A chitosanase BsCsn46A mutant and its application in preparing chitotetraose

By mutating key sites in the substrate channel of Bacillus subtilis chitosanase BsCsn46A, a mutant producing chitosan was screened out, which solved the problem of low chitosan oligosaccharide yield in the existing technology and achieved the effect of efficiently preparing high-polymerization chitosan tetraose.

CN119410616BActive Publication Date: 2025-09-23CHANGZHOU UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411582572.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-07
Publication Date
2025-09-23
Estimated Expiration
2044-11-07

AI Technical Summary

Technical Problem

It is difficult to efficiently prepare chitosan oligosaccharides with high polymerization degree, especially chitotetraose, with existing technologies, and the bioenzymatic method has the problem of low yield.

Method used

By analyzing the substrate channel of Bacillus subtilis chitosanase BsCsn46A, saturation mutagenesis of key sites was performed, and mutants with the potential to produce chitotetraose were screened. The mutants were expressed in E. coli BL21, and recombinant plasmids were constructed and the mutant enzymes were purified.

Benefits of technology

A mutant enzyme capable of efficiently producing chitotetraose was obtained, which improved the yield and biological activity of chitosan oligosaccharides, especially chitosan oligosaccharides with a degree of polymerization of 3-7, which showed better biological activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention discloses a chitosanase BsCsn46A mutant and its use in the production of chitotetraose. By mutating key sites in the chitosanase substrate pathway, a chitosanase mutant with the potential to produce chitotetraose is obtained, belonging to the field of enzyme engineering. The chitosanase (BsCsn46A), a GH46 family glycoside hydrolase derived from Bacillus subtilis, has an amino acid sequence as shown in SEQ ID NO: 1. Specifically, saturation mutations were performed at amino acid residue 50 of BsCsn46A to screen for mutants with the potential to produce chitotetraose. The mutants are T50V, T50G, T50Y, T50L, T50F, T50S, T50I, T50R, T50C, T50D, T50P, T50Q, T50H, and T50N. Analysis of hydrolysis results showed that the chitosanase mutants had greater potential to produce chitotetraose than the wild-type hydrolyzate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a chitosanase derived from Bacillus subtilis, and relates to the technical field of enzyme engineering, in which a chitotetraose-producing mutant is obtained by mutating a key site of the substrate channel of the chitosanase. Background Art

[0002] Chitosanase (EC3.2.1.132) is a glycoside hydrolase that hydrolyzes β-1,4-glycosidic bonds in chitosan to produce chitosan oligosaccharides (COS) with varying degrees of polymerization (DP). COS exhibits excellent biosafety, water solubility, and non-allergenic properties. Studies have shown that COS exhibits anti-tumor, anti-cancer, lipid-lowering, immune-enhancing, and antioxidant properties. In agriculture, it also possesses antibacterial, anti-insect, and antiviral properties, thus possessing diverse potential applications in the food and agricultural sectors. Based on amino acid sequence similarity, chitosanases are primarily derived from seven glycoside hydrolase families: GH3, GH5, GH7, GH8, GH46, GH75, and GH80. Chitosanases can also be divided into four types based on the structure of their cleavage units: Class I, Class II, Class III, and Class IV.

[0003] Chitosan (CS) is a deacetylated product derived from the acetyl groups in chitin by chitin deacetylase. Chitosan oligosaccharides (COS) can be produced directly from the hydrolysis of chitosan or from the deacetylation and hydrolysis of chitin. Studies have shown that chitosan oligosaccharides with high polymerization degrees exhibit greater biological activity. Therefore, obtaining high-polymerization COS has practical application value.

