Chicken SLCO1B3 gene insertion deletion site and application thereof

Abstract

The invention belongs to the technical field of molecular genetics, and particularly relates to a chicken SLCO1B3 gene insertion deletion site and application thereof, and the nucleotide sequence of the insertion deletion site is as shown in SEQ ID NO.4. The invention provides a new molecular marker for the field of molecular breeding of the green-shelled chickens, has important significance in the technical field of molecular genetics, and points out a new direction for identification and breeding of the green-shelled chickens.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetics, and particularly relates to a chicken SLCO1B3 gene insertion and deletion site and application thereof. Background Art

[0002] The main eggshell colors of chickens are white, pink, brown and green, etc. There are only a few local breeds in China that can produce green-shelled eggs, such as Dongxiang green-shelled laying hens, Lushi chickens, Changshun green-shelled laying hens and Jiuyuan black chickens, and the proportion of green-shelled eggs at the population level is relatively low.

[0003] Starting from 2021, a nationwide survey of agricultural germplasm resources will be organized to find out the status of my country's crop, livestock and aquatic germplasm resources. The implementation plan for key research and development of crops and livestock breeding in Sichuan Province includes the collection, preservation, creation, identification of germplasm and gene resources, and the breeding of new livestock and aquatic varieties (matching systems) into key research and development tasks. Therefore, the present invention is led by Dazhou Animal Husbandry Technology Extension Station to explore and protect the excellent genetic resources of the original Jiuyuan Black Chicken through genomic markers. In its natural population, about 5% of the individuals produce green-shelled eggs. In the early stage, we worked with the International Livestock Research Institute (ILRI) and the Beijing Institute of Animal Husbandry and Veterinary Medicine of the Chinese Academy of Agricultural Sciences (IASCAAS) through the study of some Jiuyuan Black chicken populations and other 4 green-shell laying hen populations, that is, the insertion and integration frequency and type of EAV-HP in the 5′-non-coding region of the SLCO1B3 gene in the 5 green-shell laying hen populations. It was found that after preliminary selection, the Jiuyuan Black chicken population carried With a higher frequency of EAV-HP integration, EAV-HP is integrated in the 5'-noncoding region of the SLCO1B3 gene in a reverse insertion manner, thereby initiating the specific expression of the SLCO1B3 gene in the eggshell gland and transporting biliverdin to be deposited on the eggshell, which is completely in line with the molecular genetic mechanism of green-shell egg formation and causes chickens to lay green-shell eggs. According to the PCR test results, groups can be identified, varieties can be selected, and supplementary feeding can be cultivated. The breeding effects can be analyzed in time, and the breeding methods can be continuously improved, laying the foundation for the later breeding of characteristic, high-quality, grain-saving, and high-yield new varieties and supporting systems, realizing the application of molecular marker-assisted breeding.

[0004] Based on the above needs, a molecular marker of a gene related to green-shell chicken is invented to provide a molecular marker for the field of molecular breeding of green-shell chicken, which is of great significance in the field of molecular genetics technology. Summary of the invention

[0005] The present invention firstly provides an insertion and deletion site of a chicken SLCO1B3 gene, wherein the nucleotide sequence of the insertion and deletion site is shown in SEQ ID NO.4.

[0006] The present invention also provides a primer set for identifying or assisting in identifying the insertion and deletion sites of the chicken SLCO1B3 gene. The kit contains primer sequences as shown in SEQ ID NO.1-SEQ ID NO.3.

[0007] The present invention also provides a kit for identifying or assisting in identifying the insertion and deletion sites of the chicken SLCO1B3 gene, which comprises the primer set.

[0008] The present invention also provides the application of the chicken SLCO1B3 gene insertion / deletion site in identifying or assisting in identifying green-shell chickens.

[0009] The present invention also provides an application of detecting the insertion and deletion site of the chicken SLCO1B3 gene in identifying or assisting in identifying green-shell chickens.

[0010] In certain embodiments, the substance is a primer or a kit.

[0011] In certain embodiments, the primer sequences are shown in SEQ ID NO.1-SEQ ID NO.3.

[0012] The present invention also provides the use of the above primer set or the above kit in any of the following:

[0013] (A1) Identify or assist in identifying the insertion and deletion sites of the chicken SLCO1B3 gene;

[0014] (A2) Identify or assist in identifying green-shell chicken germplasm resources;

[0015] (A3) Breeding of green-shell chicken.

[0016] The present invention also provides a method for detecting the insertion and deletion sites of the chicken SLCO1B3 gene, comprising the steps of detecting the insertion and deletion sites of the chicken SLCO1B3 gene, and judging whether the SLCO1B3 gene has insertion and deletion according to the detection result.

[0017] The present invention also provides the application of the above method in any of the following:

[0018] (A1) Identify or assist in identifying green-shell chicken germplasm resources;

[0019] (A2) Breeding of green-shell chicken.

