Method for realizing target gene editing of prawn offspring by exopalaemon carinicauda or vannabine

Abstract

The invention relates to a method for editing target genes of prawn filial generations by exopalaemon carinicauda or vannabine and application of the method. Based on the gonad development and reproduction characteristics of shrimps and crabs, Cas9 RNP (a mixture formed by mixing sgRNA and Cas9 ribonucleoprotein) is directly injected into bodies of exopalaemon carinicauda or litopenaeus vannamei with developed ovaries in an intramuscular injection manner. The used sgRNA is a guide RNA (Ribonucleic Acid), namely EcIAG-gRNA or LvIAG-gRNA, which is designed on the basis of an IAG gene (EcIAG or LvIAG) of exopalaemon carinicauda or litopenaeus vannamei. Different gRNAs and Cas9 proteins are respectively mixed and then injected into an exopalaemon carinicauda or litopenaeus vannamei parent body through intramuscular injection, Cas9 RNP can enter an ovary along with blood circulation and enter an oocyte along with development of the ovary, editing of a target gene on a genome is realized, and after the edited oocyte develops into an ovum, a progeny edited mutant is formed through fertilization. The method can also be used for delivering other biological macromolecular substances to oocytes of decapod crustacean such as exopalaemon carinicauda or litopenaeus vannamei.

Description

Technical Field

[0001] The present invention relates to the field of shrimp and crab genetic engineering technology, and in particular to a shrimp and crab gene editing technology and application thereof. Background Art

[0002] Gene editing is currently one of the important means to achieve genetic changes in species. This technology can be used to achieve the knock-in, knock-out and genotype changes of key genes that regulate economic traits, thereby achieving the improvement of target traits. Gene editing technology has developed rapidly in model animals and higher animals, and has been more commonly studied in aquatic animals and fish. However, in crustaceans, gene editing technology has developed relatively slowly, and there are bottleneck problems such as the difficulty of gene introduction, low efficiency, low embryo survival rate, and low gene editing efficiency. Success has only been reported in a very few species such as the white shrimp. At this stage, in crustaceans, the successful application of gene editing mainly depends on injecting gene editing materials into single-cell fertilized eggs through microinjection to achieve gene editing of individuals. The microinjection method has great limitations. The narrow fertilization time window, the inability to control the fertilization process, and the difficulty in operating fertilized eggs are all important factors that limit the efficiency of microinjection. In Anopheles gambiae ( Anopheles gambiae ), the researchers established a receptor-mediated cargo ovarian transport system method (ReMOT) by using the recognition interaction between vitellogenin and vitellogenin receptor. This method recombined the peptide sequence P2C that can be recognized by vitellogenin receptor with Cas9 and expressed the recombinant protein. gRNA After mixing, the mixture was directly injected into adult females to achieve targeted gene editing of eggs. This method established a gene editing technology for malaria mosquitoes that does not rely on microinjection (Chaverra-Rodriguez, D., Macias, VM, Hughes, GL et al. Targeted deliveryof CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritablegermline gene editing. Nat Commun, 2018, 9:3008. Doi: 10.1038 / s41467-018-05425-9).

[0003] White shrimp ( Exopalaemon carinicauda ) and Penaeus vannamei ( Litopenaeus vannamei) belong to the Decapoda order of the subphylum Crustacea and are marine shrimps with high economic value. Like other shrimps and crabs, vitellogenin (Vg) is the main precursor lipoprotein of yolk during the ovarian development of white shrimp and Litopenaeus vannamei. The hepatopancreas is an important target tissue for the synthesis of Vg. The secreted Vg is transported to the ovary through the open blood circulation and absorbed into the developing oocyte through receptor-mediated endocytosis. Based on the characteristics of ovarian development in shrimps and crabs, we directly injected Cas9 RNP ( sgRNA The mixture of Cas9 and Cas9 ribonucleoprotein was injected into the ovarian development of white shrimp and Penaeus vannamei, and then mated with male individuals, which can achieve the editing of target genes in some offspring individuals. The gene editing technology of white shrimp and Penaeus vannamei based on direct maternal injection was successfully established. Compared with the microinjection method, this method is simpler and more convenient to operate, and can achieve the operation of large quantities of eggs. This method can also be applied to other crustaceans with similar ovarian development processes. Summary of the invention

[0004] The purpose of this patent is to provide a method for realizing gene editing of offspring by injecting Cas9RNP into the mother muscle of white shrimp or Penaeus vannamei. Cas9 RNP is directly injected into the white shrimp or Penaeus vannamei whose ovaries are developing by intramuscular injection. Cas9 RNP can enter the ovary through blood circulation and enter the oocyte as the ovary develops, thereby realizing the editing of the target gene on its genome. After the edited oocyte develops into an egg, it forms an edited mutant of the offspring through fertilization.