[0004] Chitosan oligosaccharides can be prepared by chemical, physical, and enzymatic methods. Chemical methods are highly reactive, polluting, and environmentally unfriendly, while physical methods offer low yields. Enzymatic methods offer advantages over the other two methods, including mild reaction conditions, controllability, high yields, good reproducibility, and environmental benefits. Therefore, enzymatic methods are currently a hot topic of research. Through molecular modification of enzymes, efforts are underway to obtain chitosanase that efficiently catalyzes the conversion of chitosan to high-polymerization chitosan oligosaccharides. Summary of the Invention

[0005] The present invention is to Bacillus subtilis ( Bacillus subtilis ) The substrate channel of chitosanase BsCsn46A was analyzed to find sites that may affect the polymerization degree of the hydrolysis product. The key sites were mutated to screen out mutants with the potential to produce chitosan tetraose.

[0006] The inventors' previous research found that if the threonine at position 50 of the Bacillus subtilis chitosanase BsCsn46A is mutated to the acidic amino acid E (glutamic acid) or the basic amino acid K (lysine), T50E will hydrolyze chitosan to produce not only chitobiose and chitotriose, but also chitotetraose (CN116590260A). Mutations to the bulky hydrophobic side chain amino acid W or the small side chain amino acid A can also hydrolyze chitosan to produce chitotetraose (CN116656654A). Considering that the mutation of the threonine at position 50 may be highly correlated with the product polymer, the present invention carried out a saturation mutation at position 50 of the Bacillus subtilis chitosanase BsCsn46A and tested the results in Escherichia coli. E. coli The mutants were expressed in BL21(DE3) and further screened for the potential to produce chitotetraose.

[0007] The chitosanase mutant of the invention is obtained by subjecting the 50th amino acid sequence of the chitosanase BsCsn46A of Bacillus subtilis to saturation mutation, and screening out a chitotetraose-producing mutant. Threonine is mutated to valine, marked as T50V; threonine is mutated to glycine, marked as T50G; threonine is mutated to tyrosine, marked as T50Y; threonine is mutated to leucine, marked as T50L; threonine is mutated to phenylalanine, marked as T50F; threonine is mutated to serine, marked as T50S; threonine is mutated to isoleucine, marked as T50I; threonine is mutated to arginine, marked as T50R; threonine is mutated to cysteine, marked as T50C; threonine is mutated to aspartic acid, marked as T50D; threonine is mutated to proline, marked as T50P; threonine is mutated to glutamine, marked as T50Q; threonine is mutated to histidine, marked as T50H; threonine is mutated to asparagine, marked as T50N.The amino acid sequence of Bacillus subtilis chitosanase BsCsn46A is SEQ ID NO: 1, and the nucleotide sequence is SEQ ID NO: 2; the amino acid sequence of the chitosanase mutant T50V is SEQ ID NO: 3, and the nucleotide sequence is SEQ ID NO: 4; the amino acid sequence of the chitosanase mutant T50G is SEQ ID NO: 5, and the nucleotide sequence is SEQ ID NO: 6; the amino acid sequence of the chitosanase mutant T50Y is SEQ ID NO: 7, and the nucleotide sequence is SEQ ID NO: 8; the amino acid sequence of the chitosanase mutant T50L is SEQ ID NO: 9, and the nucleotide sequence is SEQ ID NO: 10; the amino acid sequence of the chitosanase mutant T50F is SEQ ID NO: 11, and the nucleotide sequence is SEQ ID NO: 12; the amino acid sequence of the chitosanase mutant T50S is SEQ ID NO: 13, and the nucleotide sequence is SEQ ID NO: 14; the amino acid sequence of the chitosanase mutant T50I is SEQ ID NO: 15, and the nucleotide sequence is SEQ ID NO: NO:16; the chitosanase mutant T50R amino acid sequence is SEQ ID NO:17, and the nucleotide sequence is SEQ ID NO:18; the chitosanase mutant T50C amino acid sequence is SEQ ID NO:19, and the nucleotide sequence is SEQ ID NO:20; the chitosanase mutant T50D amino acid sequence is SEQ ID NO:21, and the nucleotide sequence is SEQ ID NO:22; the chitosanase mutant T50P amino acid sequence is SEQ ID NO:23, and the nucleotide sequence is SEQ ID NO:24; the chitosanase mutant T50Q amino acid sequence is SEQ ID NO:25, and the nucleotide sequence is SEQ ID NO:26; the chitosanase mutant T50H amino acid sequence is SEQ ID NO:27, and the nucleotide sequence is SEQ ID NO:28; and the chitosanase mutant T50N amino acid sequence is SEQ ID NO:29, and the nucleotide sequence is SEQ ID NO:30.

