A kind of Trichoderma and its application in degrading straw cellulose

Abstract

The present invention belongs to the technical field of microbial fermentation, and specifically relates to a Trichoderma sp. and its application in degrading straw cellulose. The deposit number of the Trichoderma sp. is CGMCC No. 40954. The enzyme liquid obtained by fermenting the substrate by the Trichoderma sp. has the ability to effectively decompose the fiber decomposing enzyme of crop straw or wheat bran and other feeds with high yield, which helps to meet the demand for fiber decomposing enzymes in animal husbandry production and promote the effective utilization of fiber materials in feeds.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial fermentation, and particularly relates to Trichoderma and application thereof in degrading straw cellulose. Background Art

[0002] In animal husbandry, feed digestibility plays a vital role in the growth and health of livestock and poultry. Although the rumen of ruminants contains a variety of microorganisms that can decompose plant fibers, the complex fiber structure of straw often limits the effective degradation of microorganisms, resulting in its rumen digestibility usually less than 50%. This low digestibility not only causes a waste of resources, but also increases breeding costs.

[0003] To address this challenge, the livestock and feed industries have adopted a variety of strategies to improve the efficiency of animal utilization of straw plant fibers, one of which is to use cellulolytic enzyme preparations to pre-digest roughage. These enzyme preparations mainly include cellulases and hemicellulases, which can promote the degradation of plant fibers as adjuvants and further assist the digestive tract to digest the feed after the animal eats it. This helps to improve the digestibility and utilization of the feed, thereby having a positive impact. However, the application of cellulases and hemicellulases in livestock husbandry still faces some challenges, including enzyme activity, stability, substrate specificity, and production and application costs. In particular, whether the selected cellulolytic enzyme can effectively degrade straw is a key factor worthy of in-depth consideration. Therefore, these factors need to be considered comprehensively to ensure that the application of enzyme preparations can achieve the desired effect and bring practical economic and environmental benefits to the livestock industry.

[0004] Trichoderma is a fungus that is ubiquitous in the natural environment. It has a significant ability to degrade cellulose and is therefore considered an ideal strain for the efficient production of cellulolytic enzymes. Although a variety of strains capable of producing cellulolytic enzymes have been discovered, these strains still have some limitations in production efficiency, stability, and operating conditions. Therefore, it is necessary to find a new strain of Trichoderma that can not only efficiently produce cellulase but also exhibit excellent performance in animal husbandry applications, which has extremely high scientific research and practical application value. Summary of the invention

[0005] The present invention provides a new Trichoderma sp. strain named zt06, which has the ability to produce high-yield fiber decomposing enzymes that effectively decompose feeds such as crop straw or wheat bran. The research and application of the strain will help meet the demand for fiber decomposing enzymes in animal husbandry production and promote the effective utilization of fiber materials in feeds.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] The present invention provides a Trichoderma sp., whose deposit number is CGMCC No.40954.

[0008] Another aspect of the present invention provides an enzyme solution, which is obtained by fermenting the Trichoderma in the present invention.

[0009] In another aspect, the present invention provides a straw cellulose degradation system, which comprises the enzyme solution of the present invention, cellulose to be degraded and a citric acid-disodium hydrogen phosphate buffer solution.

[0010] In another aspect, the present invention provides a method for degrading straw cellulose, wherein the degradation system of the present invention is incubated in a shaking water bath.

[0011] In another aspect, the present invention provides a use of the Trichoderma of the present invention, the enzyme solution of the present invention, or the degradation system of the present invention in preparing ruminant feed.

[0012] The Trichoderma sp. in the present invention is deposited with a number of CGMCC No. 40954, the depository is the General Microbiology Center of the China Culture Collection Administration, the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit date is December 12, 2023.

