Sri Lankan cassava mosaic virus AC4 and its application

Abstract

The present invention provides an application of an AC4 gene, or a protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in reducing the expression level of AtSGS3 and / or reducing the SGS3 / RDR6 complex. The present invention has found that there is an interaction between SLCMV AC4 and AtSGS3, which can improve the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium, downregulate AtSGS3 expression, and combine with AtSGS3 to reduce the SGS3 / RDR6 complex. The research results will lay a foundation for clarifying the molecular mechanism of SLCMV AC4 regulating host RNA silencing.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to Sri Lankan cassava mosaic virus AC4 and application thereof. Background Art

[0002] Cassava ( Manihot esculenta Crantz) is a tropical plant of the genus Manihot in the family Euphorbiaceae. As an important food crop and energy crop in the world, it can provide food for nearly one billion people (Fu Haitian et al., 2022). However, cassava mosaic disease (CMD) caused by cassava mosaic geminivirus (CMVs) poses a serious threat to the development of my country's cassava industry and food security. CMD was first reported in Hainan and Fujian, my country in 2018, and was subsequently reported in other planting areas (Wang et al., 2018). Therefore, basic research on virus-resistant breeding is urgently needed. Sri Lankan cassava mosaic virus ( Sri Lanka cassava mosaic virus , SLCMV) is a strain of cassava mosaic virus, which belongs to the genus Begomovirus of the family Geminiviridae. It is a typical two-component single-stranded DNA virus, and its genome consists of two circular components, DNA-A and DNA-B. The positive strand of the DNA-A component encodes two proteins, AV1 and AV2, and the antisense strand encodes four proteins, namely AC1, AC2, AC3 and AC4; the DNA-B component encodes BV1 and BC1 (Patil et al., 2009; Chen et al., 2019).

[0003] The virus has an extremely small genome, so most of the proteins it encodes are multifunctional proteins. Studies have shown that AC4 is not only a symptom-determining factor of SLCMV but also a viral silencing suppressor, which can inhibit host PTGS and increase viral pathogenicity (Vanitharani et al., 2004; Chen et al., 2019). and It may also be involved in regulating the mRNA degradation pathway (Liu Linyu et al., 2023). However, the mechanism by which SLCMV AC4 inhibits host PTGS remains to be studied. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art, to provide Sri Lankan cassava mosaic virus AC4 and application thereof for studying the mechanism of action of SLCMV AC4 in inhibiting host PTGS.

[0005] The first aspect of the present invention is to provide the use of AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in reducing the expression level of AtSGS3 and / or reducing the SGS3 / RDR6 complex.

[0006] Among them, the nucleotide sequence of the AC4 gene is shown in SEQ ID NO:1.

[0007] Among them, the nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO:2.

[0008] Among them, the nucleotide sequence of the gene corresponding to AtRDR6 is shown in SEQ ID NO:3.

[0009] Among them, the SGS3 / RDR6 complex is formed by the interaction between the proteins AtSGS3 and AtRDR6.

[0010] The second aspect of the present invention is to provide the use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in the interaction with AtSGS3.

[0011] Among them, the nucleotide sequence of the AC4 gene is shown in SEQ ID NO:1.

[0012] Among them, the nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO:2.

[0013] Among them, the nucleotide sequence of the gene corresponding to AtRDR6 is shown in SEQ ID NO:3.

[0014] Among them, the SGS3 / RDR6 complex is formed by the interaction between the proteins AtSGS3 and AtRDR6.

[0015] Among them, AC4 interacts with AtSGS3 to reduce the expression level of AtSGS3 and / or reduce the SGS3 / RDR6 complex.

[0016] Among them, AC4 interacts with AtSGS3 or AtRDR6 to improve the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutritional deficiency medium.

[0017] The present invention found that there is an interaction between SLCMV AC4 and AtSGS3, which can improve the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium, downregulate AtSGS3 expression, and combine with AtSGS3 to reduce the SGS3 / RDR6 complex. The research results will lay a foundation for clarifying the molecular mechanism of SLCMV AC4 regulating host RNA silencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Verification of yeast self-activation of pGBKT7-AC4 and pGADT7-AtSGS3. SD-LW: SD / -Leu / -Trp medium; SD-LWHA: SD / −Leu / −Trp / −His / −Ade medium.

[0019] Figure 2 The results of yeast interaction experiments. SD-LW: SD / -Leu / -Trp medium; SD-LWHA: SD / −Leu / −Trp / −His / −Ade medium.

