KASP molecular marker significantly correlated with copper content in wheat grains and its application

Abstract

The present invention discloses a KASP molecular marker significantly associated with the copper content of wheat grains and its application. The KASP molecular marker has the following nucleotide sequence: TATGCTACTGAATGTTTGCCATCATATCAAACCTC[G / T]GGGTCAAGAATGATTCGAACTCTAGTCGACATTGG. The KASP molecular marker of the present invention can be used to identify the main effect QTL locus related to the copper (Cu) content of wheat grains. QCu.yaas‑7A Molecular marker-assisted selection breeding is a major QTL locus related to wheat copper (Cu) content. QCu.yaas‑7A Effective use in breeding provides a good tool to quickly screen wheat grain copper (Cu) content.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat breeding, and particularly relates to a KASP molecular marker significantly correlated with the copper content of wheat grains and an application thereof. Background Art

[0002] Trace elements are present in extremely small amounts in the human body, typically accounting for between 0.005% and 0.01% of the body's total mass. Despite their low concentrations, trace elements play important roles in the human body. However, deficiencies in trace elements can often occur due to dietary habits and other factors. Trace element deficiencies can lead to malnutrition, skin and hair abnormalities, digestive symptoms, weakened immune system function, nervous system dysfunction, and circulatory symptoms. Copper (Cu) is essential for human health, playing a variety of physiological roles, including participating in and maintaining hematopoiesis, participating in enzyme composition and activation, protecting normal hair pigmentation, maintaining cardiovascular and bone health, and promoting growth and development. Severe or chronic marginal copper deficiency can lead to pediatric developmental problems and endemic diseases, such as knock-knee valgum in Africa. Due to its effects on vascular cellular components, white blood cell and platelet function, and lipoprotein metabolism, copper ions play a significant role in atherosclerosis. Insufficient copper intake can contribute to atherosclerosis. In addition, copper is an important component of human nerve substances. Insufficient intake can lead to nervous system disorders and brain dysfunction, causing insomnia, memory loss, disordered thinking, slow reaction, etc.

[0003] Wheat, rice, and corn are the world's three major grain crops, but trace elements are present in very low concentrations. Trace element content in wheat varies significantly across different regions and genotypes in my country. Wheat from some regions and varieties has trace element content below recommended standards, necessitating further optimization of growing conditions and variety selection to enhance its nutritional value. Due to the importance of copper (Cu), genetic research on wheat grain copper content, identifying stable genetic loci, and developing molecular markers for use in nutritional breeding of wheat trace elements are one way to address copper deficiency in humans through dietary intervention. Graham (Transfer to wheat of the copperefficiency factor carried on rye chromosome 5RL. Plant and Soil 1987, 99:107-114; Graham RD. Breeding for nutritional characteristics in cereals.Advances in Plant Nutrition 1984, 1: 57-102.) and Schlegel (Confirmation of a4BL. 5RL wheat rye translocation line in wheat cultivar 'Viking' shows highcopper efficiency. Plant breeding, 1991, 107: 226-234.) located the copper efficiency factor on chromosome 5B. Ren Pengxun (2022) constructed a high-density genetic map using 23,536 high-quality DArT markers and discovered QTLs for copper (Cu) in wheat grains. QGCu.haust-4BS 、 QGCu.haust-7DS However, no relevant molecular markers have been developed (QTL Analysis and Related Gene Discovery of Trace Element Content in Wheat Grains [D]. Henan University of Science and Technology, 2022. DOI: 10.27115 / d.cnki.glygc.2022.000981.). Previous studies on the genetics of copper (Cu) trace element content in wheat grains have been limited, and no molecular markers have been directly applied in wheat breeding. Summary of the Invention

[0004] To address the problem that copper (Cu) is easily deficient in humans and wheat, but the copper (Cu) content of wheat varieties cannot be effectively increased, the present invention provides a KASP molecular marker significantly associated with copper content in wheat grains and its application. The present invention uses a wheat 55K SNP high-throughput gene chip to obtain genotype data, combines two years of phenotypic data and average values ​​of copper (Cu) trace elements in wheat, and conducts QTL mapping. A major QTL locus significantly associated with copper (Cu) content was detected in Yangmai No. 4. QCu.yaas-7A Based on this, a KASP marker and primer set was developed to efficiently screen the copper (Cu) content in wheat grains.

[0005] The present invention uses the wheat 55K SNP high-throughput gene chip to obtain genotype data and detects a major effect QTL locus significantly associated with copper (Cu) content on chromosome 7A from Yangmai No. 4. QCu.yaas-7A , and further developed KASP markers and dedicated primer sets KASP-QCu-7A .

