Application of TREM2 in preparation of medicine for treating temporomandibular joint osteoarthritis

Abstract

The invention discloses application of TREM2 in preparation of a medicine for treating temporomandibular joint osteoarthritis, and belongs to the field of biological medicine. Animal experiments and in-vitro cell experiment researches prove that expression of tight connection between macrophages and maintenance of joint synovial barrier homeostasis can be promoted by activating TREM2 factors in synovial macrophages, so that the progress of temporomandibular joint osteoarthritis is relieved. Based on the function of the TREM2, the invention provides the application of the TREM2 in preparation of the medicine for treating the temporomandibular joint osteoarthritis, and a new thought is provided for clinical treatment of the temporomandibular joint osteoarthritis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the application of TREM2 in the preparation of a drug for treating temporomandibular joint osteoarthritis. Background Art

[0002] Osteoarthritis of the temporomandibular joint is a common clinical disease with progressive synovial inflammation, condylar cartilage degeneration and even destruction as the main pathological features. It can cause joint pain, murmurs and even limited mouth opening, which greatly affects the quality of life of patients and imposes a significant economic burden on the families of patients. In the pathological process of osteoarthritis, the destruction of the homeostasis of the synovial barrier can aggravate synovial inflammation and inflammatory exudation of synovial tissue, thereby aggravating the damage and degeneration of articular cartilage. The synovial barrier is a layer of tightly packed CX3CR1 located in the lining layer of the synovial tissue of the joint. + Macrophages and tight junctions between cells provide a natural protective barrier for joint tissues, which is beneficial for maintaining fluid balance and homeostasis in the joint cavity. Currently, temporomandibular joint osteoarthritis is mainly treated with palliative conservative treatments, which can relieve joint pain and improve the quality of life of patients by inhibiting synovial inflammation. However, there is still a lack of better radical strategies. Summary of the invention

[0003] The purpose of the present invention is to provide the use of TREM2 in the preparation of a drug for treating osteoarthritis of the temporomandibular joint in response to the problems in the background technology. Animal experiments and in vitro cell experiments have confirmed that by activating the TREM2 factor in synovial macrophages, the expression of tight junctions between macrophages can be promoted to maintain the homeostasis of the synovial barrier of the temporomandibular joint, thereby alleviating degenerative lesions of the condylar cartilage.

[0004] The purpose of the present invention is achieved through the following technical solutions:

[0005] The use of the TREM2 gene as a target in screening drugs for treating temporomandibular joint osteoarthritis. The screening includes any one or more of the following: screening for substances that can promote TREM2 expression, screening for substances that can activate or enhance TREM2 activity.

[0006] Use of TREM2 protein or biomaterials expressing TREM2 protein in the preparation of drugs for treating temporomandibular joint osteoarthritis.

[0007] The biological material expressing the TREM2 protein includes any one or more of the following A1) to A5):

[0008] A1) a nucleic acid molecule encoding a TREM2 protein;

[0009] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0010] A3) an expression vector containing the nucleic acid molecule described in A1), or an expression vector containing the expression cassette described in A2); the expression vector includes a lentiviral vector;

[0011] A4) a recombinant virus containing the nucleic acid molecule described in A1), or a virus containing the expression cassette described in A2); the recombinant virus includes a recombinant lentivirus;

[0012] A5) A recombinant cell containing the nucleic acid molecule described in A1), or a recombinant cell containing the expression cassette described in A2), or a recombinant cell containing the expression vector described in A3).

[0013] The drug for treating osteoarthritis of the temporomandibular joint achieves the treatment of osteoarthritis of the temporomandibular joint by at least one of the following effects: promoting tight junctions between synovial macrophages of the temporomandibular joint, and promoting the homeostasis of the synovial barrier of the temporomandibular joint. That is, the drug is a drug that promotes tight junctions between synovial macrophages of the temporomandibular joint, or a drug that promotes the homeostasis of the synovial barrier of the temporomandibular joint.

[0014] The present invention has the following beneficial effects: the present invention confirms in in vivo and in vitro experiments that TREM2 can promote macrophage tight junctions and maintain the homeostasis of the synovial barrier to alleviate the progression of temporomandibular joint osteoarthritis, provides the application of TREM2 in the preparation of drugs for temporomandibular joint osteoarthritis, and provides new ideas for the clinical treatment of temporomandibular joint osteoarthritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a detection diagram of tight junctions between cells of macrophages cultured in vitro in Example 1 after being transfected with Lv-Trem2 lentivirus.

[0016] Figure 2 This is a picture showing the synovial lining layer and tight junction detection of the mouse animal model in Example 2 after intra-articular Lv-Trem2 lentivirus injection.

