Application of Down's syndrome cell adhesion molecule Dscam in regulation of bee sugar response behavior
By silencing Dscam in the brain of bees and using RNAi technology to regulate the sugar reactivity of bees, the problem of difficulty in regulating bees' sugar response behavior in the prior art was solved, and the effect of significantly improving bees' sugar reactivity was achieved.
Patent Information
- Application Number
- CN202411544352.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2025-02-11
AI Technical Summary
The prior art lacks effective means of regulating bees' sugar response behavior, especially in the functional study of Dscam, and the sugar reactivity of bees is difficult to regulate.
Through qPCR detection, it was found that Dscam was highly expressed in the brain of bees, especially at the age of 25. Using RNAi technology to silence the Dscam in bees' brains, it was found that the sugar reactivity of bees decreased significantly after Dscam silencing.
By regulating the expression of Dscam, the sugar reactivity of bees was significantly improved, proving that Dscam plays an important role in regulating bees' sugar response behavior.
Smart Images
Figure CN119405808A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of insects, and particularly relates to application of Down syndrome cell adhesion molecule Dscam in regulating honey bee sugar response behavior. Background Art
[0002] Down syndrome cell adhesion molecule (Dscam) is a member of the immunoglobulin (Ig) superfamily. It has structural characteristics similar to Ig. Its typical domains are usually connected in series in the form of Ig-Fibronectin and FN-Ig-FN (Ng et al., 2014; Brites et al., 2008). It is located on human chromosome 21 and is considered to be a high-risk gene for Down syndrome and autism. In mammals, the function of Dscam has been studied more. It is known that Dscam plays an important role in neuronal migration, axon guidance, dendrite recognition and self-avoidance, and is also involved in the regulation of motor cortex-related functions. Unlike vertebrates, Dscam has a large number of transcripts in invertebrates, especially in insects and crustaceans, such as 38,016 transcripts in Drosophila, 51 in Tribolium castaneum, and 55 in bees. Dscam mainly regulates the nervous and immune systems of insects (Ng and Kurtz, 2020). Recent studies have shown that Dscam in invertebrates plays a role similar to antibodies in the adaptive immune system (Li et al., 2021). Earlier, Peuβ et al. (2016) found that silencing Dscam had an effect on the movement behavior and survival of Tribolium castaneum and Drosophila melanogaster, but had no effect on their immune systems. So far, there have been no reports on Dscam in honey bees. The western honey bee Apis mellifera is a typical social insect with a brain of only 1mm. 3 But there are amazing behaviors like counting, choosing, and remembering. Summary of the invention
[0003] The first object of the present invention is to provide a use of Down syndrome cell adhesion molecule Dscam in enhancing the sugar responsiveness of honey bees.
[0004] The present invention uses qPCR to find that Dscam is highly expressed in the brain of honey bees, and further testing finds that its expression level is highest in the brain of 25-day-old pollen bees. RNAi technology is used to silence dsDscam in the brain of honey bees, and it is found that after silencing Dscam in the brain of honey bees, its sugar responsiveness is significantly reduced.
[0005] Preferably, the invention relates to use of a preparation for regulating the expression of Dscam, a Down syndrome cell adhesion molecule, in the preparation of a preparation for regulating the sugar responsiveness of honey bees.
[0006] Preferably, the honey bee is Apis mellifera.
[0007] Preferably, the preparation for regulating the expression amount of Down syndrome cell adhesion molecule Dscam is a Down syndrome cell adhesion molecule Dscam overexpression agent or an inhibitor of Down syndrome cell adhesion molecule Dscam.
[0008] Preferably, the inhibitor of Down syndrome cell adhesion molecule Dscam is dsRNA, and its nucleotide sequence is: GCCGAAGAACTGGAGAAGAAGAAGCGGACAATGGTGCGCAACGCTCTTCCCCCCCCACGGGGCTGTCGTCGAATTTGTCCAAAATTGCAACGATTTCTTCTACCAAGAAGTGACAACAACCATAATCATCGATCGCCAGTCGATAGATCCACGAATAGATAGATAGTTTAGACGGAGTTTCGCGGCGGCCAATAAGTAATTAAAGTCACAGCGCTCGTCGAGACGTGTTTTCGCATTTCGAGAGATCGATCGAATCGATTGATGTTAAAGGAAACCGGCGACGGATATTTTTGCCTCCCGAAGGGACGGATCCCATTCCACTTCGTCTTCGACCATTCTTTCCTTCCTTCCAATTGTTTCTTGGCCTT.