[0005] In order to achieve the above object, the technical solution of the present invention is as follows: A method for editing target genes in offspring of white shrimp or Penaeus vannamei, wherein the method comprises injecting Cas9 RNP into the muscle of white shrimp or Penaeus vannamei mother, and then mating with a male individual to edit the target gene of the offspring individual, wherein the Cas9 RNP is a Cas9 protein and a guide RNA A mixture wherein the guide RNA Genes controlling male sex differentiation in white shrimp E Guidance RNA , or the gene controlling male sex differentiation in Penaeus vannamei LqCy Guidance RNA .

[0006] Furthermore, the target gene is a male sex differentiation control gene of white shrimp E Male sex differentiation control gene in Litopenaeus vannamei LqCy .

[0007] Furthermore, the Cas9 protein in the mixture is combined with the guide RNA The mass concentration of Cas9 RNP is greater than 0.5µg / µL, preferably 1-5µg / µL; the injection volume of Cas9 RNP is 8-20μL (preferably 10-15μL).

[0008] The mother is a female shrimp of Litopenaeus chinensis or Litopenaeus vannamei whose ovaries are in the II or III developmental stage.

[0009] The site of intramuscular injection in the mother is the base of the first pair of swimming legs of the white shrimp or the vannamei shrimp.

[0010] Genes controlling male sex differentiation in white shrimp E The nucleotide sequence of the male sex differentiation control gene of white shrimp is shown in SEQ ID No.1 in the list. E Guidance RNA for EcIAG-gRNA1 and EcIAG-gRNA2 ,in EcIAG-gRNA1 The ribonucleotide sequence is shown in SEQ ID No. 2 in the sequence table, EcIAG-gRNA2 The ribonucleotide sequence of is shown in SEQ ID No.3 in the sequence table. RNA for EcIAG-gRNA1 and EcIAG-gRNA2 hour, EcIAG- gRNA1 and EcIAG-gRNA2 Mix in any mass ratio, preferably EcIAG-gRNA1 and EcIAG-gRNA2 The mass ratio is 1:1.

[0011] Genes controlling male sex differentiation in Litopenaeus vannamei LqCy The nucleotide sequence is shown in SEQ ID No. 4 in the list; Male sex differentiation control gene of Penaeus vannamei LqCy Guidance RNA for LvIAG-gRNA1 and LvIAG-gRNA2 ,in, LvIAG-gRNA1 The ribonucleotide sequence of is shown in SEQ ID No.5 in the sequence table, LvIAG-gRNA2 The ribonucleotide sequence of RNA for LvIAG-gRNA1 and LvIAG-gRNA2 hour, EcIAG- gRNA1 and EcIAG-gRNA2 Mix in any mass ratio, preferably LvIAG-gRNA1 and LvIAG-gRNA2 The mass ratio is 1:1.

[0012] This method can also be used to deliver other proteins, plasmids and other biomacromolecules to the egg cells of white shrimp or Penaeus vannamei during the ovarian development period; it can also be applied to target gene editing in the offspring of other decapod crustaceans such as shrimps and crabs with similar ovarian development processes.

[0013] Compared with the prior art, the advantages of the present invention are: 1. At present, effective gene editing technology has not been established for most crustaceans such as shrimp. This invention realizes the gene editing of shrimp for the first time, providing important technical guidance for the gene editing of other crustaceans; 2. The existing gene editing technology of white shrimp is based on the microinjection method to introduce the editing system into the fertilized eggs. The method is time-consuming, and the mortality rate of the fertilized eggs after microinjection is extremely high during embryonic development. In addition, it also relies on expensive microinjection instruments and skilled microinjection operation experience. The method established by the present invention only requires a single microinjection of the adult to achieve gene editing of the offspring individuals. The operation is simple, the success rate is high, and the replicability is strong. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The expressed Cas9 recombinant protein was detected by electrophoresis to see whether it was expressed in the supernatant.

[0015] Figure 2 This is an in vitro activity detection experiment for the purified recombinant protein Cas9.

[0016] Figure 3 This is the embryonic sequencing peak diagram of the gene-edited individual No. 3 injected in September 2023.

[0017] Figure 4 This is the monoclonal sequencing result of individual No. 3 injected in September 2023.