[0017] Figure 3 This is a graph showing the degree of condylar cartilage degeneration in the mouse animal model in Example 2 after intra-articular Lv-Trem2 lentivirus injection. DETAILED DESCRIPTION

[0018] In order to better understand the present invention, the present invention will be further described in detail below in conjunction with embodiments and drawings.

[0019] Example 1 TREM2 overexpression promotes tight junctions between macrophages

[0020] (1) In vitro culture and induction of M1 macrophages: RAW264.7 monocytes were cultured in DMEM medium containing 10% fetal bovine serum, and 100 ng / mL LPS combined with 20 ng / mL IFN-γ were used to induce RAW264.7 monocytes for 24 hours.

[0021] (2) Construction of the TREM2-overexpressing lentivirus Lv-Trem2: Shanghai Jikai Gene Chemical Technology Co., Ltd. was commissioned to construct the lentivirus Lv-Trem2. The specific process is as follows. First, the target TREM2 gene fragment (ATGGGACCTCTCCACCAGTTTCTCCTGCTGCTGATCACAGCCCTGTCCCAAGCCCTCA, SEQ ID NO.1) was synthesized by PCR, and then the vector GV492 was digested with restriction endonucleases to obtain a linearized vector, and the synthesized PCR product was exchanged, transformed and identified with the linearized vector, and further plasmid extraction was performed; finally, the constructed GV492 plasmid carrying the TREM2 gene fragment was co-transfected with the lentivirus packaging auxiliary plasmids Helper 1.0 and Helper 2.0 into 293T cells, and the lentivirus Lv-Trem2 was harvested and then concentrated, purified and quality tested.

[0022] Table 1 Primers for obtaining TREM2 gene fragments

[0023]

[0024] Primer description: Contains exchange pairing bases, restriction sites, and partial sequence at the 5' end of the target gene for PCR fishing of the target gene.

[0025] (3) Lv-Trem2 lentivirus transfection: Lv-Trem2 lentivirus was diluted to MOI = 20 using serum-free DMEM medium, and an appropriate amount of transfection agent was added. Then, the medium for culturing M1 macrophages was replaced with DMEM medium containing lentivirus and transfection agent.

[0026] (4) Changing the medium and subculturing after lentiviral transfection: 18 hours after lentiviral transfection, the transfection medium was replaced with DMEM medium containing 10% fetal bovine serum and culture was continued; when the cultured cells reached a polymerization degree of about 80%, M1 macrophages were subcultured by pipetting.

[0027] (5) Detection of tight junctions between cells: The expression of tight junction protein Occludin in transfected M1 macrophages was detected by immunocytofluorescence method.

[0028] M0 Raw246.7 cells (M0) or M1-induced Raw246.7 cells (M1) were transfected with TREM2 overexpression lentivirus (Lv-Trem2) or its control lentivirus (Lv-vector), and the expression of intercellular tight junction protein Occludin was detected by immunofluorescence, and the average fluorescence intensity of Occludin was used for statistical analysis. Figure 1 As shown, compared with the 1st and 3rd groups (M0+Lv-vector, M1+Lv-Trem2), the tight junction proteins between Raw246.7 macrophages after M1 induction were significantly reduced; compared with the 3rd and 4th groups (M1+Lv-vector, M1+Lv-Trem2), it can be seen that TREM2 overexpression can upregulate the expression of tight junction proteins between M1-type Raw246.7 macrophages, indicating that TREM2 overexpression can reverse the destructive effect of M1 induction on tight junction proteins between Raw246.7 macrophages.

[0029] Example 2 TREM2 overexpression alleviates temporomandibular joint osteoarthritis in mice

[0030] (1) Construction of a mouse model of temporomandibular joint osteoarthritis (TMJOA): 8-10 week old C57BL mice were anesthetized with isoflurane inhalation. The bilateral temporomandibular joints were disinfected with iodine tincture, and 0.4 mg / 20 μL of sterile sodium iodoacetate (MIA) solution was injected into the bilateral joint cavities using the anterosuperior needle insertion method. An equal amount of normal saline was injected as a control.

[0031] (2) Constructing a TREM2 overexpressing lentivirus using the same construction method as in Example 1.

[0032] (3) Intra-articular injection of Lv-Trem2 lentivirus: One week after modeling, the mice were anesthetized with isoflurane inhalation, and the bilateral temporomandibular joint areas were disinfected with iodine. 10 μL of 1.0E+08TU / mL Lv-Trem2 lentivirus solution was injected into the bilateral joint cavities using the anterosuperior needle insertion method. The control group was injected with an equal amount of Lv-vector lentivirus solution. The injections were maintained once a week for 3 weeks.

