Application of ZDHHC11 gene in the preparation of drugs for the treatment of non-small cell lung cancer

Abstract

The present invention discloses the use of the ZDHHC11 gene in the preparation of a drug for treating non-small cell lung cancer, relating to the field of biomedicine. The present invention has found that overexpressing the ZDHHC11 gene in NSCLC cells increases ZDHHC11 protein levels, inhibiting cell viability, migration, and proliferation, and promoting cell apoptosis. Knocking out the ZDHHC11 gene, on the other hand, increases NSCLC cell viability. These results suggest that the ZDHHC11 gene plays an important role in controlling the progression of non-small cell lung cancer, providing a new target for the treatment of NSCLC and potentially having application value in the preparation of drugs for the treatment of non-small cell lung cancer.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to the application of the ZDHHC11 gene in preparing a drug for treating non-small cell lung cancer. Background Art

[0002] Lung cancer is primarily classified into two categories based on cancer cell morphology and histopathological typing: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC). NSCLC accounts for approximately 80% of lung cancer cases. NSCLC can be further subdivided into various types, namely lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), and large cell lung cancer (LCC). Current treatment options for lung cancer include surgery, radiotherapy, chemotherapy, and targeted therapies. The current treatment paradigm for lung cancer has gradually shifted toward targeted therapies, with inhibitors targeting various molecular targets such as epidermal growth factor receptor (EGFR), anaplastic lymphoma kinase (ALK), and proto-oncogene protein tyrosine kinase 1 (ROS1). However, most targeted drugs develop resistance after a median treatment duration of 12-14 months. The trend is to identify more therapeutic targets and develop better combination therapy regimens.

[0003] A growing number of reports indicate that lipid metabolism can be involved in the development and progression of cancer. Through processes such as fatty acid oxidation, ferroptosis, and lipoylation, tumor metastasis, growth, and immune evasion can be influenced. Lipolytic acylation is a key post-translational protein modification. S-palmitoylation, also known as protein palmitoylation, is the most common protein lipid modification. Protein palmitoylation is primarily catalyzed by palmitoyltransferases. ZDHHC enzymes, as palmitoyltransferases, catalyze the formation of a sulfhydryl bond between palmitic acid and a cysteine ​​residue on a substrate protein. The ZDHHC protein family is highly conserved across eukaryotes, with 23 isoforms in human cells, mediating S-palmitoylation on virtually all membrane proteins. Multiple ZDHHCs have been implicated in cancer. Studies have predicted 299 cancer driver genes, 26% of which encode proteins potentially subject to palmitoylation. However, the specific ZDHHCs responsible for these palmitoylations remain unknown. At least 15 of the 23 known human ZDHHCs have been linked to cancer. Studies have found that ZDHHC2 can inhibit NSCLC, while ZDHHC5 can promote the development of lung cancer. These studies suggest that ZDHHC protein plays an important regulatory role in the initiation and development of lung cancer, and also suggest that screening potential ZDHHC enzymes will provide new targets for lung cancer treatment. Summary of the Invention

[0004] The purpose of the present invention is to overcome the shortcomings of the existing technology and provide the use of the ZDHHC11 gene in the preparation of a therapeutic drug for treating non-small cell lung cancer. By changing the expression of the ZDHHC11 gene, the proliferation and migration ability of non-small cell lung cancer can be effectively reduced, and the apoptosis of non-small cell lung cancer can be greatly enhanced, providing a target for the treatment of NSCLC.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] As a first aspect of the present invention, the ZDHHC11 gene is used in the preparation of a drug for treating non-small cell lung cancer. By overexpressing the ZDHHC11 gene, the ZDHHC11 protein level is increased, thereby inhibiting the proliferation and migration ability of non-small cell lung cancer cells and promoting their apoptosis.

[0007] A further improvement is that the NCBI accession number of the ZDHHC11 gene is 79844, and the sequence of the encoded ZDHHC11 protein is shown as SEQ ID No. 1.