[0009] The second object of the present invention is to provide a drug for regulating the sugar responsiveness of honey bees, comprising a preparation for regulating the expression level of Dscam, a Down syndrome cell adhesion molecule.
[0010] Preferably, the honey bee is Apis mellifera.
[0011] Preferably, the agent for regulating the Down syndrome cell adhesion molecule Dscam is a Down syndrome cell adhesion molecule Dscam overexpression agent or an inhibitor of the Down syndrome cell adhesion molecule Dscam.
[0012] Preferably, the inhibitor of Down syndrome cell adhesion molecule Dscam is dsRNA, and its nucleotide sequence is:.
[0013] The present invention confirms that the Down syndrome cell adhesion molecule Dscam is expressed most highly in the brain of honeybees, followed by antennae and heads. It is expressed relatively less in other tissues. The expression difference of Dscam in the brains of honeybees of different ages is extremely significant (P<0.01), and multiple comparisons show that the expression of Dscam is highest in the brains of 25-day-old honeybees (P<0.05), while there is no significant difference in the expression of brains of other ages (P>0.05). The expression level of Dscam in the heads of honeybees fed with dsDscam is significantly lower than that of honeybees fed with dsGFP. The sugar responsiveness of honeybees fed with dsDscam is extremely significantly lower than that of honeybees in the control group (P<0.0001). It is thus concluded that Dscam regulates the sugar response behavior of honeybees. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 It is the expression of Dscam in different tissues of Apis mellifera pollen-collecting bees.
[0015] Figure 2 This is the expression of Dscam in the brain of honey bees at different ages.
[0016] Figure 3 This is the detection of Dscam gene expression in the brain of honeybees after they were fed dsDscam.
[0017] Figure 4 This is a test of honey bee sugar responsiveness after silencing Dscam in the honey bee brain. DETAILED DESCRIPTION
[0018] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.
[0019] Embodiment 1:
[0020] 1 Materials and methods
[0021] 1.1 Collection by Italian honey bees
[0022] The bees used in the experiment were collected from the bee farm of the Comprehensive Experimental Station of the Institute of Zoology of the Guangdong Academy of Sciences. About 1,000 bees that had just left the hive were marked, and 15 bees were collected on the next 1, 6, 7, 10, 11, 14, 17, 21, 25, 28, 30, and 34 days respectively. Their brains were dissected, immediately placed in liquid nitrogen, and then stored in a -80 degree refrigerator for RNA extraction. At the same time, 10 25-day-old pollen-collecting bees were collected from each of the three normal bee colonies, and their antennae, heads, brains, chests, abdomens, feet, and wings were dissected, immediately placed in liquid nitrogen, and then stored at -80°C for RNA extraction.
[0023] 1.2 RNA extraction and cDNA synthesis
[0024] Total RNA of each sample was extracted according to the instructions of Trizol kit (Invitrogen, USA). After the integrity, purity and concentration of RNA were detected by nucleic acid analyzer, the first-strand cDNA synthesis was performed using reverse transcription kit (AG, Dalian, China). The synthesis process was divided into two steps: ① Removal of genomic DNA. The total reaction system was 10μL: 5×gDNA Eraser Buffer 2.0μL, total RNA 500ng, RNase Free ddH2O to 10μL. Incubate at 42℃ for 2min; ② Reverse transcription. The total reaction system was 20μL: 5×Evo M-MLV RT Reaction Mix 4.0μL, RNase Free ddH2O 6μL, and the reaction solution of step ① was 10μL. 37℃15min, 85℃5s, 4℃, 2min.
[0025] 1.3 Primer design
[0026] The nucleotide sequence of the Dscam gene of Apis mellifera (NM_001014991.1) was searched in the NCBI database, and primers (F: ATGAGCGACCAGGCTACCTA; R: TCCGGGATAGCTCCAACGTA) were designed using Primer 5.0 software for qPCR experiments.
[0027] 1.4dsDscam synthesis
[0028] The upstream and downstream primers of dsDscam (F: GCCGAAGAACTGGAGAAGAA; R: AAGGCCAAGAAACAATTGGA) were synthesized from Bioengineering, and PCR amplification was performed with honey bee brain cDNA using the Vazyme kit. The reaction system was: 2.5 μL cDNA template, 1.5 μL upstream and downstream primers, 19.5 μL ddH2O, 2×Taq plus Master Mix 25 μL, and the total reaction system was 50 μL. Reaction procedure: 95℃ pre-deformation for 1 min; 95℃ deformation for 30 s; 60℃ annealing for 30 s; 72℃ extension for 30 s; 35 cycles; 72℃ final extension for 10 min, and storage at 12℃. After 1% agarose gel electrophoresis (120V, 25 min), the PCR product was detected and photographed in a gel imaging system. The gel containing the target DNA band was cut and placed in a clean 1.5 ml centrifuge tube. Gel recovery was performed using the Omega kit according to the instructions.