[0018] Figure 5 This is the embryonic sequencing peak diagram of gene editing in individual No. 1 injected in November 2023.

[0019] Figure 6 This is the monoclonal sequencing result of individual No. 1 injected in November 2023.

[0020] Figure 7 This is the electrophoresis result of agarose gel of the embryo injected with gene editing of individual No. 1 in May 2024.

[0021] Figure 8 This is the monoclonal sequencing result of the individual fertilized egg No. 1 injected in May 2024.

[0022] Fig. 9 Litopenaeus vannamei LqCy The results of gene-edited offspring testing. DETAILED DESCRIPTION

[0023] Method for realizing offspring gene editing by injecting Cas9 RNP into the mother muscle of white shrimp or Litopenaeus vannamei The target gene used is the male sex differentiation control gene E (Source patent: Male sex differentiation control gene of white shrimp E and guidance RNA and application) sequence is as follows: (1) E (SEQ ID No. 1) (see sequence listing) (a) Sequence characteristics * Length: 579 base pairs *Type: Nucleotide *Chain type: double chain *Topology: Linear (b) Molecule type: Nucleic acid Sequence description: SEQ ID No.1 ; (2) EcIAG-gRNA1 Information of (SEQ ID No.2) (a) Sequence characteristics * Length: 57 bases *Type: Nucleotide *Chain type: Single chain *Topology: Linear (b) Molecular type: RNA Sequence description: SEQ ID No.2 TAATACGACTCACTATAGTCAACAGAAAGACATTCAAGTTTTAGAGCTAGAAATAGC; (3) EcIAG-gRNA2 Information of (SEQ ID No.3) (a) Sequence characteristics * Length: 57 bases *Type: Nucleotide *Chain type: Single chain *Topology: Linear (b) Molecular type: RNA Sequence description: SEQ ID No.3 TAATACGACTCACTATAGGTTGATTGAAGGGGACGAAGTTTTAGAGCTAGAAATAGC.

[0024] The target gene used in the shrimp Penaeus vannamei is the male sex differentiation control gene LqCy (NCBI Accession No.KM066114), the sequence is as follows: (1) LqCy (SEQ ID No.4) (see sequence listing) (a) Sequence characteristics * Length: 507 base pairs *Type: Nucleotide *Chain type: double chain *Topology: Linear (b) Molecule type: Nucleic acid Sequence description: SEQ ID No.4 ATGAACCAACTCGCTGCCTCACGCACTCACGGCCTCGACGTGCCTGCTCAACTGTTACTCGGATTGCTGATGCTTCTCTCGCTGACTTCGACGTCGATCGGCTACAACGTCACAGGGATTCCTGTGG ACTTCGACTGCGGTGACATCGGCGACACCATGAGCCAGATCTGCAAGACGTTCCCCACGGCCAGGCCCCACGTGAGAGTGTCAAGGTCAGCCGATACCGACGACCTCTGGCAGGACGCGGGGGCAGG TCAGACAACGCCCCCTGACCTGCTCCCCCGCCGGCACCGCCTCCACCCCAGGGCCCTGAATCCAACGTGGAATCTCGAAAGGGACCTGATCAGAGACATCCTAGTGAGCCCCGAAGCCGCGCACGCC CTCGTCAGGACGCCCCGGGGCCGCGCGAAGAGGTCCTACAACGTGCAGGACGAGTGCTGCAACCACGTGAGCCAGCGGATGTGTGGCGGAGGAGATCCTGGAGTATTGCGAGGACCCGTACTTC; (2) LvIAG-gRNA1 Information of (SEQ ID No.5) (a) Sequence characteristics * Length: 59 bases *Type: Nucleotide *Chain type: Single chain *Topology: Linear (b) Molecular type: RNA Sequence description: SEQ ID No.5 TAATACGACTCACTATAGGCGATACCGACGACCTCTGGCGTTTTAGAGCTAGAAATAGC; (3) LvIAG-gRNA2 Information of (SEQ ID No.6) (a) Sequence characteristics * Length: 59 bases *Type: Nucleotide *Chain type: Single chain *Topology: Linear (b) Molecular type: RNA Sequence description: SEQ ID No.6 TAATACGACTCACTATAGGACGTTGGATTCAGGGCCCTGGTTTTAGAGCTAGAAATAGC.

[0025] The technologies used in the following examples mainly include: protein expression and purification, PCR amplification and detection, monoclonal sequencing, gRNA Synthesis and other molecular biology techniques.

