Application of ribose-5-phosphate in the preparation of drugs for treating inflammatory diseases

Abstract

The present invention belongs to the field of biopharmaceutical technology and specifically discloses the use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases, particularly osteoarthritis. The present invention demonstrates that ribose-5-phosphate can significantly increase SW1353 cell viability, inhibit the transcriptional expression of the inflammatory factors IL-6 and IL-8 in SW1353 cells, inhibit the protein expression of the inflammatory factors IL-6 and IL-8 in SW1353 cells, and inhibit the transcription and protein expression of matrix metalloproteinase 13 in SW1353 cells, thereby treating osteoarthritis. Therefore, ribose-5-phosphate has the potential to be used in the preparation of anti-inflammatory drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the use of ribose-5-phosphate in the preparation of drugs for treating inflammatory diseases. Background Art

[0002] Osteoarthritis (OA) is a common, disabling, chronic inflammatory disease of the bones and joints, often leading to a significant decline in limb function, quality of life, and exercise levels. OA is one of the leading causes of disability in the elderly. Currently, there is a lack of recognized medications to improve OA. Clinical treatment primarily focuses on alleviating symptoms and relieving pain. Joint replacement remains the only effective treatment for patients with end-stage OA. However, the complex pathogenesis of OA makes research extremely challenging, making it a key area of ​​research for researchers.

[0003] The main pathological changes of OA include articular cartilage degeneration, synovial inflammation, and abnormal bone remodeling. While the pathological processes and mechanisms of OA remain incompletely elucidated, it is generally accepted that the development and progression of OA is closely linked to articular cartilage degeneration, chondrocyte apoptosis, and extracellular matrix degradation, all driven by inflammatory and immune factors. Cartilage, as a physiological structure at bone-to-bone contact, plays a role in weight bearing, stress transduction, and bony structural cushioning. Due to its crucial physiological position and function, cartilage damage and degeneration are the primary causes of joint dysfunction and are a core pathological hallmark of OA development. Unlike most tissues, articular cartilage lacks blood vessels, nerves, or lymphatics and is primarily composed of the extracellular matrix (ECM) and chondrocytes. Chondrocytes, the only cell type present in articular cartilage, primarily function to maintain cartilage homeostasis by regulating the ECM through their own synthesis and catabolism. Therefore, the function and fate of chondrocytes dictate the health of cartilage.

[0004] When OA develops, chondrocyte metabolism becomes disrupted, leading to the expression and secretion of a series of inflammatory factors and matrix metalloproteinases, such as IL-1β, IL-8, and MMPs. These damaging factors are directly involved in the process of articular cartilage degeneration. SW1353 cells have a well-characterized cartilage phenotype, making them suitable for studying chondrocyte structure and function. IL-1β can induce multiple pathological changes in chondrocytes, including the expression of inflammatory factors and matrix metalloproteinases, oxidative stress, and apoptosis. As an inflammatory stimulus, it is widely used to construct OA chondrocyte models. Therefore, studying the changes in SW1353 cell structure and function under IL-1β stimulation and reducing the expression of inflammatory factors and matrix metalloproteinases may have the potential to reverse or delay OA cartilage degeneration.

[0005] Ribose-5-phosphate (R-5p) is a product of the oxidative reaction phase of the pentose phosphate pathway. Under the catalysis of the specific phosphoribophosphate pyrophosphokinase, it reacts with ATP to form 5-phosphoribophosphate pyrophosphate, which is used in the de novo synthesis of nucleotides. There is a need to develop the use of ribose-5-phosphate in the preparation of OA drugs. Summary of the Invention

[0006] In order to solve the above technical problems, the present invention provides an application of R-5p in the preparation of a drug for treating inflammatory diseases. The present invention has found that R-5p can treat OA.

[0007] The purpose of the present invention is to provide an application of R-5p in preparing a drug for treating inflammatory diseases, wherein the inflammatory disease is osteoarthritis.

[0008] Preferably, the above R-5p is used in the preparation of a drug for treating inflammatory diseases, wherein the drug for treating inflammatory diseases contains R-5p as the sole active ingredient.

[0009] It should be noted that although R-5p was used as the sole active ingredient in the experiments of the present invention, in actual applications, R-5p can also be combined with other anti-inflammatory drugs. For example, R-5p can be combined with drugs such as aspirin for treating osteoarthritis, or with drugs such as acetaminophen.