[0008] A further improvement is that the overexpression of the ZDHHC11 gene is transient overexpression or stable overexpression of the ZDHHC11 gene.

[0009] As a second aspect of the present invention, a recombinant plasmid for overexpression of the ZDHHC11 gene is also disclosed. The recombinant plasmid for overexpression of the ZDHHC11 gene is constructed by the ZDHHC11 gene and the pCMV expression vector. The NCBI accession number of the ZDHHC11 gene is 79844.

[0010] As a third aspect of the present invention, also disclosed is a use of the above-mentioned ZDHHC11 gene overexpression recombinant plasmid in the preparation of a drug for treating non-small cell lung cancer.

[0011] As a fourth aspect of the present invention, a drug for treating non-small cell lung cancer is also disclosed, which comprises a therapeutically effective amount of the recombinant plasmid for overexpression of the ZDHHC11 gene as described above.

[0012] As a fifth aspect of the present invention, a ZDHHC11 gene overexpression cell line is also disclosed. The ZDHHC11 gene overexpression cell line is obtained by transfecting the above-mentioned ZDHHC11 gene overexpression recombinant plasmid into non-small cell lung cancer cells.

[0013] A further improvement is that the non-small cell lung cancer cells are A549 and PC-9 cells.

[0014] The present invention has the following beneficial effects:

[0015] The present study found that overexpressing ZDHHC11 in NSCLC cells inhibited cell viability, migration, and proliferation, and promoted cell apoptosis. Knockout of the ZDHHC11 gene, on the other hand, increased NSCLC cell viability. These results suggest that the ZDHHC11 gene plays an important role in controlling the progression of non-small cell lung cancer, providing a new target for NSCLC treatment and potentially useful in the development of drugs for the treatment of non-small cell lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Figure 3 shows the changes in ZDHHC11 transcription levels in LUAD and LUSC (A) and the relationship between ZDHHC11 expression and overall survival in LUAD (BC);

[0017] Figure 2 To detect the protein level of ZDHHC11 after transfection of ZDHHC11 overexpression plasmid into PC-9 cells;

[0018] Figure 3 The effect of ZDHHC11 overexpression on PC-9 and A549 cell viability;

[0019] Figure 4 The effect of ZDHHC11 overexpression on apoptosis of PC-9 and A549 cells;

[0020] Figure 5 The effect of ZDHHC11 overexpression on the migration ability of PC-9 and A549 cells;

[0021] Figure 6 The effect of stable overexpression of ZDHHC11 on cell proliferation ability (Figure A is a graph verifying the protein level of stable overexpressing cells; B is a graph comparing the proliferation effects of two cell lines in a clone formation experiment).

[0022] Figure 7 Construction and screening of ZDHHC11 knockout cell lines; (In the figure, A is the construction of the knockout plasmid; B is the verification of the knockdown effect of the knockout plasmid; C is the screening of knockout cells; D is the verification of the protein level of the knockout cells; E is the comparison of the gene sequences of the knockout cells.)

[0023] Figure 8 To investigate the effect of knocking out ZDHHC11 on cell viability. DETAILED DESCRIPTION

[0024] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0025] 1. Materials and Reagents

[0026] The experimental methods in the following examples are all conventional biochemical methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0027] 1. Cell lines

[0028] Lung adenocarcinoma cells (PC-9) were donated by the Central Laboratory of Hefei Binhu Hospital; lung adenocarcinoma cells (A549) were preserved in our laboratory.

[0029] 2. Plasmid

[0030] The pCMV3.1(+)-Flag plasmid was preserved in our laboratory, and pCMV3.1(+)-Flag-ZDHHC11 was purchased from General Biotechnology.