[0026] Example 1 Cas9 protein expression, purification and activity detection (1) Cas9 protein expression The expression vector used was pET-28b-Cas9-His plasmid (Addgene, Plasmid #47327), and competent cells Transetta (DE3) were used for expression. The pET-28b-Cas9-His plasmid was transformed into competent cells Transetta (TransGen Biotech) as follows: a) Take 50 μL of Transetta (DE3) competent cells melted in an ice bath, add 3 μL of extracted pET-28b-Cas9-His plasmid, shake gently, and place on an ice bath for 30 minutes; b) Heat shock in a 42°C water bath for 45 seconds, then quickly transfer the tube to an ice bath for 2 minutes. Do not shake the centrifuge tube during this process. c) Add 500 μL of non-resistant LB liquid culture medium to the centrifuge tube, mix well, and incubate at 37°C, 200 rpm for 1 hour to allow the bacteria to recover; d) Take 60 μL of the transformed Transetta (DE3) competent cells and add them to LB agar medium containing 0.1% kanamycin (Kana+), spread the cells evenly, and culture them at 37°C overnight (14-16h); e) Picking single colonies: Use a sterilized toothpick to pick a single colony and transfer it to 500 μL LB liquid medium containing kanamycin, and culture at 37°C with shaking for 6 h; f) Take 50 μL of bacterial culture solution and inoculate it into 5 mL of LB liquid medium containing kanamycin, and culture it at 37°C with shaking overnight; g) Take 200 μL of the bacterial culture solution and add it to 200 mL of LB liquid medium containing kanamycin, and culture at 37°C with shaking until the OD600 of the bacterial solution is 0.6; h) Add isopropylthiogalactoside (IPTG) to the above bacterial solution to a final concentration of 0.75 mM and induce at 18°C ​​for 24 hours. Centrifuge at 8000 rpm for 4 minutes and discard the supernatant.

[0027] (2) Cas9 protein purification and activity detection a) Wash the collected precipitate twice with PBS, add 20 ml PBS to resuspend, and ultrasonicate for 30 minutes, 2 seconds on, 2 seconds off, until it becomes clear; b) Centrifuge at 12000rpm for 15min at 4℃, carefully transfer the supernatant (clarified sample) to a clean test tube without disturbing the precipitate. Filter the supernatant through a 0.22 filter membrane and store at 4℃ until use; c) The target protein is expressed in the supernatant as Figure 1 As shown, the purified protein refers to the instruction manual of TALON® Metal Affinity; d) After measuring the concentration, the protein activity was tested. The in vitro activity test was performed using a kit (GenScript, GenCrisprsgRNA Screening Kit, L00689), such as Figure 2 As shown, the expressed protein is active; e) The obtained Cas9 protein was stored at 4°C.

[0028] Example 2 gRNA synthesis The target gene used is the male sex differentiation control gene of white shrimp E (Source patent: Male sex differentiation control gene of white shrimp E and guidance RNA and application, patent number CN116622717A) and male sex differentiation control gene of Penaeus vannamei LqCy , EcIAG-gRNA The synthesis method of the above patent is referred to. The following is the sex differentiation control gene of Penaeus vannamei LqCy Guidance RNA(gRNA) The synthesis process.

[0029] (1) gRNA Framework plasmid construction First, according to gRNA Structure, design and synthesis gRNA Frame sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT (SEQ ID No. 7); Then the framework sequence was connected to the TA cloning site of the pMD19-T vector (TaKaRa, D102A) to obtain gRNA Framework plasmid pMD19-gRNA.

[0030] (2) gRNAThe template was synthesized using the online tool CRISPRdirect (http: / / crispr.dbcls.jp / ) to select the LvIAG gene. gRNA Site, design corresponding LvIAG-gRNA1-F and LvIAG-gRNA2-F , and design the reverse primer gRNA-R ; LvIAG-gRNA1-F :TAATACGACTCACTATAGGCGATACCGACGACCTCTGGCGTTTTAGAGCTAGAAATAGC (SEQ ID No.5), LvIAG-gRNA2-F :TAATACGACTCACTATAGGACGTTGGATTCAGGGCCCTGGTTTTAGAGCTAGAAATAGC (SEQ ID No. 6), gRNA-R :AAAAAAGCACCGACTCGGTGCCA (SEQ ID No.8); by gRNA The framework plasmid pMD19-gRNA was used as a template. LvIAG-gRNA1-F and LvIAG-gRNA2-F As the forward primer, gRNA-R Reverse primer, PCR amplification was performed using ExTaq polymerase (Takara, RR001A). The PCR amplification system is shown in Table 1. Table 1 PCR amplification system is as follows: Element Dosage ExTaq (Taq enzyme) 25 μL pMD19-gRNA (plasmid) 10 ng LvIAG-gRNA-F (forward primer) 1 μL gRNA-R (reverse primer) 1 μL <![CDATA[DEPC-H2O (DEPC water)]]> To 50 μL PCR cycle program: 98℃ pre-denaturation for 5 min; 98℃ 10 sec, 55℃ 5 sec, 72℃ 30 sec, 35 cycles; 72℃ extension for 10 min; 16℃ insulation. PCR products were detected by agarose gel electrophoresis. gRNA After the template size is used as gRNA In vitro transcription template.