[0010] Preferably, the above R-5p is used in the preparation of a drug for treating inflammatory diseases, wherein the drug for treating inflammatory diseases is an injection or an oral preparation.

[0011] Preferably, in the use of the above-mentioned R-5p in the preparation of a drug for treating inflammatory diseases, the injection is an aqueous solution of ribose-5-phosphate or a physiological saline solution of ribose-5-phosphate.

[0012] Preferably, in the use of the above-mentioned R-5p in the preparation of a drug for treating inflammatory diseases, the oral preparation is an ointment, a powder, an aqueous solution or an enteric-coated sustained-release preparation.

[0013] Preferably, the excipients used in the powder are starch, dextrin, sucrose and / or microcrystalline cellulose.

[0014] The excipients used in ointments are oils, surfactants and / or emulsifiers.

[0015] Enteric-coated sustained-release preparations are capsules or tablets containing a matrix-type sustained-release material. In addition to R-5p, enteric-coated sustained-release preparations may also contain one or more pharmaceutically acceptable excipients selected from starch, dextrin, sucrose, microcrystalline cellulose, povidone, methylcellulose, hydroxypropyl methylcellulose, hydroxyethyl cellulose, xanthan gum, chitin, and sodium alginate.

[0016] Preferably, in the use of the above R-5p in the preparation of a drug for treating inflammatory diseases, the aqueous solution is an aqueous solution of ribose-5-phosphate, and the solvent is deionized water.

[0017] It should be noted that in the specific forms of the above-mentioned drugs, there is no strict requirement for the mass percentage of the active ingredient R-5p in the drug. For example, each tablet contains 0.1 mg R-5p. In the actual treatment process, the dosage is calculated based on the effective content of R-5p.

[0018] Preferably, the above R-5p is used in the preparation of a drug for treating inflammatory diseases, and the ribose-5-phosphate is used to increase the viability of chondroma cells SW1353.

[0019] Preferably, the use of the above-mentioned R-5p in the preparation of a drug for treating inflammatory diseases includes any one or more of the following:

[0020] (1) The ribose-5-phosphate is used to prepare an inhibitor of the transcriptional expression of inflammatory factors IL-6 and / or IL-8 in SW1353 cells;

[0021] (2) The ribose-5-phosphate is used to prepare a protein expression inhibitor of the inflammatory factors IL-6 and / or IL-8 in SW1353 cells;

[0022] (3) The ribose-5-phosphate is used to prepare SW1353 matrix metalloproteinase 13MMP13 inhibitor.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention finds that R-5p has an inhibitory effect on the expression of inflammatory factors IL-6 and IL-8 in SW1353 cells; R-5p inhibits the expression of matrix metalloproteinase MMP13 in SW1353 cells when stimulated by IL-1β; inflammatory factors and matrix metalloproteinases are directly involved in the process of cartilage degeneration in osteoarthritis, so R-5p can alleviate cartilage degeneration in OA. R-5p has application in the preparation of drugs for treating inflammatory diseases, and when the drugs for treating inflammatory diseases use ribose-5-phosphate as the only active ingredient, the therapeutic effect on OA is still significant. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 CCK-8 was used to detect the effect of R-5p on the viability of SW1353 cells.

[0026] Figure 2 The effect of R-5p on the transcriptional expression of IL-6 in SW1353 cells was detected by qPCR.

[0027] Figure 3The effect of R-5p on the transcriptional expression of IL-8 in SW1353 cells was detected by qPCR.

[0028] Figure 4 The effect of R-5p on IL-6 protein expression in SW1353 cells was detected by ELISA.

[0029] Figure 5 ELISA was used to detect the effect of R-5p on the expression of IL-8 protein in SW1353 cells.

[0030] Figure 6 qPCR was used to detect the effect of R-5p on the transcriptional expression of matrix metalloproteinase 13 in SW1353 cells.

[0031] Figure 7 ELISA was used to detect the effect of R-5p on the expression of matrix metalloproteinase 13 protein in SW1353 cells.

[0032] Figure 8 This is an animal experiment to detect the effect of R-5p on cartilage degeneration in rat knee osteoarthritis.

[0033] Figure 8 In the figure, A is an introduction to the treatment time; B is a photo of the degree of injury of the rat knee articular cartilage surface, Control represents the control group, MIA represents the model group, R-5p (0.1 mg / mL) represents the first drug-treated group, and R-5p (1 mg / mL) represents the second drug-treated group. DETAILED DESCRIPTION

[0034] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below with reference to specific embodiments and drawings.