[0020] Figure 3 BiFC was used to verify the interaction between SLCMV AC4 protein and AtSGS3 protein in tobacco. A: AtSGS3-YC, YN-AC4 and nuclear marker H2B-RFP were co-injected into tobacco; B: AtSGS3-YC, YNs-GUS and nuclear marker H2B-RFP were co-injected into tobacco.

[0021] Figure 4 Subcellular localization and colocalization of AC4-GFP and AtSGS3-RFP. GFP: green fluorescence; RFP: red fluorescence; Bright: white field fluorescence; Merged: overlap of green fluorescence, red fluorescence and white light.

[0022] Figure 5 Subcellular colocalization experiments were performed to verify the colocalization of SLCMV AC4 and AtSGS3 with RDR6 in tobacco cell nuclei.

[0023] Figure 6 AC4 negatively regulates the formation of cytoplasmic SGS3 / RDR6 particles.

[0024] Figure 7 These are the experimental results of AC4-induced AtSGS3 protein degradation. DETAILED DESCRIPTION

[0025] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0026] 1 Experimental Materials

[0027] Nicotiana benthamiana seeds ( Nicotiana benthamiana), yeast expression vectors pGBKT7-AC4, pGADT7-AtSGS3, and pGADT7-T and pGBKT7-53 (positive control) and pGADT7-T and pGBKT7-Lam (negative control) were co-transformed into AH109 competent yeast strains maintained in our laboratory; BiFC vectors YN-AC4, AtSGS3-YC and YNs-GUS, plant expression vectors H2B-RFP, pZP-P19, AC4-GFP, AtSGS3-GFP, AtSGS3-RFP and RDR6-RFP (references Liu Linyu et al., 2023; Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y.,Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressorof RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection.Molecular plant pathology, 24(2), 154–166.) were all kept in our laboratory. Membrane-localized green-light-labeled GFP::cDNA (Cutler et al., 2000) and plasmid-localized red-light-labeled prSSU (Dabney-Smith et al., 1999) were kindly donated by Li Yuanchao from the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences; 2×Hieff® PCR MasterMix (With Dye) was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; Escherichia coli DH5α, Agrobacterium competent GV3101 and yeast competent AH109 were all purchased from Shanghai Weidi Biotechnology Co., Ltd.; LB medium was purchased from Shanghai Shenggong Biotechnology Co., Ltd.; plasmid mini-preparation kit and DNA Marker was purchased from Beijing Tiangen Biochemical Co., Ltd.; SD / -Trp / -Leu and SD / -Trp / -Leu / -His / -Ade culture media were purchased from Beijing Coolaibo Technology Co., Ltd.; 3-amino-1,2,4-triazole (3-AT) was purchased from Beijing Qiyan Biotechnology Co., Ltd.; kanamycin, ampicillin, and rifampicin were purchased from Beijing Suobaolai Technology Co., Ltd.; spectinomycin was purchased from Shanghai Yishen Biotechnology Co., Ltd.

[0028] 2 Experimental methods and results

[0029] 2.1 Identification of yeast self-activation

[0030] According to the instructions of AH109 Chemically Competent Cell, pGADT7 was combined with pGBKT7-AC4 (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.), pGBKT7 and pGADT7-AtSGS3 (reference Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnipcrinkle virus-encoded suppressor of RNA silencing interacts with ArabidopsisSGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) were co-transformed into yeast AH109 competent cells, and the transformants were spread on SD / -Leu / -Trp (SD-LW) nutrient-deficient medium and cultured inverted in a 28°C constant temperature incubator for 2-3 days. The monoclonal colonies identified as positive by PCR were picked and serially diluted in 20 ul 0.9% NaCl (10 -1 , 10 -2 , 10 -3), 2 ul of each was aspirated and spotted on SD / -Leu / -Trp (SD-LW) and SD / -Ade / -His / -Leu / -Trp (SD-LWHA) nutrient-deficient medium, with yeast co-transformed with pGADT7-T and pGBKT7-53 as the positive control, and yeast co-transformed with pGADT7-T and pGBKT7-Lam as the negative control, and spotted on the nutrient-deficient medium together with the yeast liquid transformed with the target plasmid, and incubated inverted in a 28°C constant temperature incubator, and the growth of colonies was observed and recorded to determine whether it had self-activation activity. If the yeast colonies can grow normally only in the SD-LW nutrient-deficient medium, but cannot grow in the SD-LWHA nutrient-deficient medium, it means that the plasmid has no self-activation activity; if the yeast colonies can grow normally in both the SD-LW nutrient-deficient medium and the SD-LWHA nutrient-deficient medium, it means that the plasmid has self-activation activity. If there is self-activation activity, 3-AT is added to the SD-LWHA nutrient-deficient medium to inhibit it, and the concentration of 3-AT is gradually increased until the colonies cannot grow normally in the SD-LWHA nutrient-deficient medium added with this concentration of 3-AT. This indicates that the self-activation activity of pGBKT7-AC4 and pGADT7-AtSGS3 is basically inhibited under this concentration of 3-AT, and the concentration of 3-AT added can be used for subsequent spot plating.