[0013] The beneficial effects of the present invention include at least: the enzyme liquid obtained by fermenting the fermentation substrate with Trichoderma provided by the present invention has the ability to effectively decompose the fiber decomposing enzymes of feeds such as crop straw or wheat bran in high yield, which helps to meet the demand for fiber decomposing enzymes in animal husbandry production and promote the effective utilization of fiber materials in feeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The effect of different fermentation substrates on enzyme production of Trichodermasp.zt06;

[0015] Figure 2 The effect of corn straw concentration on enzyme production of Trichoderma sp.zt06;

[0016] Figure 3 The effect of pH on enzyme production of Trichodermasp.zt06;

[0017] Figure 4 The effect of nitrogen source on enzyme production of Trichodermasp.zt06;

[0018] Figure 5 To study the effect of adding sugars from different sources on the enzyme production of Trichoderma sp.zt06;

[0019] Figure 6The effect of fermentation time on enzyme production of Trichodermasp.zt06;

[0020] Figure 7 The effect of inoculation amount on enzyme production of Trichodermasp.zt06;

[0021] Figure 8 is the xylose standard curve;

[0022] Fig. 9 is the glucose standard curve;

[0023] Fig.10 The degradation enzyme activity of the crude enzyme solution of Trichoderma sp.zt06 strain on different substrates;

[0024] Fig.11 pH dependence of Trichodermasp.zt06 cellulolytic enzyme;

[0025] Fig.12 The temperature dependence of Trichodermasp.zt06 cellulolytic enzyme;

[0026] Fig.13 is the pH tolerance of Trichodermasp.zt06 cellulolytic enzyme;

[0027] Fig.14 The degradation of rice straw by Trichoderma sp. zt06 cellulolytic enzyme. DETAILED DESCRIPTION

[0028] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0029] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0030] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0031] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0032] The present embodiment provides a Trichoderma sp., whose deposit number is CGMCC No.40954.

[0033] The embodiment of the present invention also provides an enzyme solution, which is prepared by fermenting the Trichoderma in the present invention.

[0034] In some specific examples, the method for preparing the enzyme solution includes: culturing the fermentation substrate in a fermentation medium, then inoculating Trichoderma for fermentation, and centrifuging to obtain the enzyme solution.

[0035] In some specific examples, the preparation method may include one or more combinations of the following conditions: (a) the fermentation substrate includes one or more combinations of rice straw, wheat straw, wheat bran, bean straw or corn straw; (b) the fermentation medium includes a nitrogen source, yeast powder, MgSO 4 7H 2 O.KH 2 PO 4 and NaCl, wherein the nitrogen source is selected from one or more combinations of peptone, ammonium sulfate, ammonium chloride, urea or ammonium nitrate; (c) the concentration of the fermentation substrate is 9%-12%; (d) the pH of the fermentation medium is 5.5-7.5; (e) the fermentation time is 6d-7d; (f) the accession concentration of Trichoderma is 3×10 5 spores / ml.

[0036] In some specific examples, the fermentation substrate in the above condition (a) is corn stover; the nitrogen source in condition (b) is peptone; the concentration of the fermentation substrate in condition (c) is 10%; and the pH of the fermentation medium in condition (d) is 6.

[0037] The embodiment of the present invention further provides a straw cellulose degradation system, which comprises the enzyme solution of the present invention, cellulose to be degraded and a citric acid-disodium hydrogen phosphate buffer solution.

[0038] It should be noted that, in the degradation system of the present invention, 1 mL of the degradation system includes 300 μL of enzyme solution + 5% (ie 0.05 g) of straw cellulose to be degraded (such as rice straw).

[0039] In some specific examples, the above-mentioned degradation system includes one or more of the following features: (a) the cellulose to be degraded includes one or more of xylan, sodium carboxymethyl cellulose and microcrystalline cellulose; (b) the pH of the citric acid-disodium hydrogen phosphate buffer is 3-8.

[0040] In some specific examples, the pH of the citric acid-disodium hydrogen phosphate buffer in the above degradation system is 4-5, such as 4 or 5.

[0041] In another aspect, the present invention provides a method for degrading cellulose using straw, comprising incubating the degradation system of the present invention in a shaking water bath.