[0035] In the description of the present invention, unless otherwise specified, all reagents used are commercially available and all methods used are conventional techniques in the art.

[0036] In the examples and experiments of the present invention, R-5p was purchased from Shanghai Yuanye Biotechnology Co., Ltd. D-ribose-5-phosphate disodium salt hydrate, S26725-250 mg.

[0037] Example 1

[0038] Ribose-5-phosphate is used in the preparation of drugs for treating inflammatory diseases. Ribose-5-phosphate is D-ribose-5-phosphate disodium salt hydrate, and the drug uses D-ribose-5-phosphate disodium salt hydrate as the only active ingredient.

[0039] In order to verify the efficacy of ribose-5-phosphate in treating osteoarthritis, the present invention conducted the following experiments.

[0040] Experiment 1: Effect of R-5p on the viability of chondroma cells SW1353

[0041] Prepare cells at a concentration of 5 × 10 4 The SW1353 cell suspension was plated in a 96-well plate with a volume of 100 μL added to each well, and cultured at 37° C. and 5% carbon dioxide for 36 h.

[0042] A control group and a treatment group were then set up. The blank group was treated with 100 μL of fresh DMEM medium containing 10% serum by volume; the treatment groups were treated with 100 μL of R-5p liquid at 2.5 mM, 5 mM, 10 mM, 20 mM, 30 mM, and 40 mM concentrations, respectively. The R-5p liquid was prepared by dissolving a certain amount of R-5p in DMEM medium to obtain an R-5p solution, and then adding serum to a final serum concentration of 10% by volume to obtain the corresponding R-5p liquid concentrations for the treatment groups.

[0043] After the treatment, the control group and the treatment group were cultured at 37°C and 5% carbon dioxide for 24 hours, and the viability of SW1353 cells was detected by CCK8.

[0044] The results are as follows Figure 1 As shown in the figure, it was found that when the concentration of R-5p liquid was lower than 30 mM, the OD 450 The activity increased with increasing R-5p concentration. At 40 mM R-5p, cell viability was lower than at 30 mM, but still higher than the control group. This suggests that R-5p can increase SW1353 cell viability. All treatment groups showed significant differences from the control group (P < 0.05).

[0045] Experiment 2: R-5p inhibits the transcriptional expression of inflammatory factors IL-6 and IL-8 in SW1353 cells

[0046] In order to study the effect of R-5p on the transcriptional expression of inflammatory factors IL-6 and IL-8 in SW1353 cells, the cells were prepared at a concentration of 5 × 10 4 SW1353 cell suspension (100 cells / mL) was plated in a 6-well plate at a volume of 2 mL per well. After 36 hours, complete medium containing 1% serum was replaced for serum starvation. Following 24 hours of serum starvation, cells were pretreated with 20 mM and 30 mM R-5p solutions for 3 hours, respectively, as treatment groups. Control groups 1 and 2 were not treated with R-5p solution but were simply incubated for 3 hours in the same environment as the treatment groups. IL-1β was then added to both control group 2 and the treatment group to a final concentration of 10 ng / mL. All groups were incubated at 37°C and 5% CO2 for 24 hours. The mRNA levels of the cytokines IL-6 and IL-8 were measured by qPCR.

[0047] Among them, R-5p solution is prepared by mixing R-5p and complete culture medium.

[0048] Among them, IL-6 and IL-8 mRNA were extracted using Trizol and reverse transcribed into cDNA.

[0049] The qPCR system was as follows: 1 μL cDNA, 3.4 μL ddH2O, 5 μL 2×AceQ Universal SYBRqPCR Master Mix (Vazyme, Q511-02 / 03), 0.3 μL upstream primer, and 0.3 μL downstream primer.

[0050] The primer sequences for IL-6 are as follows:

[0051] Upstream primer IL-6F: TACATCCTCGACGGCATCTCA, SEQ ID NO.1.

[0052] Downstream primer IL-6R: CACCAGGCAAGTCTCCTCATTG, SEQ ID NO.2.

[0053] The primer sequences for IL-8 are as follows:

[0054] Upstream primer IL-8F: TCTTGGCAGCCTTCCTGATT, SEQ ID NO.3.

[0055] Downstream primer IL-8R: TGGTCCACTCTCAATCACTCTCAGT, SEQ ID NO.4.

[0056] The primer sequences for the internal reference GAPDH are as follows:

[0057] Upstream primer GAPDH-F: TGCCTCAACGACCACTTTG, SEQ ID NO.5.