[0029] The gel-recovered product DNA was used as a template for the second PCR, and the reaction procedure and reaction system were the same as above. The PCR product was liquid-recovered using an Omega kit according to the instructions. The liquid-recovered DNA was used for the next step of dsRNA synthesis. The dsRNA synthesis was performed using a Promega kit according to the instructions.
[0030] 1.5ds DScam feeding
[0031] Thirty pollinating bees were collected from a bee colony (pollinating bees were measured by carrying pollen in the pollen basket on their hind legs) and divided into two groups. One group of bees was fed 3 μg of dsDscam (3 μg of dsRNA dissolved in 4 μl of 50% sucrose solution) and the other group of bees was fed the same amount of dsGFP. This experiment was repeated in three bee colonies.
[0032] 1.6 Detection of silencing efficiency
[0033] 24 hours after feeding the reagent, the total RNA was extracted from the heads of the bees in the experimental group and the control group (the method is the same as above), reverse transcribed, and qPCR was performed using Dscam as upstream and downstream primers (the reaction system and reaction procedure are the same as above).
[0034] 1.7 Honey bee sugar reactivity test
[0035] The concentrations of sucrose solution required for the test are: 0.1%, 0.3%, 1%, 3%, 10% and 30% (w / w), in addition to water. Preparation method of 10% (w / w) sucrose solution: weigh 10g sucrose and add it to 90g water. The other concentrations are prepared according to the same method. Bees are lined up and tested in order, with the sugar water concentrations from low to high. For example, all bees are tested for their responsiveness to 0.1% sugar water first, then all bees are tested for their responsiveness to 0.3% sugar water, and so on. Before testing with 0.1% sugar water, a drop of water is touched to each antenna of the bee. Similarly, before stimulating the antennae of the bees with subsequent sugar waters, a drop of clean water is touched to each antennae of the bee (i.e., water, 0.1%; water, 0.3%; etc.). The interval between stimulations with different sugar waters is 2 to 3 minutes. The standard for a bee to show a kissing reaction is that when a drop of sugar water touches each antenna of the tested bee in sequence and in turn, the bee can fully extend its kiss, and the bee shows a reaction to the sugar water of that concentration. If the kiss only moves very slightly and does not fully extend, the bee is considered to have not shown a reaction. After all concentration tests are completed, the bee is tested with 50% sugar water. If the bee extends its kiss, it means that the bee is normal. If it does not extend its kiss, it means that the bee is abnormal, and all data previously tested on the bee are discarded.
[0036] 1.8 Fluorescence quantitative PCR
[0037] The cDNA of each sample (diluted 4 times after reverse transcription) was used as a template. Premix ExTaqTM II (Tli RNaseH Plus) kit was used for fluorescence quantitative PCR. Reaction system (20μL): SYBR Premix ExTaqTMII 10μL, upstream and downstream primers (10μmol / L, F: ATGAGCGACCAGGCTACCTA, R: TCCGGGATAGCTCCAACGTA) 0.8μL each, cDNA template 3μL, DEPC water 5.4μL. Reaction conditions: 95℃ pre-denaturation for 30s; followed by 40 cycles: 95℃ 30s, 60℃ 30s. Reaction conditions for determining the melting curve: from 60℃ to 95℃ at a heating rate of 0.5℃.
[0038] 1.9 Data Processing
[0039] For qPCR test data, the Ct value obtained from the amplification curve was calculated using 2 －△CT SPSS 25.0 software was used for one-way analysis of variance, Duncan's method was used for multiple comparisons, and GraphPad Prism 9.1 software was used for drawing graphs.
[0040] 2 Test results
[0041] 2.1 Expression of Dscam in different tissues
[0042] The results of one-way ANOVA showed that ( Figure 1 ), the expression of Dscam in different honey bee tissues was extremely different (P<0.01), and multiple comparisons showed that Dscam was most highly expressed in the honey bee brain, followed by antennae and head. It was relatively less expressed in other tissues.
[0043] 2.2 Expression of Dscam in the brain of honeybees of different ages.