[0042] In some specific examples, the above method includes one or more of the following features: (a) the incubation temperature is 30°C-70°C, such as 40°C, 50°C or 60°C, etc.; (b) the cellulose comes from rice straw.

[0043] The embodiment of the present invention further provides a method for improving rumen fermentation of rice straw, comprising pretreating the rice straw using the method for degrading cellulose of the present invention.

[0044] The embodiment of the present invention also provides a use of the Trichoderma of the present invention, the enzyme solution of the present invention, or the degradation system of the present invention in preparing ruminant feed.

[0045] In the following examples, the enzyme activity was determined according to the following method: 700 μL of citric acid-disodium hydrogen phosphate buffer (pH 6.0) and 0.05 g of substrate (straw) were added to a 2 mL centrifuge tube, and then 300 μL of enzyme solution was added, and incubated at 40° C. for 2 h; after the test, the reducing sugar content in the reaction solution was determined using an alkaline 3,5-dinitrosalicylic acid (DNS) reagent, and the reducing sugar concentration was calculated with reference to the glucose standard curve; one enzyme activity unit (IU) was defined as the amount of enzyme required to release 1 μmol of reducing sugar within 1 min under specific conditions.

[0046] 1. Isolation and identification of Trichoderma sp. zt06

[0047] Example 1 Source of Trichoderma sp. zt06

[0048] The Trichoderma in the present invention is derived from rotten branches and leaves in a grove on the campus of Jiangxi Agricultural University in Nanchang, Jiangxi Province.

[0049] Take out a small part from the rotten branches and leaves, and put it into a PDA medium (put 200g peeled potato pieces into a pot, add 1000ml of water, heat to boiling, maintain for 20-30min, filter with 2 layers of gauze while hot, and discard the residue; add water to the filtrate to 1000ml; add 20g glucose and 15g agar, dissolve and sterilize by high pressure) plate, after the mycelium grows, pick the mycelium on the edge or obviously abnormal, inoculate it into a new PDA medium plate, transfer it repeatedly for several times (not less than 5 times) for preliminary purification; then pick the mycelium to liquid culture medium (10g peptone, 0.5g yeast powder, 1g KHPO4, 0.2g MgSO4·7HO, 10g NaCl, add distilled water to 1000mL, pH 6.5) for culture, and perform enzyme activity determination to pick out strains with enzyme activity. Finally, inoculate it onto a potato culture medium plate, and continue to repeatedly pick the mycelium for purification to obtain Trichoderma sp. zt06.

[0050] The ITS sequence amplified using the universal primers ITS4 and ITS5 for fungi is as follows:

[0051] AACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCC

[0052] AAACCCAATGTGAACGTTACCAAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGT

[0053] CGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCC

[0054] CTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGA

[0055] ATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT

[0056] GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGC

[0057] GCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTC

[0058] CGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCTCCGAAATACA

[0059] GTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGC

[0060] GGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGG

[0061] AATACCCGCTGAACTTAAGCATAT.

[0062] 2. Optimization of enzyme production conditions of Trichoderma sp.zt06

[0063] (I) Effects of different fermentation substrates on enzyme production by Trichoderma sp. zt06

[0064] Rice straw, wheat straw, wheat bran, bean straw, and corn straw were used as fermentation substrates at a mass fraction of 2% (2% of the fermentation medium) to prepare 50 mL of fermentation medium (containing 1.0 g of peptone, 0.5 g of yeast powder, and MgSO 4 7H 2 O 0.2g, KH 2 PO 4 1g, NaCl 10g, pH 6.5) were added into a 250mL conical flask and pressurized at 108℃ for 30min; the PDA culture medium block with Trichoderma sp.zt06 hyphae was inoculated and cultured in a shaking incubator at 30℃ for 5 days; the crude enzyme solution was obtained by centrifugation, and the enzyme activity of the crude enzyme solution was analyzed using rice straw as the degradation substrate; 3 biological replicates were set for each group.