[0031] (3) gRNA In vitro transcription and purification T7 in vitro transcription kit TranscriptAid T7 High Yield Transcription Kit (Thermo, K0441) was used to gRNA The PCR products were transcribed in vitro and synthesized gRNA, In vitro transcription system is shown in Table 2 ； Table 2 The in vitro transcription system is as follows: Element Dosage 5×TranscriptAid Buffer 4 μL ATP / TTP / CTP / UTP mix (nucleotide mixture) 2 μL×4 TranscriptAid Enzyme Mix 2 μL template 1 μg DEPC-H2O (DEPC water) Up to 20 μL The transcription system was reacted at 42℃ for 2 h; 2 μL DNase (QIAGEN, 79254) was added and digested at 37℃ for 15 min to remove the DNA template; 2 μL 0.5M EDTA (pH8.0) was added and reacted at 65℃ for 10 min to terminate the reaction; 1 μL was taken for electrophoresis detection. The phenol / chloroform extraction method (Lee S. Toni, et al., Optimization of phenol-chloroformRNA extraction, MethodsX, 2018, 5:599-608) was used to obtain the DNA from the digested system. gRNA LvIAG-gRNA1 and LvIAG-gRNA2 .

[0032] Example 3 Gene editing experiment of white shrimp progeny (1) Intramuscular injection of white shrimp mothers and collection of offspring embryos Female white shrimp injected with 10 μL Cas9 RNP intramuscularly were mated with wild-type male white shrimp (for the specific intramuscular injection experimental process, see (5)). After fertilization, when the fertilized eggs developed to the blastocyst stage (this was the 5th day after fertilization), the embryos were collected and stored in anhydrous ethanol. 24 embryos were randomly selected from each shrimp to test the gene editing efficiency.

[0033] (2) Embryo E PCR amplification The genomic DNA of randomly selected embryos was extracted using the lysate microextraction method (Gao et al., CRISPR / Cas9-mediated mutation onan insulin-like peptide encoding gene affects the growth of the ridgetailwhite prawn Exopalaemon carinicauda, ​​Front Endocrinol, 2022, 13:986491.). E Two sgRNA The genomic regions flanking the CRISPR target site were PCR amplified. The PCR amplification system is shown in Table 3; The PCR primers used were as follows: EcIAG-exon2-F: GACTGATCTTATGTATCGACATTGA (SEQ ID No. 9), EcIAG-exon2-R: CTGCATCACTAACTTTTGGTAAT (SEQ ID No. 10), Table 3 PCR amplification system is as follows: Element Dosage / μL 2×Reaction Mix 12.5 Golden DNA polymerase 0.25 DNA template 1 EcIAG-exon2-F (forward primer) 0.5 EcIAG-exon2-R (reverse primer) 0.5 DEPC-H2O (DEPC water) 10.25 Total volume 25 PCR amplification conditions are as follows: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 25 s, 35 cycles; extension at 72°C for 10 min; insulation at 16°C; Agarose gel electrophoresis was used to preliminarily determine whether there was an editing effect. The products obtained by amplifying the target sequence were sequenced using the Sanger sequencing method. The sequencing map was viewed using Chromas software, and the editing efficiency was calculated based on the spectrum results. In order to further determine the mutation type, the PCR amplification products of samples that may have an editing effect were selected for monoclonal detection based on the sequencing map.

[0034] (3) Cloning detection of PCR products The purified PCR product was connected to the pMD19-T vector (TaKaRa, 6013), transformed into E. coli DH5α competent cells (TransGen Biotech, CD201-01), plated, incubated overnight at 37°C, single clone colonies were picked, colony PCR amplification was performed, positive clones were screened, and sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing. The detailed steps are as follows: a) Connection connection system see Table 4, Table 4 The connection system is as follows: Element Dosage / μL pMD19-T 1 PCR products 4 Solution Ⅰ 5 Total volume 10 Incubate at 16°C for 4-6 h.