[0031] The results of yeast self-activation verification are as follows Figure 1 As shown ( Figure 1 1, 10 -1 , 10 -2 , 10 -3 Represents 1-fold, 10-fold, 100-fold, and 1000-fold dilution of bacterial solution, respectively). It can be observed that in the SD-LW nutrient-deficient medium, the AH109 yeast strain co-transformed with pGBKT7-AC4 and pGADT7, the AH109 yeast strain co-transformed with pGADT7-AtSGS3 and pGBKT7, as well as the positive control and the negative control can all grow normally to form colonies, while in the SD-LWHA nutrient-deficient solid medium, only the positive control can grow, indicating that the yeast expression vectors pGBKT7-AC4 and pGADT7-AtSGS3 have no self-activation activity and can be directly used in subsequent yeast two-hybrid experiments.

[0032] 2.2 Yeast two-hybrid assay to study the interaction between SLCMV AC4 and AtSGS3

[0033] For ease of expression, during the co-transformation process, the "pGADT7" vector is abbreviated as "AD" and the "pGBKT7" vector is abbreviated as "BD". To study the mechanism of SLCMV AC4 regulating AtSGS3 and participating in PTGS immune function, BD-AC4 and AD-AtSGS3 or AD-AC4 (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) and BD-AtSGS3 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) were co-transformed into competent yeast cells according to the instructions of AH109 Chemically Competent Cell. The transformants were evenly spread on SD-LW nutrient-deficient medium and inverted in a 28°C constant temperature incubator for 2-3 days. After the colonies grew, single clones were picked for PCR identification using the universal primers pGADT7-F and pGADT7-R and pGBKT7-F and pGBKT7-R of the activation domain vector and the bait vector. After the correct colonies were identified, 2 µl of the diluted bacterial solution of different concentrations were taken and spotted on SD-LW nutrient-deficient medium and SD-LWHA nutrient-deficient medium, and placed in a 28°C constant temperature incubator, inverted for culture, and observed and recorded whether SLCMV AC4 interacted with AtSGS3.

[0034] The results are shown in Figure 2 ( Figure 2 1, 10 -1 , 10 -2 , 10 -3 Respectively represent the dilution of bacterial solution by 1 times, 10 times, 100 times, and 1000 times). In SD-LW nutrient-deficient medium, all co-transformed yeast can grow normally, but in SD-LWHA nutrient-deficient medium, the negative control cannot grow normally, while the positive control and yeast co-transformed by BD-AC4 and AD-AtSGS3, and yeast co-transformed by AD-AC4 and BD-AtSGS3 can grow. The results show that AC4 and AtSGS3 interact in yeast cells.

[0035] Table 1 Primers used in this study

[0036] Primer name Primer sequence (5¢‒3¢) pGADT7-F GGAGTACCCATACGACGTACC pGADT7-R TATCTACGATTCATCTGCAGC pGBKT7-F TAATACGACTCACTATAGGGC pGBKT7-R TTTTCGTTTTAAAACCTAAGAGT

[0037] 2.3 Fluorescence bimolecular complementation experiments confirm the interaction between SLCMV AC4 and AtSGS3 proteins

