SNP molecular marker related to dry and wet environment adaptability of sheep and application thereof

Abstract

The application discloses a SNP molecular marker related to dry and wet environment adaptability of sheep and application thereof, and belongs to the field of molecular biology. BMPR1B The SNP molecular marker related to the wet environment adaptability of sheep is located in an intron region of a gene, and a gene mutation of the site significantly affects the sheep; when the genotype of the site is AA, the sheep is of dry environment adaptability; and when the genotype of the site is GG, the sheep is of wet environment adaptability, so that a new molecular breeding marker is provided for screening or introduction of the sheep with the wet environment adaptability.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and particularly relates to a SNP molecular marker related to the dry and wet environment adaptability of sheep and application thereof. BACKGROUND

[0002] The large-scale and intensive breeding mode of mutton sheep has become an inevitable trend of the development of mutton sheep industry in China. In modern intensive sheep production, the breeding density is increasing, and the influence of environmental stress on the production and health of sheep cannot be ignored. Among them, the hot environment is often one of the important factors affecting the development of the sheep industry. In the hot environment, temperature and humidity are the two most sensitive factors. Under the high temperature and high humidity environment in summer, mutton sheep is prone to heat stress reaction, causing physiological and biochemical, immune response and metabolic disorders, thereby affecting the production performance of mutton sheep, including feed intake, daily weight gain, finishing time, reproductive performance and immune function of the body, etc., bringing huge economic losses to the summer production of mutton sheep industry. The sweat glands of sheep breeds are not developed, and their long and dense wool makes the summer hot and humid climate more harmful to sheep. How to improve the production performance of sheep under heat stress in summer has become a research focus. Accelerating the breeding of high-temperature and high-humidity resistant sheep breeds is an important way to solve the above problems.

[0003] Mutton sheep heat stress belongs to the category of stress. THI (Temperature-humidity index) is the most commonly used evaluation index of animal heat stress, and THI 25.6 is considered as extremely severe heat stress. At present, people have achieved some results in alleviating the heat stress of mutton sheep by improving environmental management, feeding management and nutritional regulation, and improved the growth and reproductive performance of mutton sheep in summer. However, to fundamentally solve the problem, it is still necessary to breed mutton sheep breeds or lines that can resist high temperature and high humidity. The heritability of heat tolerance of domestic animals is about 0.15-0.30, and by selecting heat-resistant mutton sheep for breeding, certain genetic progress can be obtained.

[0004] Bone morphogenetic protein receptor 1B (Bone morphogenetic protein receptor 1B, BMPR1BAlso known as ALK6 (Activin receptor-like kinases 6), it is located on sheep chromosome 6 and is a membrane receptor for bone morphogenetic proteins. It belongs to the transforming growth factor-beta (TGF-β) superfamily and is widely distributed in various tissues of the animal body, but is mainly expressed in ovarian oocytes and granulosa cells. It plays an important role in cumulus cell expansion, ovulation circulation, and skeletal system development, primarily participating in the signal transduction of BMP2, BMP4, BMP6 / Vgr1 (Vg-related protein 1), BMP7 / OP1 (Osteogenic protein 1), GDF5, and BMP15. It is an important transmembrane receptor protein. (The last sentence appears to be a separate, unrelated statement.) FecB The mutation is an A746G mutation in the coding region of the sheep BMPR1B gene, which changes the amino acid at position 249 from glutamine to arginine (Q249R). This mutation has been officially named by the International Committee on Nomenclature of Sheep and Goat Genetics. FecB This gene mutation additively increases the number of ovulations and lambs born. Recent studies have found that BMPR1B activity is regulated by the small molecule repressor protein FKBP1A, which acts as a key switch controlling the activity of the BMPR1B and BMP / SMAD pathways. However... BMPR1B Whether genes play a role in environmental adaptation has not yet been reported. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker related to the adaptability of sheep to dry and wet environments and its application.

[0006] To achieve the objectives of this invention, in a first aspect, this invention provides a SNP molecular marker related to the adaptability of sheep to dry and wet environments, said molecular marker containing sheep... BMPR1B The nucleotide sequence of the gene, as shown in SEQ ID NO:1, has a polymorphism of A / G at position 289.

[0007] Furthermore, when the genotype of the polymorphic locus is AA, the sheep is adapted to dry environments; when the genotype of the polymorphic locus is GG, the sheep is adapted to wet environments.

[0008] In this invention, sheep BMPR1B The gene's reference sequence number in NCBI is NC_056059.1 ARS-UI_Ramb_v2.0.