[0035] b) Transform the ligation product into competent cells Add the ligation product to 50 μL competent cells, mix well, and place on ice for 30 min. Heat shock in a 42 ℃ water bath for 45 seconds, and place on ice for 2 minutes. Add 500 μL of antibiotic-free LB liquid culture medium, place on a shaker at 220 rpm and culture at 37 ℃ for 2 hours.

[0036] c) Plate coating: 40-50 μL of bacterial solution was applied to a plate containing 0.1% ampicillin antibiotics, spread evenly, and cultured in a 37°C incubator overnight.

[0037] d) Pick a single colony In the clean bench, pick a monoclonal colony into 20 μL sterile water and vortex to mix. Take 1 μL of the mixture and add it to 19 μL of PCR system: 10 μL Premix Taq™ (Takara, RR901A), 0.5 μL each of M13 primers M13F / R, 9μLDEPC-H2O. PCR reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ annealing extension for 40 s, 35 cycles; 72℃ extension for 10 min. Add 500μL of 0.1% ampicillin antibiotics to the remaining 19μL sterile water and culture in a shaker at 37℃, 220rpm for 4-6 hours. According to the agarose gel electrophoresis test results of colony PCR, select the monoclonal bacterial solution with a band of about 700 bp and send it to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing.

[0038] The sequence of the M13 primer is as follows: M13F: AGGGTTTTCCCAGTCACG (SEQ ID No.11), M13R: GAGCGGATAACAATTTCACAC (SEQ ID No. 12).

[0039] (4) Sequence analysis The nucleotide sequence of the EcIAG gene obtained by sequencing was compared with the nucleotide sequence obtained by transcriptome sequencing using NCBI (https: / / www.ncbi.nlm.nih.gov / ) to verify its correctness. The results showed that the sequencing results were consistent. Sequence alignment was performed using DNAman version 7 software.

[0040] (5) Statistics of gene editing results of individual offspring of white shrimp a) Injection statistics for September 2023: Preparation of Cas9 RNP, the prepared Cas9 protein, EcIAG-gRNA1 and EcIAG-gRNA2 Add to PBS buffer (Solebol, P1020) to form a mixture, the mass concentration of Cas9 protein in the mixture is 1µg / µl, EcIAG-gRNA1 and EcIAG-gRNA2 The mass concentrations were 0.5 µg / µl.

[0041] Ten female white shrimps at the ovarian development stage II were selected and each female white shrimp was intramuscularly injected with 10 μL of 10 μg Cas9 protein and 10 μg sgRNA (in EcIAG-gRNA1 and EcIAG-gRNA2 They are 5The mixture of 100 μg and 20 μg was injected intramuscularly at the base of the first pair of swimming legs of the white shrimp. After injection, they were raised and mated with male white shrimps, and a total of 6 spawning white shrimps were obtained. 24 embryos that developed to blastocysts were randomly selected from the offspring of each shrimp for testing. The sequencing peaks of the embryonic stage where gene editing occurred are shown in the figure. Figure 3 As shown. Among the 6 shrimp eggs tested, 3 shrimp eggs had editing effects. EcIAG-sgRNA1 and EcIAG-sgRNA2 ,two sgRNA Large fragment deletions occur between Figure 4 The specific test results are shown in Table 5 below: Table 5 Statistics of editing effect of 6 spawning white shrimps Individual number Detection of embryo number Number of successful sequencing The number of edits that occurred Editing efficiency 1 24 22 0 0 2 24 23 8 34.8% 3 24 24 7 29.2% 4 24 23 7 30.4% 5 24 23 0 0 6 24 24 0 0 .

[0042] b) Injection statistics for November 2023 Six female white shrimps at the ovarian development stage II were selected for injection. The preparation of Cas9 RNP was the same as above. Each shrimp was injected with 10µl containing 10µg Cas9 protein and 10µg sgRNA (including EcIAG-gRNA1 and EcIAG-gRNA2 They are 5 The mixture of 100 μg and 20 μg was injected intramuscularly at the base of the first pair of swimming legs of the white shrimp. After injection, they were raised and mated with male white shrimps, and a total of 4 spawning white shrimps were obtained. 24 embryos that developed to blastocysts were randomly selected from the offspring of each shrimp for testing. The sequencing peaks of the embryonic stage where gene editing occurred are shown in the figure. Figure 5 As shown. Among the 4 shrimp eggs tested, 2 shrimp eggs had editing effects. EcIAG-sgRNA1 and EcIAG-sgRNA2 Large fragment deletions occur between Figure 6 The specific test results are shown in Table 6 below: Table 6 Statistics of editing effect of spawning of 4 spawning white shrimp Individual number Detection of embryo number Number of successful sequencing The number of edits that occurred Editing efficiency 1 24 20 1 5% 2 24 19 0 0 3 24 16 0 0 4 24 13 4 30.7% .