[0033] (4) Pathological detection of the temporomandibular joint of mice: Four weeks after modeling, mice were killed by carbon dioxide inhalation. The temporomandibular joint tissues on both sides were collected and fixed, decalcified, dehydrated, embedded, and sectioned. Histological staining was then used to detect the degree of inflammation of the synovial tissue of the temporomandibular joint and degeneration of the condylar cartilage of the mice.

[0034] Immunohistofluorescence was used to detect the expression of tight junction protein Occludin and synovial barrier marker CX3CR1 in joint synovial tissue, and the positive cell rates of Occludin and CX3CR1 in the synovial lining layer of mice were statistically analyzed. Figure 2 As shown, compared with groups 1 and 2 (Saline+Lv-vector, MIA+Lv-vector) (figure *), the expression of tight junction proteins between macrophages in the synovial lining layer of TMJOA mice induced by MIA injection was significantly reduced, and the synovial barrier was destroyed; compared with groups 2 and 3 (MIA+Lv-vector, MIA+Lv-Trem2) (figure #), it can be seen that Lv-Trem2 injection for TREM2 overexpression can increase the expression of tight junction proteins between macrophages in the synovial lining layer of TMJOA mice and promote synovial barrier homeostasis, indicating that TREM2 overexpression can alleviate the effects of MIA injection on the expression of tight junction proteins between macrophages in the synovial lining layer and the synovial barrier of mice.

[0035] Histological safranin-fast green and toluidine blue staining were used to detect the degree of articular cartilage degeneration, and the Mankin OA score and toluidine blue staining percentage were used for statistical analysis. Figure 3As shown, compared with groups 1 and 2 (Saline+Lv-vector, MIA+Lv-vector) (figure *), the Mankin OA score of TMJOA mice induced by MIA injection was significantly increased and the percentage of toluidine blue staining was significantly decreased; compared with groups 2 and 3 (MIA+Lv-vector, MIA+Lv-Trem2) (figure #), it can be seen that TREM2 overexpression by Lv-Trem2 injection can reduce the degree of increase in Mankin OA score of TMJOA mice and increase the percentage of toluidine blue staining, indicating that TREM2 overexpression can alleviate the degree of degeneration of articular cartilage in mice induced by MIA injection.

[0036] It should be understood that the above embodiments are only used to help illustrate the present invention. The methods of overexpressing Lv-Trem2 in the present invention include but are not limited to the above-mentioned lentiviral forms. Other modifications, improvements or applications made by other technicians based on the above conception without departing from the spirit of the present invention, as well as other solutions obtained without creative work, are all included in the protection scope of the present invention.

Claims

1. Application of TREM2 gene as a target in screening drugs for the treatment of temporomandibular joint osteoarthritis.

2. The use according to claim 1, characterized in that: The screening includes any one or more of the following: screening for substances that can promote TREM2 expression, screening for substances that can activate or enhance TREM2 activity.

3. Application of TREM2 protein in the preparation of drugs for the treatment of temporomandibular joint osteoarthritis.

4. Application of biomaterials expressing TREM2 protein in the preparation of drugs for the treatment of temporomandibular joint osteoarthritis.

5. The use according to claim 4, characterized in that: The biological material expressing the TREM2 protein includes any one or more of the following A1) to A5): A1) a nucleic acid molecule encoding a TREM2 protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) an expression vector containing the nucleic acid molecule described in A1), or an expression vector containing the expression cassette described in A2); A4) a recombinant virus containing the nucleic acid molecule described in A1), or a recombinant virus containing the expression cassette described in A2); A5) A recombinant cell containing the nucleic acid molecule described in A1), or a recombinant cell containing the expression cassette described in A2), or a recombinant cell containing the expression vector described in A3).

6. The use according to claim 5, characterized in that: The expression vector comprises a lentiviral vector.

7. The use according to claim 5, characterized in that: The recombinant virus includes a recombinant lentivirus.

8. The use according to any one of claims 1 to 7, characterized in that: The drug achieves the treatment of temporomandibular joint osteoarthritis by at least one of the following effects: promoting tight junctions between synovial macrophages of the temporomandibular joint and promoting the homeostasis of the synovial barrier of the temporomandibular joint.

9. The use according to any one of claims 1 to 7, characterized in that: The medicine is a medicine for promoting tight junction between synovial macrophages of the temporomandibular joint.

10. The use according to any one of claims 1 to 7, characterized in that: The drug is a drug for promoting the homeostasis of the synovial barrier of the temporomandibular joint.

Images