[0009] In a second aspect, the present application provides primers for amplifying the molecular marker, including an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO: 3.

[0010] In a third aspect, the present application provides a detection reagent or kit containing the primers.

[0011] In a fourth aspect, the present application provides a method for identifying and breeding a sheep strain with adaptability to a humid environment, comprising:

[0012] 1) extracting total DNA of the sheep to be tested;

[0013] 2) using the primers shown in SEQ ID NO: 2-3 to perform PCR amplification with the DNA as a template;

[0014] 3) analyzing the PCR amplification product.

[0015] Preferably, the PCR reaction system is: 2 × Phanta Max Master Mix 12.5 μL, 50-100 ng of DNA template, 10 μM of each of the upstream and downstream primers 1 μL, and ddH2O supplemented to 25 μL.

[0016] Preferably, the PCR reaction program is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 60 s, 34 cycles; and 72℃ final extension for 5 min.

[0017] Further, step 3) comprises: performing sanger sequencing on the amplification product to obtain the genotype of the site with the polymorphism, and when the genotype is GG, the sheep to be tested is a sheep with adaptability to a humid environment.

[0018] In a fifth aspect, the present application provides any of the following applications of the molecular marker or its detection reagent:

[0019] (1) for early prediction of the adaptability of sheep to dry and humid environments;

[0020] (2) for sheep molecular marker-assisted breeding.

[0021] By means of the above technical solutions, the present application has at least the following advantages and beneficial effects:

[0022] The present application provides a SNP molecular marker related to the adaptability of sheep to a humid environment, which is located in an intron region of BMPR1B The mutation of the site significantly affects sheep, and when the genotype of the site is AA, it is a sheep with adaptability to a dry environment; and when the genotype of the site is GG, it is a sheep with adaptability to a humid environment, thereby providing a new molecular breeding marker for screening or introducing sheep with adaptability to a humid environment. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 The correlation degree of the signal matrix and the heterozygosity matrix for different environmental factors and populations in the preferred embodiment of the present application.

[0024] Figure 2 The BMPR1B gene interval on the sheep genome is significantly correlated with the precipitation (bio14) and humidity of the driest month of the sheep's region in the preferred embodiment of the present application. Wherein, A, the local Manhattan plot of chr6 of the LFMM result of the A, bio14 environmental factor, the red point represents the site in the gene interval; B, the haplotype of the high bio14 and low bio14 populations in the gene region. BMPR1B BMPR1B

[0025] Figure 3 The PCR result graph containing the target SNP site in the preferred embodiment of the present application. The leftmost band is DNA Marker, and the remaining bands are PCR amplification bands of sheep DNA.

[0026] Figure 4 The sanger sequencing result of the PCR product fragment in the preferred embodiment of the present application. DETAILED DESCRIPTION

[0027] The present application aims to provide a SNP molecular marker related to the adaptability of sheep to a humid environment and an application thereof.

[0028] The present application also provides a method for screening sheep with adaptability to a humid environment.

[0029] The present application adopts the following technical scheme:

[0030] The present application provides a method for screening sheep with adaptability to a humid environment, detects the genotype of the 30090758 site on the 6th chromosome of the sheep, the reference genome version is ARS-UI Rammb v2.0, and screens through the genotype of the site:

[0031] When the genotype of the site is AA, it is a sheep with adaptability to a dry environment;

[0032] When the genotype of the site is GG, it is a sheep with adaptability to a humid environment.

[0033] The present application also provides an application of a substance for detecting the genotype of the SNP site in the auxiliary breeding of sheep adaptability to dry and humid environments, the SNP site is located at the 30090758 site on the 6th chromosome of the sheep, is located at the 289th site of the nucleotide sequence described in SEQ ID NO: 1, and has A / G polymorphism (n=a or g). ​​

[0034] Further, the substance is a primer pair, and nucleotide sequences of the primer pair are shown in SEQ ID NO: 2-3.

[0035] The application also provides a primer pair, and nucleotide sequences of the primer pair are shown in SEQ ID NO: 2-3.

[0036] The application also provides a kit containing the primer pair.

[0037] The following examples are intended to illustrate the present application but not to limit the scope of the present application. If not specifically mentioned, the technical means used in the examples are the conventional means well known to those skilled in the art, and the raw materials used are commercially available.

[0038] Example 1 BMPR1B Discovery of SNP molecular markers of genes

[0039] According to the resequencing data of sheep population samples in different humidity environments across the country and climate data, the genetic regulation of environmental adaptability changes of sheep is discussed.