[0008] The present invention provides a recombinant vector carrying the gene encoding the chitosanase mutant and a recombinant bacterium for transforming / transfecting the recombinant vector.

[0009] The specific mutation steps are as follows:

[0010] Step 1: Clone the gene sequence SEQ ID NO: 2 into plasmid pET-28a to construct the recombinant plasmid pET-BsCsn46A;

[0011] The two primers were the upstream primer CGGGATCCGCGGGACTGAATAAAGATC and the downstream primer CCCAAGCTTTTAAGGGATTACAAAATTACC.

[0012] Step 2: Use Swiss-Model online software to simulate chitosanase (BsCsn46A) to obtain the spatial structure of chitosanase.

[0013] Step 3: Use substrate channel simulation and molecular docking to find the key site (T50) related to the hydrolysis substrate and perform saturation mutagenesis.

[0014] Step 4: Design site-directed mutagenesis primers, obtain the mutant chitosanase gene by PCR technology, clone the amplified target gene into the expression vector pET-28a, and construct a recombinant plasmid.

[0015] Step 5: Transform the recombinant vector from step 4 into Escherichia coli E. coli BL21 (DE3) was induced and cultured, the bacteria were collected after centrifugation, the cells were disrupted by ultrasound, and the mutant chitosanase was obtained by protein purification using a Ni-NTA affinity chromatography column.

[0016] The chitosanase mutant provided by the present invention can be used in industrial applications to produce not only chitobiose and chitotriose but also chitotetraose.

[0017] In a specific embodiment of the present invention, 450 μL of 1% colloidal chitosan solution, 20 U of purified enzyme solution, 500 μL of pH 6.6 phosphate buffer and 9 μL of 100 mM Mn 2+ A hydrolysis system was constructed and allowed to react at 37°C with a shaker at 160 rpm. TLC analysis of the hydrolysis time of the tetrasaccharide-producing mutant enzymes revealed that mutants T50V and T50G produced no tetrasaccharide after 9 hours of hydrolysis; T50Y and T50L produced no chitosan after 7 hours of hydrolysis; T50F, T50S, T50I, T50R, T50C, and T50D produced no tetrasaccharide after 5 hours of hydrolysis; and T50P, T50Q, T50H, and T50N produced no chitosan after 3 hours of hydrolysis. Compared to the wild type, these mutants all exhibited prolonged chitosan production times, indicating potential for chitosan production.

[0018] Studies have shown that chitosan oligosaccharides with a degree of polymerization of 3-7 have better biological activity. The present invention is based on a saturated mutant library obtained from key sites of the substrate channel. The screened mutants have the ability to produce chitotetraose, which has obvious advantages in preparing active oligosaccharides. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1Thin layer chromatograms of chitosan degradation products of wild-type chitosanase and mutant T50D.

[0020] Figure 2 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50R and T50H.

[0021] Figure 3 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50N and T50Y.

[0022] Figure 4 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50C and T50Q.

[0023] Figure 5 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50G and T50M.

[0024] Figure 6 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50S and T50I.

[0025] Figure 7 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50V and T50P.

[0026] Figure 8 Thin layer chromatograms of chitosan degradation products of chitosanase mutants T50L and T50F. DETAILED DESCRIPTION

[0027] The inventors' previous research identified position 50 of the Bacillus subtilis chitosanase BsCsn46A as a key site in the enzyme, and published the ability of T50E, T50K, T50A, and T50W to hydrolyze and produce chitotetraose (CN116590260A and CN116656654A). The present invention subjected the enzyme to saturation mutation at amino acid position 50 (excluding previously published amino acid mutations) to screen for mutants capable of producing chitotetraose.

