3. The method according to claim 2, wherein: The introduction of loss-of-function mutations is carried out using at least one genome editing system selected from the clustered regularly interspaced short palindromic repeats / CRISPR-associated protein 9 (CRISPR / Cas9) system, the CompoZr zinc finger nuclease (ZFN) system, and the transcription activator-like effector nuclease (TALEN) system.

4. The method according to claim 1, wherein: The functional expression is suppressed by suppressing the expression of at least one of the genes of the leptin receptor and leptin.

5. The method according to claim 4, wherein: The gene expression is suppressed by at least one selected from the group consisting of at least one RNA molecule selected from the group consisting of siRNA, shRNA and miRNA that targets the mRNA of at least one of the leptin receptor and leptin, or a vector capable of expressing the RNA molecule.

6. The method according to claim 1, wherein: The fish are female individuals.

Images