[0044] like Figure 2 As shown, the expression level of Dscam in the honey bee brain increases with the age, reaching the highest level at 25 days old, and then shows a downward trend.
[0045] The results of one-way ANOVA showed that the expression of Dscam in the brains of bees of different ages was extremely significant (P<0.01). Multiple comparisons showed that the expression level of Dscam was highest in the brains of 25-day-old bees (P<0.05), while there was no significant difference in the expression of Dscam in the brains of bees of other ages (P>0.05).
[0046] 2.3 RNAi silencing efficiency verification
[0047] like Figure 3 As shown, the expression of Dscam in the brain of bees was detected 24 hours after orally feeding bees dsDscam. The results showed that the expression level of Dscam in the head of bees fed dsDscam was significantly lower than that of bees fed dsGFP (p<0.05).
[0048] 2.4 Effects of Dscam silencing on sugar responses in honey bees
[0049] like Figure 4 As shown in the figure, 24 hours after orally feeding honey bees with dsDscam, the responses of the honey bees to sugar solutions of different concentrations were tested. The results showed that the sugar responsiveness of the honey bees fed with dsDscam was significantly lower than that of the control group (P<0.0001). This shows that Dscam regulates the sugar response behavior of honey bees.
Claims
1. Application of Down syndrome cell adhesion molecule Dscam in regulating honey bee sugar response behavior.
2. The use according to claim 1, characterized in that: The invention relates to the use of a preparation for regulating the expression of Dscam, a Down syndrome cell adhesion molecule, in the preparation of a medicament for regulating the sugar responsiveness of honey bees.
3. The use according to claim 1 or 2, characterized in that: The honey bee is Apis mellifera.
4. The use according to claim 1, characterized in that: The preparation for regulating the expression amount of Down syndrome cell adhesion molecule Dscam is a Down syndrome cell adhesion molecule Dscam overexpression agent or a Down syndrome cell adhesion molecule Dscam inhibitor.
5. The use according to claim 1, characterized in that: The inhibitor of Down syndrome cell adhesion molecule Dscam is dsRNA, and its nucleotide sequence is: GCCGAAGAACTGGAGAAGAAGAAGCGGACAATGGTGCGCAACGCTCTTCCCCCCCCACGGGGCTGTCGTCGAATTTGTCCAAAATTGCAACGATTTCTTCTACCAAGAAGTGACAACAACCATAATCATCGATCGCCAGTCGATAGATCCACGAATAGATAGATAGTTTAGACGGAGTTTCGCG GCGGCCAATAAGTAATTAAAGTCACAGCGCTCGTCGAGACGTGTTTTCGCATTTCGAGAGATCGATCGAATCGATTGATGTTAAAGGAAACCGGCGACGGATATTTTGCCTCCCGAAGGGACGGATCCCATTCCACTTCGTCTTCGACCATTCTTTCCTTCCTTCCAATTGTTTCTTGGCCTT.
6. A drug for regulating the sugar responsiveness of honey bees, characterized in that: The invention discloses a preparation containing a preparation for regulating the expression of Dscam, an adhesion molecule in Down syndrome cells.
7. The agent for regulating the sugar responsiveness of honey bees according to claim 6, characterized in that: The honey bee is Apis mellifera.
8. The agent for regulating the sugar responsiveness of honey bees according to claim 6, characterized in that: The preparation for regulating Down syndrome cell adhesion molecule Dscam is an inhibitor of Down syndrome cell adhesion molecule Dscam.
9. The agent for regulating the sugar responsiveness of honey bees according to claim 6, characterized in that: The inhibitor of Down syndrome cell adhesion molecule Dscam is dsRNA, and its nucleotide sequence is: GCCGAAGAACTGGAGAAGAAGAAGCGGACAATGGTGCGCAACGCTCTTCCCCCCCCACGGGGCTGTCGTCGAATTTGTCCAAAATTGCAACGATTTCTTCTACCAAGAAGTGACAACAACCATAATCATCGATCGCCAGTCGATAGATCCACGAATAGATAGATAGTTTAGACGGAGTTTCGCGGCGGCCAATAAGTAATTAAAGTCACAGCGCTCGTCGAGACGTGTTTTCGCATTTCGAGAGATCGATCGAATCGATTGATGTTAAAGGAAACCGGCGACGGATATTTTTGCCTCCCGAAGGGACGGATCCCATTCCACTTCGTCTTCGACCATTCTTTCCTTCCTTCCAATTGTTTCTTGGCCTT。