[0065] The results are as follows Figure 1 As shown, when corn stover was used as liquid fermentation substrate, Trichoderma sp.zt06 strain had the strongest enzyme production ability, followed by wheat bran, wheat straw, rice straw and bean straw as liquid fermentation substrates.

[0066] (II) Effect of substrate concentration on enzyme production

[0067] Corn straw was selected as the substrate, and the composition of the culture medium remained unchanged. The substrate concentration was set at 1%-12% (the mass of corn straw in the liquid culture medium (containing 1.0 g peptone, 0.5 g yeast powder, MgSO per liter) and 1.2% MgSO per liter). 4 7H 2 O 0.2g, KH 2PO 4 1g, NaCl 10g, pH 6.5), the pH was adjusted to 6.5, and the culture was carried out at 30°C and 100rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation; 3 biological replicates were set for each group; and the cellulase activity of the crude enzyme solution was determined according to the above method.

[0068] The results are as follows Figure 2 As shown, the results showed that in the two concentration value tests of 1%-5% and 5%-9%, the enzyme activity of the crude enzyme solution of Trichoderma sp.zt06 strain increased with the increase of corn straw concentration; while at the corn straw fermentation concentration of 9%-12%, the enzyme activity of Trichoderma sp.zt06 strain no longer increased with the concentration, among which the enzyme activity was the highest at 10%, and at 11%-12%, the enzyme activity decreased significantly, and the enzyme activity shown was not much different.

[0069] (III) Optimization of initial pH value of fermentation

[0070] Corn stalks were selected as the basic fermentation substrate, the substrate concentration was set to 10%, the fermentation medium composition remained unchanged, the medium pH was adjusted to 5.5, 6.0, 6.5, 7.0 and 7.5, and cultured at 30°C and 100 rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation, and the cellulase activity of the crude enzyme solution was determined according to the above method.

[0071] The results are as follows Figure 3 As shown, at pH = 6.0, the crude enzyme solution exhibits the strongest enzyme activity, while at other pH conditions, the enzyme activity is also relatively strong, all reaching more than 80% of that at pH 6.0.

[0072] (IV) Nitrogen source optimization

[0073] Ammonium sulfate, ammonium chloride, urea and ammonium nitrate were selected as alternative inorganic nitrogen sources, and the nitrogen content of each was determined; on the basis of the optimal culture conditions determined in the above experiment (corn straw was selected as the substrate, the substrate concentration was 10%, and the pH was 6.0), according to isonitrogenous balance, the peptone in the fermentation medium was replaced with these four inorganic nitrogen sources respectively; the culture was carried out at 30°C and 100rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation, and the cellulase activity of the crude enzyme solution was determined according to the above method.

[0074] The results are as follows Figure 4 As shown in the figure, when peptone was used as the nitrogen source, the enzyme activity was the highest. After changing to ammonium nitrate, the enzyme activity was only about 70% of that of peptone. The other three groups had the worst effects. Compared with the peptone group, their enzyme activities were all below 60%, namely 53.44%, 50.69% and 52.04% respectively.

[0075] 5. Effects of sugar from different sources

[0076] On the basis of the optimal culture conditions determined in the above experiment (corn straw was selected as the substrate, the substrate concentration was 10%, and the pH was 6.0), 1% of each of the five high-quality sugar sources, namely glucose, fructose, sucrose, maltose and galactose, was additionally added. Other conditions remained unchanged. The culture was carried out at 30°C and 100 rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation. The cellulase activity of the crude enzyme solution was determined according to the above method.

[0077] The results are as follows Figure 5 As shown, compared with the group without additives, sugars from five different sources could not increase the enzyme production level of Trichoderma sp. zt06 strain, but instead inhibited it; among them, sucrose and galactose had less effect, with the enzyme activity being about 80% of that in the group without additives, but wine, fructose and galactose all had a strong inhibitory effect, with the enzyme activity only reaching about 20% of that in the group without additives.