[0028] The saturation primer sequences were designed using the online software PrimerX as follows, and the chitosanase BsCsn46A gene SEQ ID NO: 2 was used as a template to obtain the mutant chitosanase gene through genetic engineering.

[0029] Table 1. Primer sequences for mutant library

[0030]

[0031]

[0032] Table 2. Inverse PCR system

[0033] Reagent name Volume (μL) template 2 PCR Buffer 5 dNTPs (10 mM) 1 Upstream / downstream primers (100 mM) 0.3 each PfuDNA polymerase 1.5 <![CDATA[ddH2O]]> 40 Total volume 50

[0034] Reverse PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; 15 cycles of denaturation at 95°C for 30 s, annealing at 65°C for 1 min, and extension at 68°C for 10 min; and insulation at 4°C.

[0035] The amplified PCR product was digested with 0.7 μL DpnI for 1.5 h to remove the plasmid template. E. coli DH5α was placed in an ice bath and 10 μL of the above reaction mixture was added to form a transformation system to complete the transformation. The obtained recombinant bacteria were sent to Shanghai Bioengineering Co., Ltd. for sequencing. The plasmids of the recombinant bacteria with correct sequencing were extracted and then transformed into E. coli. E. coli BL21 and stored at -80°C.

[0036] The preserved strain was inoculated into 10 mL of liquid LB medium at a one thousandth inoculum size for activation, then transferred to 50 mL of liquid LB medium for expansion culture, and the inducer IPTG (isopropyl-β-D-thiogalactopyranoside) was added to induce the production of the target protein.

[0037] Protein purification: Aliquot the bacterial suspension of the induced expression strain into centrifuge tubes and balance them. Centrifuge in a refrigerated centrifuge to remove the supernatant, retaining the cells. Pipette an appropriate amount of M0 (20 mM Tris-HCl, 0.5 M NaCl, 10% glycerol, pH 8.0) to resuspend the cells. Centrifuge again to remove the supernatant, and resuspend the suspension in M0 a second time, carefully pipetting evenly. Use an ultrasonic cell disruptor to disrupt the cells and separate the proteins. Centrifuge again to collect the supernatant (containing the protein) and store on ice. Take the Ni-IDA column out of the 4 ℃ refrigerator and turn it upside down to make the agarose filler in the column fluffy. First wash the column with M0 and pure water (Wahaha purified water), then pass the supernatant through the column twice, wash away the impurities with 0.02 M imidazole eluent (0.02 M Tris-HCl, pH 8.0, 0.5 M NaCl, 0.02 M imidazole and 10% glycerol) solution, and then elute the target protein with 0.08 M imidazole eluent (20 mM Tris-HCl, 0.5 M NaCl, 0.08 M imidazole, 10% glycerol, pH 8.0). Collect the eluted protein solution and store it in the refrigerator.

[0038] The purified enzyme was tested for enzyme activity by DNS method. The reaction system consisted of 1475 μL pH buffer, 18 μL 100 mM Mn 2+To 500 μL of 1% colloidal chitosan solution, 25 μL of the purified enzyme solution was added. The reaction was incubated at 55°C in a water bath for 5 min. The reaction was terminated by adding 1.5 mL of DNS solution, followed by boiling for 5 min. Finally, the volume was made up to 25 mL with distilled water and allowed to cool for 1 h. No enzyme was added to the blank control. The absorbance of the samples was measured at 520 nm using a UV-visible spectrophotometer. The reducing end content of the product released by the catalytic reaction was calculated using a standard curve. Chitosanase activity was defined as 1 U of enzyme required to generate 1 μmol of reducing end per minute (1 μmol / mL / min). Protein content in the enzyme solution was determined using a protein quantification reagent purchased from Nanjing Novezan Biotechnology Co., Ltd. (Bradford Reagent: E211-01). Activity data for the relevant mutant enzymes are shown in the table below.