[0031] 3. Molecular biology reagents and antibodies

[0032] Transfection reagent Lipofectamine 2000 was purchased from Thermo Scientific (Cat. No. 11668019); fetal bovine serum (FBS) was purchased from Excell; DMEM medium was purchased from Proteintech; anti-ZDHHC11 was purchased from GeneTex, and anti-FLAG, anti-GAPDH, goat anti-rabbit IgG (H+L)-HRP, and goat anti-mouse IgG (H+L)-HRP antibodies were purchased from Proteintech.

[0033] The quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0034] 2. Methods

[0035] 1. ZDHHC11 expression and prognostic bioinformatics analysis

[0036] The GEPIA (Gene Expression Profile Interactive Analysis) dataset is a tool that provides key interactive network functions based on TCGA and GTEx data. The tissue expression levels of the ZDHHCs gene were processed using the standard processing method provided by the GEPIA dataset. The results showed that the expression level of ZDHHC11 in lung adenocarcinoma and lung squamous cell carcinoma was much lower than that in normal tissues ( Figure 1 A). Compared with normal tissues, the expression of ZDHHC11, ZDHHC14, ZDHHC17 and ZDHHC19 genes in LUAD and LUSC showed significant downregulation ( Figure 1 B).

[0037] The Kaplan-Meier database was used to evaluate the correlation between ZDHHC11 gene expression level and prognosis survival of lung cancer patients online. The present invention uses Kaplan-Meier survival diagram to evaluate the relationship between ZDHHC11 gene expression in LUAD and patients' overall survival (OS) and first progression survival (FP). The results showed that the effect of ZDHHC11 gene expression on survival was more significant, with an HR value of only 0.36, which indicates that high expression of ZDHHC11 may greatly improve the survival rate of patients with lung cancer cells ( Figure 1 C).

[0038] 2. Detection of protein expression levels by immunoblotting after transfection of Flag-ZDHHC11 plasmid

[0039] PC-9 cells were cultured at a rate of 2×10 5Cells were seeded into 6-well plates, 2 mL per well, and cultured for 24 h. The Flag-ZDHHC11 plasmid was transfected according to the instructions of Lipofectamine 2000. After 6 h of culture, the supernatant was replaced with 10% FBS culture medium. Cells were collected 48 h after transfection. The culture medium was discarded, and the cells were washed three times with 1 mL of pre-cooled 1× PBS solution, and the supernatant was discarded. The cell sample was placed on ice, and 50 μL of single-cell lysis buffer (150 mmol / L NaCl, 50 mmol / L Tris-HCl pH 8.0, containing 1 tablet / 50 mL of EDTA protease inhibitor, 1% NP40) was added and lysed on ice for 30 min. Centrifuge at 12000 rpm at 4°C for 10 min; take 2 μL of cell lysate and add 800 μL of Coomassie Brilliant Blue solution (Bio-Rad) for protein quantification, and use the cell lysate for protein balance; add 12.5 μL of 5× SDS loading buffer to the balanced sample, water bath at 100°C for 5 min, centrifuge at 12000 rpm at 4°C for 5 min, take 10 μL for electrophoresis, the voltage is initially set to 80 V, and after bromophenol blue migrates to the separation gel, adjust the voltage to 120 V and continue electrophoresis; 30 min before the end of electrophoresis, activate the PVDF membrane with methanol for 15 s, and then soak it and two 2.5 mm thick filter papers in 1× transfer buffer for 30 min. After the electrophoresis is completed, transfer the membrane from bottom to top according to the filter paper-PVDF membrane-PA Place the GE gel-filter paper in a semi-dry transfer apparatus in order, use a roller to remove bubbles, and transfer at 18V for 1 hour; block the transferred PVDF membrane with blocking solution (TBST solution containing 5% skim milk powder) for 3 hours, add anti-ZDHHC11 and anti-GAPDH (the corresponding concentration has been prepared according to the antibody instructions) and incubate at 4°C overnight; wash with 1×TBST for 5 minutes, repeat 6 times, add goat anti-rabbit IgG (H+L)-HRP (the corresponding concentration has been prepared according to the antibody instructions) and incubate on a shaker at room temperature for 1 hour, wash with 1×TBST for 5 minutes, repeat 3 times, and finally perform ECL chemiluminescence. Mix the color development solution A and solution B in a 1:1 ratio and evenly cover the PVDF membrane, and develop with a chemiluminescence imager.