[0078] (VI) Fermentation time optimization

[0079] On the basis of the optimal culture conditions determined in the above experiment (corn straw was selected as the substrate, the substrate concentration was 10%, and the pH was 6.0), the culture components were kept unchanged, and only the culture time was changed. At 30°C and 100rpm, the cultures were cultured for 3d, 4d, 5d, 6d, and 7d, respectively; after the culture period, the crude enzyme solution was obtained by centrifugation, and the cellulase activity of the crude enzyme solution was determined according to the above method.

[0080] The results are as follows Figure 6 As shown in the figure, during these five time periods, the enzyme activity showed a general trend of increasing with the increase of time, among which the enzyme activity was relatively weak at 3d-5d; but when the fermentation time was extended to more than 6d, the enzyme activity tended to be flat, and the enzyme activity was strongest at the 6th and 7th days.

[0081] (VII) Optimization of inoculation volume

[0082] On the basis of the optimal culture conditions determined in the above experiment (choosing corn stalks as the substrate, the substrate concentration was 10%, and the pH was 6.0), the culture conditions were kept unchanged and cultured for 6 days; 0.2%, 0.4%, 0.6%, 0.8% and 1.0% (suspension and liquid culture medium (containing 1.0 g of peptone, 0.5 g of yeast powder, and MgSO per liter) were inoculated respectively. 4 7H 2 O 0.2g, KH 2 PO 4 1g, NaCl10g, pH 6.5) (volume ratio) of spore suspension (spore concentration of 1.5×10 8After the culture is completed, the crude enzyme solution is obtained by centrifugation, and the cellulase activity of the crude enzyme solution is determined according to the above method.

[0083] Results Figure 7 As shown in the figure, with the increase of inoculation amount, the enzyme activity of crude enzyme solution showed a downward trend and gradually tended to be flat.

[0084] In summary, the culture scheme for enzyme production of Trichoderma sp. zt06 is as follows: on the basis of the fermentation medium, the initial pH is adjusted to 6.0, and 10% corn stalks are added as the fermentation substrate, and the final concentration of inoculation is 3×10 5 spores / ml, fermented for 6-7 days. III. Analysis of the enzymatic properties of Trichoderma sp.zt06 cellulolytic enzyme

[0085] (I) Substrate specificity

[0086] The reaction system is 1 mL, and the substrates to be degraded are 1% (i.e. 0.01 g) of xylan, 1% (i.e. 0.01 g) of sodium carboxymethyl cellulose (CMC-Na), 1% (i.e. 0.01 g) of microcrystalline cellulose and 1% (i.e. 0.01 g) of chitosan, respectively. 50 μL of crude enzyme solution is added, and the rest is made up with pH 6.0 citric acid-disodium hydrogen phosphate buffer; put it in a shaking water bath at 40°C and incubate for 30 minutes. After the reaction is completed, the released reducing sugar is measured. Except for the xylan substrate, the xylose standard curve (see Figure 8 ) to calculate reducing sugar concentration, the other three were calculated based on the glucose standard curve (see Fig. 9 ) to calculate the reducing sugar concentration.

[0087] The results are as follows Fig.10 As shown, the crude enzyme solution of Trichoderma sp.zt06 strain has the ability to specifically and efficiently degrade CMC, followed by xylan; it has weaker degradation activity for microcrystalline cellulose, but has no degradation activity for chitosan.

[0088] (II) pH dependence

[0089] According to the above test, xylan, sodium carboxymethyl cellulose and microcrystalline cellulose were selected for property analysis; 1 mL was used as the reaction system, including 50 μL of crude enzyme solution, 1% substrate (xylan, sodium carboxymethyl cellulose and microcrystalline cellulose) and citric acid-disodium hydrogen phosphate buffer of different pH, placed in a shaking water bath at 40°C, incubated for 30 minutes, and the released reducing sugar was measured after the reaction.