[0043] c) Injection statistics for May 2024 Ten female white shrimps in the ovarian development stage II were selected for injection. The preparation of Cas9 RNP was the same as above. Each shrimp was injected with 10µl containing 10µg Cas9 protein and 20µg sgRNA (in EcIAG-gRNA1 and EcIAG-gRNA2 They are 5The mixture of 100 μg and 20 μg was injected intramuscularly at the base of the first pair of swimming legs of white shrimp. After injection, they were raised and mated with male white shrimp, and a total of 9 spawning white shrimp were obtained. 24 embryos that developed to blastocysts were randomly selected from the offspring of each shrimp for testing. The embryos with gene editing were analyzed by agarose gel electrophoresis. Figure 7 As shown. Among the 9 shrimp eggs tested, 4 shrimp eggs had editing effects. EcIAG-sgRNA1 ,like Figure 8 The specific test results are shown in Table 7 below: Table 7 Statistics of editing effect of 9 spawning white shrimp Individual number Detection of embryo number Number of successful expansions The number of edits that occurred Editing efficiency 1 24 24 15 62.5% 2 24 24 0 0 3 24 24 8 33.3% 4 24 24 6 25% 5 24 24 0 0 6 24 24 0 0 7 24 24 1 4% 8 24 24 0 0 9 24 24 0 0 .

[0044] From the above results, it can be seen that the RNP injection method based on adult white shrimp is feasible, and gene editing of offspring can be achieved through adult injection. This method is simpler than the microinjection method, and can also be used to deliver other biomacromolecules to white shrimp oocytes during ovarian development, and can be applied to other crustaceans.

[0045] Example 4 Gene Editing Detection in Offspring of Litopenaeus vannamei Preparation of Cas9 RNP, the prepared Cas9 protein, LvIAG-gRNA1 and LvIAG-gRNA2 Add to PBS buffer (Solebol, P1020) to form a mixture, the mass concentration of Cas9 protein in the mixture is 1µg / µl, LvIAG-gRNA1 and LvIAG-gRNA2 The mass concentrations were 0.5µg / µl; The selection and injection method of female Penaeus vannamei was the same as that of white shrimp. A total of 4 female Penaeus vannamei were selected for intramuscular injection, and each was injected with 10µl containing 10µg Cas9 protein and 10µg sgRNA ( LvIAG-gRNA1 and LvIAG-gRNA2 They are 5 µg) were injected and then fed with male white shrimps. All four shrimps laid eggs, with each shrimp producing tens to hundreds of thousands of fertilized eggs. The fertilized eggs were hatched and developed to the nauplii stage for sampling. DNA The nauplii were extracted using an extraction kit (Takara, Cat. No. 9182). DNA Extraction, each shrimp offspring selected 192 nauplii for DNA For extraction method, refer to the kit instructions.

[0046] (1) LqCy First round PCR amplification of genes The primers used in the first round of PCR amplification were forward and reverse primers containing the linker and target gene sequences. The forward primer sequence is Lv-IAG-barcode-F:ACACGACGCTCTTCCGATCTNNNNNNNNCCACAAAACACCACAACAAGC (SEQ ID No. 13), The reverse primer sequence is Lv-IAG-barcode-R:TGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAATTACCTGACTCACCCT (SEQ ID No. 14); the amplification system and amplification program are shown in Tables 8 and 9: Table 8 The first round of PCR amplification system: Reagent name Volume (μL) 2xMultiplex DNA Buffer(high specificity) 5 Primer F 0.5 Primer R 0.5 DNA 4 Multiplex DNA Polywerase (high specificity) 0.25 Table 9 First round PCR amplification program settings: .