[0038] According to the instructions of GV3101 Chemically Competent Cell, the plant expression vector AtSGS3-YC (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.), nuclear localization marker H2B-RFP and YN-AC4 (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) or YNs-GUS to transform Agrobacterium GV3101 competent cells, and the transformed Agrobacterium is evenly spread on the LB solid medium containing the corresponding resistance, and inverted in a 28°C constant temperature incubator for 2-3 days. After the colony grows, pick a single colony for colony PCR identification, and then pick a single colony identified as positive by colony PCR to a 1.5 ml centrifuge tube containing 500ul LB liquid medium containing the corresponding antibiotics and shake it in a 28°C 200 r / min constant temperature shaker for 16 h. Take 50 ul of the above-mentioned small shaking bacterial solution and add it to 5ml LB liquid medium containing the corresponding antibiotics, and then expand the culture. After centrifuging the expanded cultured bacterial solution at 5000 rmp / min for 10 min, discard the supernatant, and resuspend the precipitate with 2 ml injection buffer. After blowing evenly with a gun tip, dilute the bacterial solution concentration to OD600=0.5. Preparation of injection buffer: 1 ml 1 mol / L MgCl2, 1 ml 1 mol / L 2-morpholineethanesulfonic acid (MES) and 100 μl 100 mg / ml acetosyringone (AS) were taken respectively, and finally the volume was fixed to 100 ml with ultrapure water. After the diluted bacterial solution was placed at room temperature for 2-3 h, the plant expression vector YN-AC4 and the resuspension of AtSGS3-YC were mixed in equal volumes and injected into the leaves of N. benthamiana at the 5-6 leaf stage. Each combination was injected with 2 replicates. After the injection, the N. benthamiana was treated in the dark for 24 h and then placed under normal conditions for 48 h. Then, the tobacco leaves were observed and photographed using a laser confocal microscope (Olympus FV3000). The GFP excitation light was 488 nm and the RFP excitation light was 561 nm.

[0039] The results are as follows Figure 3 As shown. AtSGS3-YC and YN-AC4 co-injected into N. benthamiana leaves can restore green fluorescence under 488 nm excitation light, and it does not overlap with the red fluorescence of the nuclear localization marker. The control group AtSGS3-YC and YNs-GUS co-injected into N. benthamiana leaves did not restore fluorescence under 488 nm excitation light. This result further verifies that SLCMV AC4 and AtSGS3 interact in cells.

[0040] 2.4 Subcellular localization and colocalization of SLCMV AC4 and AtSGS3

[0041] According to the experimental method in 2.3, the recombinant plasmids AC4-GFP (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.), AtSGS3-GFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plantpathology, 24(2), 154–166.), AtSGS3-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) and membrane-localized green light marker were used to transform Agrobacterium competent cells, and then the monoclonal colonies identified as positive by PCR were picked and cultured in LB medium containing the corresponding antibiotics. The injection buffer was prepared according to the formula in 2.3, and the bacterial solution was resuspended with the injection buffer and the OD600 value was uniformly adjusted to 0.5. After standing at room temperature for 2-3 hours, the different recombinant plasmid Agrobacterium combinations were mixed in equal volumes according to Table 2 and injected into 5-6 leaf stage Nicotiana benthamiana leaves. At least two tobacco leaves were injected. After being treated under dark conditions for 24 hours, they were placed under normal conditions for 48 hours, and then observed and photographed using a fluorescence confocal microscope (Olympus FV3000). The GFP excitation light was 488 nm and the RFP excitation light was 561 nm.

[0042] The results are as follows Figure 4As shown. By using a laser confocal microscope (FV3000) to observe the treated tobacco leaves, it was found that AC4-RFP and the membrane-localized green light marker GFP::cDNA overlapped in fluorescence at laser 488nm and 561nm, turning into yellow fluorescence. The results showed that AC4-RFP was localized on the plasma membrane of tobacco epidermal cells; and AtSGS3-GFP and the plasma-localized red light marker prSSU also overlapped at laser 488 nm and 561 nm, turning into yellow fluorescence. The results showed that AtSGS3-GFP was localized on the plastid of tobacco epidermal cells. Further, by using a laser confocal microscope (FV3000) to observe the treated tobacco leaves, it was found that AC4-GFP and AtSGS3-RFP overlapped in fluorescence at laser 488 nm and 561 nm, turning into yellow fluorescence. The results showed that SLCMV AC4 protein and AtSGS3 were co-localized in tobacco epidermal cells.