[0039] Table 3. Enzyme activities of mutant enzymes

[0040] mutant enzyme Optimum pH Optimum temperature / ℃ Specific enzyme activity (U / mg) WT 6.0 50 15620.46 T50H 6.0 55 6081.16 T50M 6.0 60 1089.34 T50S 6.0 55 3038.05 T50I 6.0 55 607.42 T50L 6.0 45 1012.22 T50Y 6.0 55 593.29 T50V 6.0 55 565.28 T50P 6.0 50 1637.34 T50D 6.2 50 771.60 T50Q 6.2 50 2517.83 T50G 6.2 55 454.96 T50F 6.2 55 1006.73 T50C 6.4 60 2334.78 T50R 6.8 50 585.52 T50N 6.8 50 5627.88

[0041] Hydrolysis reaction: 450 μL 1% colloidal chitosan solution, 20 U purified enzyme solution, 500 μL pH 6.6 phosphate buffer and 9 μL 100 mM Mn 2+ The hydrolysis system was formed and placed on a shaker at 37 °C and 160 rpm for full reaction. The hydrolysis system was centrifuged at 5 min, 30 min, 1 h, 3 h, 5 h, 7 h, 9 h, and 11 h, respectively, and 20 μL of the supernatant was taken and boiled for 10 min.

[0042] TLC analysis. The thin-layer chromatography procedure is as follows: draw a thin line 1 cm from one end of a high-performance silica gel plate to mark the next sample placement location. Use a pipette or capillary tube to aspirate the hydrolyzate samples from the aforementioned sample preparations at different times and apply multiple small amounts of the sample. A mixed solution of a GlcN2-5 standard and D-glucosamine hydrochloride is used as a control. After the sample-streaked silica gel plate is thoroughly dried, place it in a chromatography tank for development. The chromatographic solution should not exceed the drawn line. Allow the developer to reach the top of the silica gel for approximately 1 hour. Remove the plate and blow dry it with a hair dryer until there is no ammonia odor. Spray the developer (0.5% ninhydrin-ethanol solution) evenly, dry it, and place it in a 110°C oven until clear purple-red spots appear.

[0043] TLC analysis of the hydrolysis time of tetrasaccharide-producing mutant enzymes revealed that mutants T50V and T50G produced no tetrasaccharide after 9 hours of hydrolysis; T50Y and T50L produced no chitosan after 7 hours of hydrolysis; T50F, T50S, T50I, T50R, T50C, and T50D produced no tetrasaccharide after 5 hours of hydrolysis; and T50P, T50Q, T50H, and T50N produced no chitosan after 3 hours of hydrolysis. Compared to the wild type, the mutants obtained above all had longer hydrolysis times to produce chitosan, indicating the potential for producing chitosan. Studies have shown that chitosan oligosaccharides with a degree of polymerization of 3-7 have better biological activity. The present invention uses a saturated mutant library obtained based on key sites in the substrate pathway, and the mutants screened out have the ability to produce chitosan, which has a significant advantage in the preparation of active oligosaccharides.