[0006] In one aspect, the present invention provides a method for detecting QTLs for copper (Cu) content in wheat grains. QCu.yaas-7A The molecular marker is a KASP molecular marker having a nucleotide sequence as shown in SEQ ID No.4.

[0007] A second aspect of the present invention provides a primer set for detecting whether the allelic variation at position 36 in the nucleotide sequence shown in SEQ ID No. 4 is GG, TT, or G and T. The primer set is a complete primer set consisting of the upstream primers shown in SEQ ID No. 1 and SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0008] Furthermore, the upstream primers are designed based on the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome and its upstream sequence, and the 3'-terminal deoxyribonucleotide of one of the upstream primers is G, and the 3'-terminal deoxyribonucleotide of the other upstream primer is T;

[0009] The downstream primer is designed based on the downstream sequence of the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome.

[0010] Furthermore, the 5' end of the upstream primer shown in SEQ ID No. 1 is connected to a fluorescent tag sequence FAM, and the 5' end of the upstream primer shown in SEQ ID No. 2 is connected to a fluorescent tag sequence HEX.

[0011] The third aspect of the present invention provides a reagent or kit containing the above-mentioned primer set.

[0012] A fourth aspect of the present invention provides the use of the above-mentioned primer set, reagent, or kit in any of the following:

[0013] (A) Identify or assist in identifying wheat grain copper (Cu) content traits;

[0014] (B) Comparison of copper (Cu) content in wheat grains;

[0015] (C) Breeding or screening wheat plants, lines, strains, or varieties that have relatively high wheat grain copper (Cu) content;

[0016] (D) Breeding or screening wheat plants, lines, strains, or varieties with relatively low wheat grain copper (Cu) content;

[0017] (E) preparing a product for comparing the copper (Cu) content of wheat grains to be tested;

[0018] (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties having relatively high copper (Cu) content in wheat grain;

[0019] (G) Preparing a product for breeding or screening wheat plants, lines, varieties or varieties with relatively low copper (Cu) content in wheat grains.

[0020] A fifth aspect of the present invention provides a method for detecting whether the allele variation at position 36 in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T, comprising the following steps (1) or (2):

[0021] (1) Direct sequencing;

[0022] (2) PCR amplification of the wheat genomic DNA to be tested is performed using the above primer set or a reagent or kit containing the above primer set, the amplified product is subjected to fluorescence signal scanning, the scanning data is analyzed, and then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the wheat gene to be tested is determined according to the following method:

[0023] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is displayed as red, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a homozygous T;

[0024] If the fluorescence signal data of the amplified product of the wheat to be tested is blue after analysis by Kluster Caller software, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome to be tested is a homozygous G;

[0025] If the fluorescence signal data of the amplified product of the wheat to be tested is green after analysis by Kluster Caller software, the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a hybrid of G and T.

[0026] A sixth aspect of the present invention provides any of the following methods:

[0027] Method A: A method for comparing the copper (Cu) content of wheat grains to be tested, comprising the following steps:

[0028] (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence of SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T;

[0029] (A2) determining the copper (Cu) content of the wheat grain to be tested as follows: the copper (Cu) content of the wheat grain to be tested, in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is G, is higher than the copper (Cu) content of the wheat grain to be tested, in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is T, or is a heterozygote of G and T;

[0030] Method B: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively high wheat grain copper (Cu) content, comprising the following steps:

[0031] (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence of SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T;

[0032] (B2) selecting a wheat plant to be tested that is homozygous for G at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome as a parent for breeding, and selecting wheat plants that are homozygous for G at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or cultivars having a relatively high grain copper (Cu) content;

[0033] Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively low wheat grain copper (Cu) content, comprising the following steps:

[0034] (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T;

[0035] (C2) selecting a wheat plant to be tested that is homozygous for T at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome as a parent for breeding, and selecting wheat plants that are homozygous for T at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or varieties having a relatively low grain copper (Cu) content.

[0036] Specifically, in the method A, the method B and the method C, the method of detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT or G and T is the method described in the fifth aspect of the present invention.

[0037] A seventh aspect of the present invention provides the use of the aforementioned KASP molecular marker, primer set, reagent or kit, and the aforementioned method in molecular marker-assisted breeding for wheat grain copper (Cu) content.