[0058] Downstream primer GAPDH-R: TACTCCTTGGAGGCCATGTG, SEQ ID NO.6.

[0059] The results are as follows Figure 2 and Figure 3 As shown, compared with the control group 2 in which only IL-1β was added, there was no difference in the IL-6 mRNA content when the R-5p solution concentration was 20 mM. When the R-5p solution concentration was increased to 30 mM, the IL-6 mRNA content was significantly reduced (P < 0.05 ( Figure 2Similarly, when the concentration of R-5p solution was 20 mM, the mRNA level of IL-8 was not different from that of IL-1β alone. When the concentration of R-5p solution was increased to 30 mM, the mRNA level of IL-8 was significantly reduced, P < 0.05 ( Figure 3 ). This indicates that R-5p inhibits the transcriptional expression of inflammatory factors IL-6 and IL-8 in SW1353 cells.

[0060] Experiment 3: R-5p inhibits the protein expression of inflammatory factors IL-6 and IL-8 in SW1353 cells

[0061] In order to study the effect of R-5p on the expression of inflammatory factors IL-6 and IL-8 in SW1353 cells, the cells were prepared at a concentration of 6 × 10 4 SW1353 cell suspension (500 μL / well) was plated in a 24-well plate. After 36 hours, the cells were serum-starved with complete medium containing 1% serum. After 24 hours of serum starvation, cells were treated with 20 mM and 30 mM R-5p solutions for 3 hours, respectively. Control groups 1 and 2 were left alone for 3 hours under the same conditions as the treatment groups without R-5p solution. IL-1β was then added to both control group 2 and the treatment group to a final concentration of 10 ng / mL. All groups were incubated at 37°C and 5% CO2 for 24 hours. The R-5p solution was prepared by mixing R-5p with complete medium. IL-6 and IL-8 levels in the cell culture medium were measured by ELISA.

[0062] The results are as follows Figure 4 and Figure 5 As shown in the figure, compared with the control group 2 in which only IL-1β was added, the IL-6 content gradually decreased with the increase of the concentration of R-5p solution, and there were significant differences compared with the control group 2, P < 0.05 ( Figure 4 ). Similarly, IL-8 gradually decreased with the increase of R-5p concentration ( Figure 5 ), and all of them were significantly different from the control group 2, P < 0.05. This indicates that R-5p inhibits the protein expression of inflammatory factors IL-6 and IL-8 in SW1353 cells.

[0063] Experiment 4: R-5p inhibits the transcription and protein expression of matrix metalloproteinase 13MMP13 in SW1353 cells

[0064] To investigate the effect of R-5p on the expression of matrix metalloproteinase 13 in SW1353 cells, qPCR and ELISA were used to detect the transcriptional expression and protein expression of matrix metalloproteinase 13 after the addition of R-5p. 4SW1353 cell suspension (100 cells / mL) was plated in a 6-well plate, with 2 mL added to each well. After 36 hours, serum starvation was initiated by replacing the culture medium with 1% serum. Following 24 hours of serum starvation, cells were pretreated with 20 mM and 30 mM R-5p solutions for 3 hours, respectively, as treatment groups. Control groups 1 and 2 were not treated with R-5p solution but were kept in the same environment as the treatment groups for 3 hours. Interleukin-1β was then added to both control group 2 and the treatment group to a final concentration of 10 ng / mL. All groups were incubated at 37°C and 5% CO2 for 24 hours. The R-5p solution was prepared by mixing R-5p with complete culture medium. MMP13 mRNA levels were measured by qPCR.

[0065] The extraction method and qPCR method of MMP13 mRNA were based on Experiment 2, and the detection object was replaced by MMP13 mRNA.

[0066] The primers used to detect the MMP13 mRNA content were:

[0067] MMP13F:ATGCAGTCTTTCTTCGGCTTAG, SEQ ID NO.7.

[0068] MMP13R: ATGCCATCGTGAAGTCTGGT, SEQ ID NO. 8.

[0069] Meanwhile, prepare cells at a concentration of 6 × 10 4 SW1353 cell suspension (500 μL / well) was plated in a 24-well plate. After 36 hours, the cells were serum-starved with complete medium containing 1% serum. After 24 hours of serum starvation, cells were pretreated with 20 mM and 30 mM R-5p solutions for 3 hours, respectively, as treatment groups. Control groups 1 and 2 were not treated with R-5p solution but were kept in the same environment as the treatment groups for 3 hours. Interleukin-1β was then added to both control group 2 and the treatment group to a final concentration of 10 ng / mL. All groups were incubated at 37°C and 5% CO2 for 24 hours. The R-5p solution was prepared by mixing R-5p with complete medium. MMP13 levels in the cell culture medium were measured by ELISA.