[0040] The results showed that the expression level of ZDHHC11 was significantly increased under the conditions of equal amount of plasmid transfection ( Figure 2 ). This indicates that the ZDHHC11 overexpression plasmid was overexpressed in the transfected cells.

[0041] 3. MTT assay to detect the effect of overexpression of ZDHHC11 on lung cancer cell viability

[0042] Healthy A549 and PC-9 cells were seeded into 96-well plates at a density of 3,000-5,000 cells per well. Plasmid transfection was then performed after 18-24 hours of cell attachment. Plasmid transfection procedures were performed according to the Lipofectamine 2000 instructions. 48 hours after transfection, 20 μL of MTT solution (5 mg / mL) was added to each well of the 96-well plate. The plates were incubated at 37°C for 4 hours. The solution in each well was carefully discarded, taking care not to aspirate any crystals at the bottom. 150 μL of DMSO solution was added to each well. The plates were shaken at low speed for 10 minutes. The absorbance at 490 nm was measured using a microplate reader.

[0043] The results showed that overexpression of ZDHHC11 could inhibit the viability of lung cancer cells in a gradient-dependent manner ( Figure 3 ).

[0044] 4. Flow cytometry detection of the effect of overexpression of ZDHHC11 on apoptosis of lung cancer cells

[0045] A549 and PC-9 cells in good condition were cultured at 3 × 10 5 -4×10 5 Cells were seeded into a medium dish and transfected with plasmids 18-24 hours later, following the instructions for Lipofectamine 2000. 48 hours after transfection, floating cells and adherent cells were collected from the culture medium and combined for staining. For adherent cells, trypsin was used to disintegrate the cells with EDTA-free trypsin. After digestion, the cells were harvested and centrifuged at 1000 rpm for 5 minutes in a pre-cooled 4°C centrifuge. The supernatant was discarded. The cell pellet was washed twice with pre-cooled PBS at 4°C, centrifuged at 1000 rpm for 5 minutes each time at 4°C, and the supernatant was discarded. Resuspend the cells in 100 μL of 1× Binding buffer and gently pipette to a single-cell suspension. Add 5 μL of Annexin V-FITC and 5 μL of PI, mixing gently. Incubate at room temperature in the dark for 10 minutes. Add 400 μL of 1× Binding buffer and transfer the sample to be analyzed to a flow cytometer. Analyze on a flow cytometer within 1 hour. The flow cytometer used an excitation wavelength of 488 nm and detection was performed using the FL1 and FL3 channels. The number of cells collected was set to 20,000, and cross-gating was performed based on the positive and negative limits of the FITC and PI fluorescence parameters. Cells were divided into three subpopulations: double-negative cells were viable; single-positive cells with Annexin V-FITC were early apoptotic cells; and double-positive cells with Annexin V-FITC and PI were late apoptotic cells. The final apoptosis rate was calculated based on both the early and late apoptosis rates.

[0046] The results showed that overexpression of ZDHHC11 could promote apoptosis of lung cancer cells in a gradient-dependent manner ( Figure 4 ).