[0038] Through the above technical solution, the present invention achieves the following beneficial effects:

[0039] The KASP molecular marker described in the present invention can be used to identify the major QTL loci related to copper (Cu) content in wheat grains. QCu.yaas-7A Molecular marker-assisted selection breeding. The present invention is a major effect QTL locus related to the copper (Cu) content in wheat grains. QCu.yaas-7A It provides a good tool for effective use in breeding. This marker can quickly screen the copper (Cu) content in wheat grains, facilitate the screening of wheat materials carrying excellent allelic variations, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the specific embodiments:

[0041] Figure 1 For the Yangmai 4 / Yanzhan 1 RIL population QCu.yaas-7A Positioning map;

[0042] Figure 2 for QCu.yaas-7AKASP mark KASP-QCu-7A The genotypes amplified in 149 wheat high-generation lines (A) and QCu.yaas-7A Effect of on copper (Cu) content (B), the different letters after the copper (Cu) content represent the difference between the two groups by t test. P There was a significant difference at the <0.001 level. DETAILED DESCRIPTION

[0043] The following is a detailed description of the specific embodiments of the present invention in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0044] In this experiment, a population of recombinant inbred lines (RILs) was created by crossing Yangmai 4, a high-quality and high-yield wheat variety from the middle and lower reaches of the Yangtze River, with Yanzhan 1, a high-yield wheat variety from the Huanghuai wheat region, as the paternal parent. A genetic map was constructed using the Wheat 55K SNP array. Combined with two years of copper (Cu) phenotypic data, genetic regulatory sites were discovered and corresponding KASP markers were developed. These markers were then validated in the developed wheat lines, aiming to provide materials and methods for the selection of copper (Cu)-enriched wheat varieties.

[0045] Example 1 Screening and verification of stable and significant QTL loci associated with wheat grain copper (Cu) content

[0046] 1. Materials and Methods

[0047] 1.1 Test materials and field trials

[0048] In the early stage, Yangmai 4 was used as the female parent and Yanzhan 1 as the male parent, and a RIL population of 151 was obtained by single seed fertilization. 10 The RIL population was planted in 2019 and 2020 at the Wanfu Experimental Base of the Jiangsu Lixiahe Regional Agricultural Science Research Institute (Yangzhou, Jiangsu). Wheat sowing in Yangzhou was standardized on October 25th during the experimental years. A randomized block design was used, with each line planted in three rows, two replicates, with 40 seeds per row, a row length of 1.33 m, and a row spacing of 0.23 m. Field fertilization and management followed the same guidelines as local field cultivation practices, with timely pest and weed control. At maturity, each line was harvested manually by plot. Wheat grains were harvested at maturity in 2020 and 2021. Wheat seeds were washed three times with deionized water, air-dried, and dried in a constant temperature oven to constant weight. They were then ground and sieved for subsequent analysis and testing. Planting methods and trace element determination methods for the 149 advanced wheat lines in 2022 were similar to those for the RIL population.

[0049] 1.2 Trace element determination method

[0050] The determination of trace elements was completed by Nanjing Yizhiyuan Testing Technology Co., Ltd. Copper (Cu) determination method: Weigh 0.2g of sample (accurate to 0.0001g), place it in a PTFE tank, add 5mL concentrated nitric acid, 2mL hydrogen peroxide, place it on a graphene hot plate, heat and digest at 150℃, add nitric acid in the middle until the digestion solution is transparent, set 170℃ to remove the acid until about 1mL of the solution remains, cool it down and dilute it to 50mL with pure water, filter it, and use a Thermo Fisher dual-channel inductively coupled plasma emission spectrometer (ICP-AES) to determine the copper (Cu) element content. Perform a blank test at the same time. Inject the mixed standard solution into the ICP-AES, measure the signal response values ​​of the element and the internal standard element, and draw a standard curve with the concentration of the element as the horizontal axis and the ratio of the response signal value of the element to the selected internal standard element as the vertical axis. Inject the blank solution and the sample solution into the ICP-AES respectively, measure the signal response values ​​of the element and the internal standard element, and obtain the concentration of the element in the digestion solution according to the standard curve. The content of the element to be measured in the sample:

[0051] X=

[0052] Where: X-element content in sample (mg / kg); P-element mass concentration in sample solution (mg / L); P 0-mass concentration of element in sample blank solution (mg / L); V-volume of sample digestion solution (mL); f-dilution factor of sample; m-weight of sample (g).

[0053] 1.3 Phenotypic data statistics

[0054] SPSS 22.0 and Excel 2019 were used to process and statistically analyze the phenotypic data, mainly descriptive statistics, analysis of variance, and T test.