[0040] 1. Association analysis of environmental factors, population selection signals and heterozygosity

[0041] Different local sheep breeds are used, including the following samples:

[0042] The population in dry environments includes Tibetan sheep, Oula sheep, small-tail Han sheep, small-tail Han sheep, Sishui sheep, Wadi sheep, and Tan sheep.

[0043] The population in humid environments includes the Hu sheep population from 8 core breeding farms.

[0044] Through redundancy analysis (RDA) of climate data and resequencing genomic data, it is found that for different genotypes, the annual temperature range, the average temperature of the warmest season, and the precipitation of the wettest month can explain most of the environmental factor variation. It is also found that the precipitation of the driest month (bio14) is significantly associated with the selection signal value and population heterozygosity between different sheep populations ( Figure 1 ).

[0045] 2. Identification of marker sites by association analysis

[0046] Using latent factor mixed models (LFMM), the bio14 environmental factor is associated with genomic data, and the results show that the bio14-associated sites are mainly distributed on chromosomes 6 and 10. It is suggested that there is a major gene for adaptation to the bio14 environmental factor ( Figure 2 ).BMPR1B The locus of intron region of gene chr6: 30090758 (reference genome version ARS-UI Rammb v2.0, located at the 252nd nucleotide sequence shown in SEQ ID NO: 1) is dominated by A allele in dry environment population, with a frequency of 0.67, and G allele is dominant in high humidity environment population, with a frequency as high as 0.97, and the allele frequency and BIO14 environmental factor distribution gradient trend are consistent, suggesting that the A allele of this locus helps the sheep to adapt to dry environment, and the G allele helps the sheep to adapt to humid environment, and the mutation of this locus helps the sheep to adapt to different precipitation in different regions Figure 2 ), which can be used as a molecular breeding marker for screening or introducing sheep with the ability to adapt to humid environment.

[0047] 3. Locus genotype detection

[0048] For the Chr 6_ 3009075 locus, the following primers were used for PCR amplification and sequencing:

[0049] BMPR1B HF: 5'- AAGCACTCCCAAGACAGCTTG (SEQ ID NO: 2)

[0050] BMPR1B HR: 5'- GTCCCTGCAGTGTACGATTGA (SEQ ID NO: 3)

[0051] The high-fidelity PCR enzyme (2 × Phanta® MaxMaster Mix) of Nanjing Novozyme Biotech Co., Ltd. was used for amplification, and the item number was P525-02.

[0052] The amplification system of chr6: 30090758 is shown in Table 1:

[0053] Table 1 Amplification system of chr6: 30090758

[0054]

[0055]

[0056] The product obtained by the PCR amplification in the previous step was used for Sanger sequencing Figure 3 ), sequencing was performed by Shanghai Bioengineering Co., Ltd., and after comparing the sequencing results with the reference gene sequence, the genotypes of different SNP sites could be obtained Figure 4 ).

[0057] Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application claimed.

Claims

1. A method for identifying and breeding sheep breeds adapted to humid environments, characterized in that, include: 1) Extract total DNA from the sheep to be tested; 2) Using DNA as a template, PCR amplification was performed on SNP molecular markers related to sheep's adaptation to dry and wet environments using primers shown in SEQ ID NO:2-3; the sequence of the molecular marker is shown in SEQ ID NO:1, wherein the polymorphism at position 289 of SEQ ID NO:1 is A / G; 3) Analyze the polymorphism of the SNP molecular markers in the PCR amplification products; when the genotype of the polymorphic site is AA, it is a sheep adapted to dry environment; when the genotype of the polymorphic site is GG, it is a sheep adapted to humid environment.

2. The method according to claim 1, characterized in that, The PCR reaction system consisted of: 12.5 μL of 2 × Phanta Max MasterMix, 50-100 ng of DNA template, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to a final volume of 25 μL.

3. The method according to claim 2, characterized in that, The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 60 s, 34 cycles; 72℃ final extension for 5 min.

4. The method according to claim 2 or 3, characterized in that, Step 3) includes: performing Sanger sequencing on the amplified product to obtain the genotype of the site with the polymorphism. When the genotype is GG, the sheep to be tested is a sheep adapted to a humid environment.

5. Any of the following applications of reagents for detecting SNP molecular markers related to sheep's adaptability to dry and wet environments: (1) Used for early prediction of sheep’s adaptability to dry and wet environments; (2) Used for molecular marker-assisted breeding of sheep to adapt to dry and wet environments; The sequence of the molecular marker is shown in SEQ ID NO:1, wherein the polymorphism at position 289 of SEQ ID NO:1 is A / G.

Images