[0047] 5. Observation of changes in cell migration ability before and after transfection using Transwell chamber

[0048] A549 and PC-9 cells in good condition were cultured at 2 × 10 5 Cells were seeded into six-well plates and plasmid transfection was performed 18-24 hours later. The plasmid transfection steps were carried out according to the instructions of Lipofectamine 2000. The experimental group cells after lipofectamine transfection, the negative control group cells and the untransfected cells were digested with 0.25% trypsin, and the cells were counted and resuspended in base medium. 200 μL of cell suspension was added to the chamber, and the cell number was 8×10 4 The lower chamber was filled with 600 μL of DMEM culture medium containing 15% fetal bovine serum, and the transfection was performed again according to the set groups. Incubate in an incubator at 37°C and 5% CO2 for 48 hours. After the incubation, remove the chamber, wash twice with PBS, gently wipe the attached cells on the inner side of the upper chamber filter membrane with a cotton swab, and wash twice with PBS. Fix the chamber filter membrane with 4% paraformaldehyde for 10 minutes, aspirate the fixative, add 800 μL of crystal violet stain to each well, stain for 5 minutes, aspirate the staining solution, wash three times with PBS, remove the upper chamber, and dry naturally. Take pictures under an upright fluorescence microscope and count the number of cells migrating on the back of the membrane. Count three random fields of view in the central and peripheral parts of each membrane and calculate the average value.

[0049] The results showed that overexpression of ZDHHC11 could inhibit the migration ability of lung cancer cells in a gradient-dependent manner ( Figure 5 ).

[0050] 6. Effect of stable overexpression of ZDHHC11 on cell proliferation

[0051] 6.1. Hygromycin working concentration screening

[0052] The constructed pCMV3.1(+)-Flag-ZDHHC11 overexpression plasmid carries the hygromycin selection marker, allowing for pressure selection using this antibiotic. However, cell resistance to hygromycin varied. Therefore, prior to the experiment, the original cells were treated with the drug to determine the working hygromycin selection concentration, using a series of concentrations as described below. Six-well plates were plated with PC-9 cells and cultured in a medium containing a gradient of hygromycin concentrations of 0, 300, 600, 900, 1200, and 1500 μg / mL. After three cycles of drug treatment, the cell culture medium was changed every three days, and cell survival was monitored. After approximately one week, no cells survived the hygromycin treatment at a concentration of 1200 μg / mL. Therefore, a final hygromycin concentration of 400 μg / mL was determined as the final selection concentration.

[0053] 6.2 Screening of ZDHHC11 Stable Overexpression Cell Lines

[0054] After determining the working concentration of hygromycin, the overexpression plasmid was transfected into the cells according to the instructions of Lipofectamine 2000. 2 μg of plasmid was transfected into the cells. After the cells grew normally and attached to the wall, they were cultured in a selection medium containing 1200 μg / mL hygromycin. After a period of culture, the cells were divided into single clones by limiting dilution method, observed and labeled, and these single cell clusters were expanded and cultured to detect their protein expression levels. Finally, an overexpression cell line was obtained and named EO-1 ( Figure 6 A).

[0055] 6.3. Clone Formation Assay to Detect the Proliferation Ability of ZDHHC11 Stably Overexpressing Cell Lines

[0056] First, plate well-maintained PC-9 and EO-1 cells evenly into 6-well plates at a density of 200-300 cells per well. Culture in an incubator, replacing the culture medium every few days until most colonies within the wells have grown to an appropriate size. Remove the culture medium from the 6-well plate and rinse once with PBS. Add 1 mL of 4% paraformaldehyde to each well and refrigerate at 4°C for 30 minutes to fix the cells. Aspirate the cells. After fixation, add 1 mL of PBS to each well to remove any residual paraformaldehyde. Then, add 1 mL of the prepared 0.1% crystal violet solution to each well. Allow the cells to stand at room temperature for 10 minutes, then rinse several times with ultrapure water to remove any excess crystal violet. Allow the cells to dry at room temperature before photographing.

[0057] The results showed that the proliferation ability of ZDHHC11 stably transfected cell lines was weakened compared with wild-type cells ( Figure 6 B. Figure 6 C).