[0055] 1.4 Genetic map construction and QTL mapping

[0056] Genomic DNA was extracted from seedlings of the test material using the CTAB method. The Wheat 55K SNP markers, developed by the Institute of Crop Science, Chinese Academy of Agricultural Sciences, were used for the test parents and RIL populations. All polymorphic markers were filtered and screened based on the genotypes of the parents and offspring, resulting in 7974 polymorphic SNP markers. Redundancy was removed using the BIN function in Icimapping v4.2 (http: / / www.isbreeding.net), resulting in 1546 SNPs. The MAP function was then used to group and calculate genetic distances between markers. A 3574.10 cM long genetic linkage map covering all 21 wheat chromosomes was constructed. The map above shows 1440 SNPs, with an average genetic distance of 2.58 cM between markers. The genetic map for each chromosome was constructed using MapChart 2.3 (https: / / www.wur.nl / en / show / Mapchart.htm). Inclusive composite interval mapping (ICIM) was used to identify QTLs significantly associated with wheat grain trace element content, with a LOD threshold of 2.5. Loci with peaks within 10 cm of each other on a chromosome were considered identical. The flanking marker sequences of the QTLs located in this study and those flanking similar loci reported previously were aligned with the reference genome (IWGSC RefSeq v2.1) (https: / / wheaturgi.versa illes. inra. fr) to confirm the novelty of the QTLs located in this study.

[0057] 1.5 KASP marker development and detection

[0058] Based on the QTL mapping results, KASP markers (PolyMarker, http: / / polymarker.tgac.ac.uk / ) were developed targeting the SNP sequences flanking the major locus. Two SNP-specific primers (SEQ ID No. 1 / SEQ ID No. 2) and one universal primer (SEQ ID No. 3) were designed for each marker. A specific sequence that binds to FAM fluorescence was added to the tail of the F1 line, and a specific sequence that binds to HEX fluorescence was added to the tail of the F2 line. KASP primers were designed using PolyMarker (http: / / www.polymarker.info / ) and synthesized by Beijing Jiacheng Biotechnology Co., Ltd. PCR detection of the original 151 RIL populations and 149 advanced wheat lines was performed using the developed KASP markers. PCR reactions were performed on an ABIVeriti 384 PCR instrument (Thermo Fisher), and the fluorescence values ​​of the PCR amplification products were scanned and read using an Omega F SNP typing instrument (LGC Genomics Ltd, KBS-0024-002). Genotyping was performed using Kluster Caller™ (KBioscience), and the genotypes of SNP markers were determined based on the analysis results.

[0059] 2. Results

[0060] A QTL simultaneously associated with wheat grain copper (Cu) content was detected on chromosome 7A. QCu.yaas-7A The synergistic allele variation was detected in the two-year environment and the average value, and the phenotypic contribution rate was 7.77% to 17.59% (Table 1, Appendix Figure 1 ).

[0061] Table 1 QTL information related to wheat grain copper (Cu) content

[0062]

[0063] After comparison, it was found that this locus is a new locus related to copper (Cu) content in wheat grains. Further using the flanking marker AX-109110307 information of this locus, its flanking sequence SEQ ID No. 4: TATGCTACTGAATGTTTGCCATCATATCAAACCTC[G / T]GGGTCAAGAATGATTCGAACTCTAGTCGACATTGG was downloaded. KASP primers were designed using Polymarker (http: / / polymarker.tgac.ac.uk / ). The primers were synthesized by Beijing Jiacheng Biotechnology Co., Ltd., and the flanking sequence was successfully converted into a KASP marker. KASP-QCu-7A, and the corresponding mutation site is G / T.

[0064] This embodiment is designed for this site KASP-QCu-7A The primer set includes an upstream primer with the nucleotide sequence shown in SEQ ID No. 1, another upstream primer with the nucleotide sequence shown in SEQ ID No. 2, and a shared downstream primer with the nucleotide sequence shown in SEQ ID No. 3. The 5' end of the upstream primer of SEQ ID No. 1 is linked to the fluorescent tag sequence FAM, and the 5' end of the other upstream primer of SEQ ID No. 2 is linked to the fluorescent tag sequence HEX. The 3' end of the upstream primer is the allelic variant G / T at the locus. The downstream primer ensures chromosome 7A specificity for PCR amplification. The primer sequences are shown in Table 2.

[0065] Table 2 KASP-QCu-7A KASP molecular marker primer information for the interval

[0066]

[0067] Note: The underlined parts are the linker sequences FAM and HEX.

[0068] Preparation of KASP labeled primer working solution:

[0069] Take 12 μL (100 μM) of each upstream primer (nucleotide sequence shown in SEQ ID No. 1 and SEQ ID No. 2) and 30 μL (100 μM) of the downstream primer (nucleotide sequence shown in SEQ ID No. 3), add sterile ultrapure water to 100 μL, mix thoroughly, and use as the KASP-labeled primer working solution for later use.