[0020] Compared with the prior art, the present invention has at least the following beneficial effects:

[0021] The present invention discovers a molecular marker of a gene related to green-shell chicken, provides a new molecular marker for the field of molecular breeding of green-shell chicken, has important significance in the field of molecular genetics technology, and points out a new direction for the identification and breeding of green-shell chicken. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 PCR amplification electrophoresis of some samples;

[0023] Figure 2 Typing peak diagram;

[0024] Figure 3 Sequencing results Sequence alignment results; underlined fragments are inserted fragments. DETAILED DESCRIPTION

[0025] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0026] Example 1

[0027] Materials: A total of 1,648 Jiuyuan Black Chickens (1,200 hens and 448 roosters) were selected from the Sichuan Provincial Genetic Resource Conservation Farm, Sichuan Provincial Livestock and Poultry Core Breeding Farm and Jiuyuan Black Chicken Original Farm - Wanyuan Hengkang Agriculture Co., Ltd. through scientific screening and raised under the same conditions; they were raised with reference to the "Chicken Rearing Standards" (NY / T33-2004) and combined with actual production conditions, with free drinking water and food.

[0028] method:

[0029] (1) Extraction of total DNA from blood: Blood was collected from the wing using a vacuum blood collection tube, and DNA was extracted using a whole blood genomic DNA rapid extraction kit (consisting of red blood cell lysate, cell nucleus lysate, protein precipitation solution and DNA dissolution solution), and then dissolved in TE. The extracted DNA samples were detected by 0.8% agarose gel electrophoresis. The test results showed that the DNA sample bands in the lanes were clear and neat, with no obvious tailing phenomenon, indicating that the extracted DNA had good integrity and no obvious degradation, and could be used as template DNA for PCR amplification. The concentration and purity of all the extracted genomic DNA were detected by ND-10001 UV spectrophotometer. The results showed that the OD260 / 280 values ​​of each sample were between 1.8 and 2.0, indicating that the purity of the genotype DNA was good. According to the concentration tested, a portion of the sample DNA stock solution was taken and diluted to about 50-100 ng / μL for working genomic DNA, and the remaining DNA stock solution was stored at -20°C.

[0030] (2) PCR detection

[0031] The primers were synthesized by Wuhan Tianyi Huayu Gene Technology Co., Ltd. and the primer sequences are shown in Table 1.

[0032] Table 1. Primer sequences

[0033]

[0034] Note: The underlined sequence is the linker sequence of Ad1-FAM.

[0035] The PCR method was used to detect whether the chicken genomic DNA had insertion and deletion sites of the chicken SLCO1B3 gene. The band type of the PCR amplification product was detected by 2% agarose gel electrophoresis. The results showed that the amplified target fragment length was 205bp and / or about 385bp. The amplified product was sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing. The typing peak diagram of some results is shown in the figure below. Figure 2 As shown, the sequencing results are consistent with the electrophoresis results. Figure 3 As shown, after comparison with the reference sequence, it was found that SEQID NO.4: GTTTCCCTCGCTACGCATACAACA is an inserted fragment. After verification, the SLCO1B3 gene of green-shell chickens all contain the above inserted fragment, while non-green-shell chickens do not contain the above fragment. Green-shell chickens show a single band of 205bp or a double band of 205bp and 385bp, while non-green-shell laying hens show a single band of 385bp.

[0036] Example 2 Verification of Indel Fragment Identification

[0037] New samples were selected, 50 pure green-shell laying hens bred by other methods and 50 non-green-shell chickens, and the primers described in Example 1 were used for amplification. The PCR amplification products were detected by 2% agarose gel electrophoresis. The actual size of the amplified fragment was consistent with the size of the target product, 205 bp was after insertion, and 385 bp was not inserted. That is, according to the judgment criteria of Example 1, the accuracy of identifying green-shell chickens using the insertion and deletion fragments was 100%, indicating that the insertion and deletion fragments mentioned above are of great significance in the field of molecular genetics technology.

[0038] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A chicken SLCO1B3 gene insertion and deletion site, characterized in that: The nucleotide sequence of the insertion / deletion site is shown in SEQ ID NO.

4.

2. A primer set for identifying or assisting in identifying the insertion and deletion sites of the chicken SLCO1B3 gene according to claim 1, characterized in that: The kit contains primer sequences as shown in SEQ ID NO.1-SEQ ID NO.

3.

3. A kit for identifying or assisting in identifying the insertion and deletion sites of the chicken SLCO1B3 gene according to claim 1, characterized in that: It comprises the primer set according to claim 2.

4. Use of the chicken SLCO1B3 gene insertion and deletion site as claimed in claim 1 in identifying or assisting in identifying green-shell chicken.

5. Use of the method for detecting the insertion / deletion site of the chicken SLCO1B3 gene as claimed in claim 1 in identifying or assisting in identifying green-shell chicken.

6. The use according to claim 5, characterized in that: The substance is a primer or a kit.

7. The use according to claim 6, characterized in that: The primer sequences are shown as SEQ ID NO.1-SEQ ID NO.

3.

8. Use of the primer set according to claim 2 or the kit according to claim 3 in any of the following: (A1) Identify or assist in identifying the insertion and deletion sites of the chicken SLCO1B3 gene; (A2) Identify or assist in identifying green-shell chicken germplasm resources; (A3) Breeding of green-shell chicken.

9. A method for detecting insertion and deletion sites of chicken SLCO1B3 gene, characterized in that: The method comprises the steps of detecting the insertion / deletion site of the chicken SLCO1B3 gene according to claim 1, and judging whether the SLCO1B3 gene has insertion / deletion based on the detection result.

10. Use of the method according to claim 9 in any of the following: (A1) Identify or assist in identifying green-shell chicken germplasm resources; (A2) Breeding of green-shell chicken.

Images