[0070] The results are as follows Figure 6 and Figure 7 As shown in Figure 2, compared with the control group 2 where only IL-1β was added, the mRNA content of MMP13 gradually decreased with the increase of R-5p solution concentration after the addition of R-5p solution, and there were significant differences compared with the control group 2, P < 0.05 ( Figure 6The content of MMP13 in the cell culture supernatant had no difference when the concentration of R-5p solution was 20mM, but decreased when the concentration increased to 30mM, and was significantly different from the control group 2, P < 0.05 ( Figure 7 This indicates that R-5p inhibits the transcription and protein expression of matrix metalloproteinase 13 in SW1353.

[0071] Experiment 5: R-5p alleviates cartilage degeneration in rat knee osteoarthritis induced by iodoacetic acid

[0072] To study the effect of R-5p on OA cartilage degeneration in rats, male, 6-week-old, 200±20g SD rats were adaptively fed for 3 days and randomly divided into 3 groups: control group n=4, model group n=4, treatment group 1 n=4, and treatment group 2 n=4. Figure 8 Figure A: On day 1, treatment group 1 received a 0.1 mg / mL R-5p solution in saline (100 μL / mouse) intraarticularly in the right knee; treatment group 2 received a 1 mg / mL R-5p solution in saline (100 μL / mouse) intraarticularly in the right knee; the model and control groups received an equal volume of saline. On day 2, the model and treatment groups were each injected with a 20 mg / mL iodoacetic acid solution (100 μL / mouse) to establish a knee osteoarthritis model; the control group received an equal volume of saline (both treatment groups received iodoacetic acid). On days 3, 5, 7, 9, 11, and 13, treatment group 1 received a 0.1 mg / mL R-5p solution in saline (100 μL / mouse), and treatment group 2 received a 1 mg / mL R-5p solution in saline (100 μL / mouse) daily. The control and model (MIA) groups received an equal volume of saline. After the administration, the knee joints of the rats in the control group, model group, administration group 1 and administration group 2 were collected, dissected and the cartilage damage of the knee joints of the rats in each group was observed.

[0073] It should be noted that in Experiment 5, the normal saline solution was a sodium chloride solution with a mass fraction of 0.9%.

[0074] The results showed that compared with the model group, the degree of articular cartilage damage in the rat knee was significantly reduced after adding R-5p saline solution ( Figure 8 (B) This indicates that R-5p can alleviate iodoacetic acid-induced cartilage degeneration in rat knee osteoarthritis.

[0075] It should be noted that when numerical ranges are involved in the present invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as those in the embodiments, in order to avoid redundancy, the present invention describes preferred embodiments. Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic inventive concept, and such changes and modifications fall within the scope of the present invention.

[0076] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. If these modifications and variations of the present invention fall within the scope of the equivalent technology of the present invention, the present invention is intended to include these modifications and variations.

Claims

1. A use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases, characterized in that: The inflammatory disease is osteoarthritis.

2. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 1, characterized in that: The drug for treating inflammatory diseases uses ribose-5-phosphate as the only active ingredient.

3. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 2, characterized in that: The drug for treating inflammatory diseases is an injection or an oral agent.

4. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 3, characterized in that: The injection is an aqueous solution of ribose-5-phosphate or a physiological saline solution of ribose-5-phosphate.

5. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 3, characterized in that: The oral preparation is a paste, powder, aqueous solution or enteric-coated sustained-release preparation.

6. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 5, characterized in that: The aqueous solution is an aqueous solution of ribose-5-phosphate.

7. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 3, characterized in that: The ribose-5-phosphate is used to increase the cell viability of chondroma cells SW1353.

8. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 1, characterized in that: The applications include any one or more of the following: (1) The ribose-5-phosphate is used to prepare an inhibitor of the transcriptional expression of inflammatory factors IL-6 and / or IL-8 in SW1353 cells; (2) The ribose-5-phosphate is used to prepare a protein expression inhibitor of the inflammatory factors IL-6 and / or IL-8 in SW1353 cells; (3) The ribose-5-phosphate is used to prepare SW1353 matrix metalloproteinase 13MMP13 inhibitor.

Images