[0043] Table 2 Combinations of different recombinant plasmids Agrobacterium

[0044] Recombinant plasmid name AC4-GFP + membrane-localized green light-labeled GFP::cDNA + pPTN-P19 AtSGS3-GFP + plasmochromatin red marker prSSU + pPTN-P19 AC4-GFP + AtSGS3-RFP + membrane-localized green light labeled GFP::cDNA + pPTN-P19

[0045] 2.5 Subcellular colocalization of the complex formed by SLCMV AC4 and AtSGS3 and AtRDR6

[0046] The recombinant plasmids YN-AC4, AtSGS3-YC and RDR6-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance according to the experimental method in 2.3. virus infection. Molecular plant pathology, 24(2), 154–166.) and pZP-P19 (Voinnet, O., Rivas, S., Mestre, P., & Baulcombe, D. (2003). An enhanced transient expression system in plants based onsuppression of gene silencing by the p19 protein of tomato bushy stunt virus. The Plant journal : for cell and molecular biology, 33(5), 949–956. ) were transformed into Agrobacterium competent cells, and then the monoclonal colonies identified as positive by PCR were picked and cultured in LB medium containing the corresponding antibiotics. Prepare the injection buffer according to the formula in 2.3, use the injection buffer to resuspend the bacterial solution and make the OD600 value uniform to 0.5, let it stand at room temperature for 2-3 hours, and then mix the plant expression vectors YN-AC4, AtSGS3-YC and RDR6-RFP and pZP-P19 in equal volumes and inject them into the leaves of Nicotiana benthamiana at the 5-6 leaf stage. At least two tobacco leaves were injected, and they were treated under dark conditions for 24 hours and then placed under normal conditions for 48 hours, and then observed and photographed using a fluorescence confocal microscope. The GFP excitation light was 488 nm and the RFP excitation light was 561 nm.

[0047] 2.6 AC4 negatively regulates the formation of cytoplasmic SGS3 / RDR6 particles

[0048] Referring to the experimental method in 2.3, the recombinant plasmids YN-AtRDR6 and YC-AtSGS3 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) and AC4-Flag (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) or empty vector (EV as control) were co-expressed in Nicotiana benthamiana for competitive BiFC experiments. Confocal microscopy was performed on the 5th day after injection. The observation results are shown in Figure 2. Figure 6 a and Figure 6 As shown in b, strong YFP fluorescence was observed in both cases, while the fluorescence of co-expression with AC4 was weaker than that of the control group. These findings suggest that AC4 does not hinder the interaction between AtSGS3 and AtRDR6, but affects the formation of the SGS3 / RDR6 complex. In addition, subcellular colocalization of AtSGS3 and AtRDR6 can be observed in the presence of EV or AC4. However, compared with the EV control, the co-expression of AC4 resulted in a significant decrease in the formation of the SGS3 / RDR6 complex in the cytoplasm ( Figure 6 c and Figure 6 These results suggest that AC4 plays a negative regulatory role in the formation of the cytosolic SGS3 / RDR6 complex.

[0049] 2.7 AC4-induced AtSGS3 protein degradation

[0050] Referring to the experimental method in 2.3, pG1300 (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang,X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing suppresses mRNA decay by interacting with Arabidopsis XRN4. ThePlant journal : for cell and molecular biology, 116(3), 744–755.) and AtSGS3-GFP fusion protein were co-expressed with EV or AC4-Flag in tobacco leaves, respectively, and confocal microscopy was performed on the 5th day after injection. The observation results showed that the subcellular localization of AtSGS3-GFP did not change when co-expressed with empty vector or AC4-Flag, and the results of pG1300 were similar ( Figure 7 However, the co-expression of AtSGS3-GFP and AC4-Flag resulted in a significant decrease in the number of green fluorescent particles ( Figure 7 a and Figure 7 b), while there was no significant difference in fluorescence when pG1300 was co-expressed with AC4-Flag or EV. To further determine whether the reduced fluorescence of AtSGS3-GFP in tobacco co-expressing AC4-Flag was related to the reduced level of AtSGS3-GFP, we used Western blot to analyze the accumulation of AtSGS3-GFP. As expected, when co-expressed with AC4-Flag, the protein level of AtSGS3 was observed to be reduced by about 2.5 times compared with EV ( Figure 7 c). However, the protein level of pG1300 and the mRNA levels of AtSGS3-GFP and pG1300 remained unchanged. To eliminate the possibility that the antibody labeling affected the results, AtSGS3-Flag was co-expressed with pG1300 or AC4-GFP according to the experimental method in 2.3. Figure 7 As shown in (d), in the presence of AC4, the level of AtSGS3 showed a significant decrease, which is consistent with Figure 7 These observations confirm that AC4 induces a decrease in AtSGS3.

[0051] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in interaction with AtSGS3, wherein the interaction between AC4 and AtSGS3 improves the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium; wherein, The nucleotide sequence of the AC4 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the gene corresponding to AtSGS3 is shown in SEQ ID NO:2.

Images