[0058] 7. Effect of ZDHHC11 knockout on cell viability

[0059] 7.1. Construction of ZDHHC11 knockout plasmid

[0060] According to the CRISPR-Cas9 technology requirements, sgRNA was designed for the exons of the ZDHHC11 gene. After comparing various parameters such as the off-target and effectiveness of the sequence, two sgRNAs were selected for the experiment ( Figure 7 A). The sequence information of sgRNA is as follows:

[0061] sgRNA1:CACCGCAATGTATTTCCACGCG

[0062] sgRNA2: CACCGAAGGGAATGAAGATCCCGA

[0063] The constructed single-stranded sgRNA was then annealed with double-stranded oligonucleotides and connected to the vector px459 digested with BpiⅠ, and transformed into Escherichia coli for positive clone identification. After sequencing verification, a recombinant knockout plasmid was obtained. Next, the function of the knockout plasmid was verified. The two sgRNA plasmids targeting ZDHHC11 were transfected into PC-9 cells respectively, and after one round of screening using DMEM medium containing puromycin, the cells were collected to detect the expression level of ZDHHC11. The results of the immunoblotting experiment showed that both sgRNA1 and sgRNA2 had a knockdown effect, and subsequent stable screening of knockout cell lines ( Figure 7 B).

[0064] 7.2 Screening of ZDHHC11 Knockout Cell Lines

[0065] The two sgRNA plasmids were transfected into PC-9 cells according to the instructions of Lipofectamine 2000. After about 3 weeks of pressure selection in a puromycin-containing medium, the cells were isolated by limiting dilution. After the monoclonal cell selection and expansion culture experiments, multiple monoclonal cells were collected for immunoblotting to verify the expression of ZDHHC11 protein ( Figure 7 C). After repeated verification, a ZDHHC11 knockout monoclonal cell line was finally obtained and named PAU-5. The results of immunoblotting ( Figure 7 D). After extracting the cell genome, PCR amplified the ZDHHC11 genomic sequence containing the sgRNA1 target region. After sequencing and comparison, it was found that the corresponding sequence in the first exon of ZDHHC11 was edited compared to the original sequence in PC-9 cells, missing one base, resulting in an early stop codon ( Figure 7 E).

[0066] 7.3. MTT assay for cell viability of ZDHHC11 knockout cell lines

[0067] PC-9 and PAU-5 cells in good condition were seeded into 96-well plates with the same number of cells per well (about 3000). After 48h and 72h, 20μL of MTT solution (5mg / mL) was added to each well of the 96-well plate and placed in a 37°C incubator for 4h. The solution in each well was carefully discarded, and care was taken not to absorb the crystals at the bottom. 150μL of DMSO solution was added to each well, and the plate was placed on a shaker for low speed shaking for 10min. The absorbance value at a wavelength of 490nm was detected using a microplate reader. The results showed that the cell viability of the ZDHHC11 knockout cell line was higher than that of the wild-type cell line ( Figure 8 ).

[0068] 3. Conclusion

[0069] The ZDHHC11 gene can be used as a new target for the treatment of NSCLC. This gene can affect the proliferation, migration and apoptosis of NSCLC and has potential application value in the treatment of NSCLC.

[0070] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. ZDHHC11 The use of a gene in preparing a drug for treating non-small cell lung cancer is characterized in that: pass ZDHHC11 Overexpression of the gene increases the level of ZDHHC11 protein, thereby inhibiting the proliferation and migration ability of non-small cell lung cancer cells and promoting their apoptosis. ZDHHC11 The NCBI accession number of the gene is 79844, and the sequence of the encoded ZDHHC11 protein is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that described ZDHHC11 Overexpression of genes ZDHHC11 Transient or stable overexpression of a gene.

3. ZDHHC11 The use of a gene overexpression recombinant plasmid in the preparation of a drug for treating non-small cell lung cancer is characterized in that: described ZDHHC11 The recombinant plasmid for gene overexpression was ZDHHC11 Gene and pCMV expression vector were constructed, ZDHHC11 The NCBI accession number of the gene is 79844, and the sequence of the encoded ZDHHC11 protein is shown in SEQ ID No. 1.

Images