[0090] The results are as follows Fig.11As shown, the optimum pH values ​​of the enzyme systems in the crude enzyme solution of Trichoderma sp. zt06 strain that can degrade xylan, sodium carboxymethyl cellulose and microcrystalline cellulose are 5, 4 and 4, respectively; among them, the xylanase system has a very wide pH adaptation range, and the xylanase activity exhibited is more than 70%.

[0091] (III) Temperature dependence

[0092] Select the optimal pH buffer determined by the above experiment and keep other reaction components unchanged; set the temperature of the water bath to 30℃, 40℃, 50℃, 60℃, 70℃, and 80℃, respectively, incubate for 30 minutes, and measure the released reducing sugar after the reaction.

[0093] The results are as follows Fig.12 As shown, at 50°C, the xylanase and microcrystalline cellulose enzyme systems have the strongest enzyme activity, while the optimum temperature of the CMC enzyme system is 60°C; among them, the xylanase and CMC enzyme systems still maintain more than 50% activity at 30°C-70°C.

[0094] According to the optimum pH and temperature, it was calculated that the cellulolytic enzyme produced by Trichoderma sp. zt06 contained 11385 U / L of xylanase, 4412 U / L of endocellulase and 975 U / L of exocellulase.

[0095] (IV) pH tolerance

[0096] First, the obtained crude enzyme solution was added to different citric acid-disodium hydrogen phosphate buffers (pH 3-8) and placed at room temperature for 1 hour; the optimal reaction component determined by the above test was selected, incubated at the optimal reaction temperature for 30 minutes, and the released reducing sugar was measured after the reaction was completed.

[0097] The results are as follows Fig.13 As shown, in the range of pH 3.0-8.0, the enzyme activities of the three enzyme systems were all maintained above 70%.

[0098] The reaction system is 1 mL, the content of rice straw is 1% (1% is 1% (m / V) 0.01 g of 1 mL of the reaction system), 50 μL-500 μL of crude enzyme solution is added, and the rest is made up to 1 mL with pH 6.0 citric acid-disodium hydrogen phosphate buffer; put it in a shaking water bath at 40°C, incubate for 6 hours, and measure the released reducing sugar after the reaction is completed.

[0099] The results are as follows Fig.14As shown, the cellulolytic enzyme produced by Trichoderma sp.zt06 has a significant degradation effect on rice straw, and this effect is dose-dependent with the amount of enzyme added; when the addition amount increases to 200 μL, the degradation efficiency of Trichoderma sp.zt06 cellulolytic enzyme on rice straw reaches the maximum.

[0100] 5. Effect of Trichoderma sp. zt06 cellulolytic enzyme pretreatment on rumen fermentation of crop straw

[0101] In the following tests, the preparation method of artificial saliva is as follows:

[0102] (1) Artificial saliva stock solution: NaHCO 3 49.0g / L, Na 2 HPO 4 18.5g / L, NaCl 2.35g / L, KC1 2.85g / L, MgCl 2 6H 2 O0.6g / L, CaCl 2 0.2g / L;

[0103] (2) Artificial saliva: Add 800 mL of distilled water to 200 mL of the artificial saliva stock solution prepared above and pass CO 2 , until the solution is clear, measure the pH, and adjust the pH to 6.5 with hydrochloric acid to obtain artificial saliva.

[0104] 10 g of rice straw was pretreated with 200 ml of Trichoderma sp. ZT06 crude enzyme solution, and then 0.5 g of rice straw was weighed as the substrate for in vitro fermentation, while the control group was rice straw treated with 200 ml of buffer (pH 5.0);

[0105] The in vitro fermentation process was as follows: rumen fluid was collected from three healthy sheep through a gastric tube, filtered through gauze, and mixed with artificial saliva at a ratio of 1:2; the entire operation was carried out in a 39°C water bath while maintaining CO 2 Pass; in a 120mL fermentation bottle, different fermentation substrates were added according to the experimental design (the treatment group was rice straw pretreated with Trichoderma sp. ZT06 crude enzyme solution; the control group was rice straw group not pretreated with Trichoderma sp. ZT06 crude enzyme solution (replaced with an equal amount of water)) and 60mL buffered rumen fluid (mixed with rumen fluid and artificial saliva at a volume ratio of 1:2), and then placed in a constant temperature incubator at 39°C for 48 hours after exhausting; after fermentation, the reaction was terminated with ice water, filtered through a 400-mesh nylon mesh, and the filtrate was collected for determination of pH, ammonia nitrogen, microbial protein, and volatile fatty acids. The results are shown in Table 1.