[0047] (2) LqCy Second round of PCR amplification of genes The second round of PCR amplification adds a forward tag (barcode) and a reverse tag (index) to each sequence. The second round forward primer contains the adapter sequence and the barcode. The forward primer sequence was: AATGATACGGCGACCACCGAGATCTACACAACGTGATACACTCTTTCCCTACACGACGCTCTTCCGATCTTGAACACG (SEQ ID No. 15); The reverse primer also includes a linker sequence and an index sequence, and the reverse primer sequence is: CAAGCAGAAGACGGCATACGAGATTAGCTTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCG (SEQ ID No. 16); amplification is performed using the first round product as a template, and the specific amplification system and amplification program are shown in Tables 10 and 11: Table 10 Second round PCR amplification system: Reagent name Volume (μL) 2xMultiplex DNA Buffer(high specificity) 12.5 Barcode (positive label) 0.4 Index (reverse label) 0.4 First round PCR products 5 Multiplex DNA Polywerase (high specificity) 0.5 Table 11 Second round PCR amplification program settings: .

[0048] (3) Gel recovery using a gel recovery kit All products from the same individual were recovered into the same tube using a gel recovery kit, and then the concentration was measured and sent to Novo Bio for high-throughput sequencing.

[0049] (4) Use Fastp software to perform preliminary analysis of the sequence The obtained second-generation sequencing files were quality controlled using Fastp software to remove adapters, polyG, and low-quality sequences. The sequences at both ends were then merged and exported as fastq. format files for subsequent analysis.

[0050] (5) Use blast software to compare the sequencing data with the target fragment The merged file obtained in the previous step was converted into fasta format, and the blast software was used for comparison to output the results.

[0051] The analysis results showed that the editing efficiencies of the offspring of four parental Penaeus vannamei after intramuscular injection were 2.1%, 8.7%, 6.3% and 3.4%, respectively. LvIAG-gRNA1 and LvIAG-gRNA2 There are fragment deletions between sequences such as Fig. 9 As shown, this method successfully achieved gene editing of offspring individuals of Penaeus vannamei.

Claims

1. A method for editing target genes in offspring of white shrimp or Litopenaeus vannamei, characterized in that: The method involves injecting Cas9 RNP into the muscle of a white shrimp or a Penaeus vannamei mother, followed by mating with a male individual to edit the target gene of the offspring individual. Cas9 RNP is a Cas9 protein and guide RNA mixture; said guide RNA Genes controlling male sex differentiation in white shrimp E Guidance RNA , or the gene controlling male sex differentiation in Penaeus vannamei LqCy Guidance RNA .

2. The method for editing target genes in progeny according to claim 1, characterized in that: The target gene is a male sex differentiation control gene of white shrimp E Male sex differentiation control gene in Litopenaeus vannamei LqCy .

3. The method for editing target genes in progeny according to claim 1, characterized in that: The mixture contains Cas9 protein and guide RNA The mass concentrations of Cas9 RNP were all greater than 0.5µg / µl, and the injection volume of Cas9 RNP was 8-20μL.

4. The method for editing target genes in progeny according to claim 1, characterized in that: Genes controlling male sex differentiation in white shrimp E Guidance RNA for EcIAG-gRNA1 and / or EcIAG-gRNA2 ,in EcIAG-gRNA1 The ribonucleotide sequence is shown in SEQ ID No. 2 in the sequence table, EcIAG-gRNA2 The ribonucleotide sequence is shown as SEQ ID No.3 in the sequence listing.

5. The method for editing target genes in progeny according to claim 1, characterized in that: Genes controlling male sex differentiation in Litopenaeus vannamei LqCy Guidance RNA for LvIAG-gRNA1 and / or LvIAG-gRNA2 ,in, LvIAG-gRNA1 The ribonucleotide sequence of is shown in SEQ ID No.5 in the sequence table, LvIAG-gRNA2 The ribonucleotide sequence is shown as SEQ ID No.6 in the sequence listing.

6. The method for editing target genes in progeny according to claim 1, characterized in that: The mixture contains Cas9 protein and guide RNA The mass concentration of Cas9 RNP is 1-5µg / µl, and the injection volume of Cas9 RNP is 10-15μL.

7. The method for editing target genes in progeny according to claim 1, characterized in that: The site of intramuscular injection in the mother is the base of the first pair of swimming legs of the white shrimp or the vannamei shrimp.

8. The method for editing target genes in progeny according to claim 1, characterized in that: The mother is a female shrimp of Litopenaeus chinensis or Litopenaeus vannamei whose ovaries are in the II or III developmental stage.

9. The method for editing a target gene in a progeny according to claim 1 or 8, characterized in that: The method is applied to delivering other biomacromolecules to egg cells of white shrimp or Litopenaeus vannamei whose ovaries are in the II or III developmental stage, wherein the biomacromolecules are one or both of proteins and plasmids.

10. The method for editing target genes in progeny according to claim 1, characterized in that: This method has also been applied to target gene editing in the offspring of other decapod crustaceans with similar ovarian development processes.

Images