Claims

1. A chitosanase mutant producing chitotetraose, characterized in that: The chitosanase mutant is obtained by replacing the threonine at position 50 of the amino acid sequence of chitosanase BsCsn46A from Bacillus subtilis as shown in SEQ ID NO: 1 with an amino acid; the chitosanase mutant producing chitotetraose is any one of the following: (1) mutated to valine, denoted as T50V, whose amino acid sequence is shown in SEQ ID NO: 3; (2) mutated to glycine, denoted as T50G, whose amino acid sequence is shown in SEQ ID NO:5; (3) mutated to tyrosine, denoted as T50Y, whose amino acid sequence is shown in SEQ ID NO:7; (4) mutated to leucine, denoted as T50L, whose amino acid sequence is shown in SEQ ID NO:9; (5) mutated to phenylalanine, denoted as T50F, whose amino acid sequence is shown in SEQ ID NO:11; (6) mutated to serine, denoted as T50S, whose amino acid sequence is shown in SEQ ID NO:13; (7) mutated to isoleucine, denoted as T50I, whose amino acid sequence is shown in SEQ ID NO:15; (8) mutated to arginine, denoted as T50R, and its amino acid sequence is shown in SEQ ID NO: 17; (9) mutated to cysteine, denoted as T50C, whose amino acid sequence is shown in SEQ ID NO: 19; (10) mutated to aspartic acid, denoted as T50D, whose amino acid sequence is shown in SEQ ID NO: 21; (11) mutated to proline, denoted as T50P, and its amino acid sequence is shown in SEQ ID NO: 23; (12) mutated to glutamine, denoted as T50Q, and its amino acid sequence is shown in SEQ ID NO: 25; (13) mutated to histidine, denoted as T50H, and its amino acid sequence is shown in SEQ ID NO: 27; (14) mutated to asparagine, denoted as T50N, and its amino acid sequence is shown in SEQ ID NO:

29.

2. The gene encoding the chitosanase mutant producing chitotetraose according to claim 1, characterized in that: The nucleotide sequence encoding T50V is shown in SEQ ID NO:4; the nucleotide sequence encoding T50G is shown in SEQ ID NO:6; the nucleotide sequence encoding T50Y is shown in SEQ ID NO:8; the nucleotide sequence encoding T50L is shown in SEQ ID NO:10; the nucleotide sequence encoding T50F is shown in SEQ ID NO:12; the nucleotide sequence encoding T50S is shown in SEQ ID NO:14; the nucleotide sequence encoding T50I is shown in SEQ ID NO:16; the nucleotide sequence encoding T50R is shown in SEQ ID NO:18; the nucleotide sequence encoding T50C is shown in SEQ ID NO:20; the nucleotide sequence encoding T50D is shown in SEQ ID NO:22; the nucleotide sequence encoding T50P is shown in SEQ ID NO:24; the nucleotide sequence encoding T50Q is shown in SEQ ID NO:26; the nucleotide sequence encoding T50H is shown in SEQ ID NO:28; and the nucleotide sequence encoding T50N is shown in SEQ ID NO:

30.

3. A recombinant vector, characterized in that Comprising the chitosanase mutant according to claim 1 or the gene according to claim 2.

4. A recombinant strain, characterized in that The host bacteria comprises the chitosanase mutant according to claim 1, the gene according to claim 2, or the recombinant vector according to claim 3.

5. The use of the chitosan mutant according to claim 1, characterized in that: The chitosanase mutant is used in catalyzing the hydrolysis of chitosan to produce chitooligosaccharides.

6. The use according to claim 5, characterized in that The chitosanase mutant produces chitotetraose in the hydrolysis reaction of catalyzing chitosan.

7. The use according to claim 6, characterized in that In the hydrolysis reaction system, the mass fraction of the substrate is 0.45-0.5%, the amount of the chitosanase mutant is 20 U, and the reaction temperature is 37°C.

8. The use according to claim 7, characterized in that The hydrolysis reaction time of the chitosanase mutants in catalyzing chitosan to produce chitotetraose was controlled. Among them, the hydrolysis reaction time of T50P, T50Q, T50H, and T50N was within 3 h, the hydrolysis reaction time of T50F, T50S, T50I, T50R, T50C, and T50D was within 5 h, the hydrolysis reaction time of T50Y and T50L was within 7 h, and the hydrolysis time of T50V and T50G was within 9 h.

Citation Information

Patent Citations

  • Chitosan enzyme mutant for producing chitotetraose and application thereof

    CN116590260A

  • Chitosanase mutant with changed product polymerization degree and application of chitosanase mutant

    CN116656654A

  • Chitosan enzyme mutant for producing chitobiose per unit

    CN116676297A

  • Chitosanase mutant with improved catalytic activity and application thereof

    CN116949015A