[0106] Table 1 Effect of pretreatment of rice straw with Trichoderma sp. zt06 cellulase on its rumen fermentation

[0107]

[0108] It can be seen from Table 1 above that pretreatment with Trichoderma sp. ZT06 crude enzyme solution significantly improved the dry matter digestibility, ammonia nitrogen and microbial protein synthesis of rice straw during in vitro rumen fermentation, which increased by 3.72%, 2.96 mg / g and 1.78 mg / g respectively compared with the control group; although the total volatile fatty acid content was not significantly affected, the molar ratio of acetic acid was significantly higher than that of the control group, while the molar ratios of propionic acid and butyric acid were significantly lower than those of the control group; these results indicate that pretreatment of rice straw with Trichoderma sp. ZT06 crude enzyme solution can significantly improve the rumen fermentation of rice straw and promote the application of rice straw in ruminant production.

[0109] In summary, the cellulolytic enzyme secreted by Trichoderma sp.zt06 has the characteristics of xylanase, endoglucanase and exoglucanase, maintains high activity at pH 4.0-5.0 and 50℃-60℃, and has good stability at pH 3.0-8.0.

[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. Trichoderma sp., whose deposit number is CGMCC No.40954.

2. An enzyme solution, characterized in that The method is prepared by fermenting the Trichoderma according to claim 1.

3. The enzyme solution according to claim 2, characterized in that The preparation method comprises: culturing a fermentation substrate in a fermentation medium, then inoculating Trichoderma for fermentation, and centrifuging to obtain an enzyme solution.

4. The enzyme solution according to claim 3, characterized in that The preparation method includes one or more combinations of the following conditions: (a) the fermentation substrate comprises one or more combinations of rice straw, wheat straw, wheat bran, bean straw or corn straw; (b) the fermentation medium comprises a nitrogen source, yeast powder, MgSO4·7H2O, KH2PO4 and NaCl, wherein the nitrogen source is selected from one or more combinations of peptone, ammonium sulfate, ammonium chloride, urea or ammonium nitrate; (c) the concentration of the fermentation substrate is 9%-12%; (d) the pH of the fermentation medium is 5.5-7.5; (e) the fermentation time is 6d-7d; (f) the accession concentration of Trichoderma is 3×10 5 Spores per ml.

5. A straw cellulose degradation system, characterized in that: The invention comprises the enzyme solution according to any one of claims 2 to 4, cellulose to be degraded and a citric acid-disodium hydrogen phosphate buffer.

6. The degradation system according to claim 5, characterized in that: The method comprises one or more of the following features: (a) the cellulose to be degraded comprises one or more of xylan, sodium carboxymethyl cellulose and microcrystalline cellulose; and (b) the pH value of the citric acid-disodium hydrogen phosphate buffer is 3-8.

7. The degradation system according to claim 6, characterized in that: The pH of the citric acid-sodium hydrogen phosphate buffer is 4-5.

8. A method for degrading straw cellulose, characterized in that: The degradation system according to any one of claims 6 to 8 is incubated in a shaking water bath.

9. The method according to claim 8, characterized in that The invention comprises one or more of the following features: (a) the incubation temperature is 30° C.-70° C.; (b) the cellulose is derived from rice straw.

10. Use of the Trichoderma according to claim 1, the enzyme solution according to any one of claims 2 to 4, or the degradation system according to any one of claims 5 to 7 in preparing ruminant feed.

Images