[0070] PCR amplification reaction system: 2 μL of wheat DNA template to be tested (approximately 30 ng / μL), 0.07 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), and then add sterile ultrapure water to 5 μL.

[0071] PCR reaction procedure: Step 1: pre-denaturation at 95°C for 15 min; Step 2: denaturation at 95°C for 20 s, followed by 60 s at 65–57°C (1°C decrease per cycle), for a total of 9 cycles; Step 3: denaturation at 95°C for 20 s, followed by annealing at 57°C for 1 min, for a total of 32 cycles; Storage at 10°C. Blank controls (NTCs) were also included in the experiment, with no template DNA added to the reaction system. One or more blank controls were included on each plate.

[0072] Wheat seedlings were taken and the genomic DNA of the wheat to be tested was extracted using the PVP-40 method.

[0073] Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the KASP primer set and PCR reagents described above to obtain PCR amplification products. PCR reactions were performed on an S1000™ Thermal Cycler PCR instrument (Bio-Rad Laboratories Inc.), and the PCR amplification products were scanned and read using a multifunctional microplate reader (PHERAstar Plus, BMG LABTECH, Germany). The excitation wavelength for FAM was 485 nm, and the emission wavelength was 520 nm; the excitation wavelength for VIC was 535 nm, and the emission wavelength was 556 nm; the excitation wavelength for the system reference fluorescence ROX was 575 nm, and the emission wavelength was 610 nm. KlusterCaller software (KBioscience) was used for genotyping, and the significantly associated loci for wheat grain copper (Cu) were determined based on the analysis results. QCu.yaas-7A genotype.

[0074] 151 RIL population families and 149 wheat high-generation lines were amplified as described above. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the X-axis (blue) in the fluorescence signal coordinate system of the typing results, indicating that the genotype of these wheat at the nucleotide sequence flanking the SNP site (e.g., the 36th base (SNP site) of SEQ ID No. 4) was G; and the fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the Y-axis (red) in the coordinate system, indicating that the genotype of these wheat at the SNP site was T. KASP-QCu- 7A The typing results after amplification were the same as those of the original SNP. The KASP test results and wheat grain copper (Cu) content of 149 advanced wheat lines are shown in Table 3.

[0075] Table 3 Average copper (Cu) content in wheat grains of wheat breeding lines and QCu.yaas-7A KASP typing results

[0076]

[0077] GG represents the Yangmai 4 genotype, and TT represents the Yanzhan 1 genotype.

[0078] Table 4 Carrying QCu.yaas-7A Results of t-test on copper (Cu) content in wheat grains of different genotypes at the locus

[0079]

[0080] The analysis results in Table 4 show that the copper (Cu) content in the grains of the GG (Yangmai 4) genotype is 28.86% higher than that of the TT (Yanzhan 1) genotype. P The value is 0.000875, P There was a significant difference at the <0.01 level, indicating that the copper (Cu) content in the grains of wheat containing the allele GG (Yangmai 4) was higher than that of wheat containing the allele TT (Yanzhan 1).

[0081] KASP-QCu-7A Typing effect and QCu.yaas-7A Effects on copper (Cu) content in wheat grains Figure 2 As shown. At the same time, the above KASP mark is explained KASP-QCu-7A The primer set and genotype detection system can be applied to molecular marker-assisted selection breeding for wheat grain copper (Cu) content.

[0082] By using the primer set of the present invention to perform PCR amplification on wheat genomic DNA, the genotype at the site can be directly detected by KASP. The detection method is simple to operate, the detection results are very intuitive, and the detection effect is obvious and effective. Screening using this molecular marker can greatly improve the efficiency of molecular marker-assisted selection of wheat grain copper (Cu) content in wheat breeding.

[0083] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0084] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0085] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. Use of a primer set for detecting a KASP molecular marker significantly associated with copper content in wheat grains in any of the following: (A) Identify or assist in identifying copper content traits in wheat grains; (B) Comparison of copper content in tested wheat grains; (C) Breeding or selecting wheat lines or strains with relatively high copper content in wheat grains; (D) Breeding or screening wheat lines or strains with relatively low copper content in wheat grains; (E) preparing a product for comparing the copper content of wheat grains to be tested; (F) preparing a product for breeding or screening wheat lines or strains with relatively high copper content in wheat grain; (G) preparing a product for breeding or screening wheat lines or strains with relatively low copper content in wheat grain; The KASP molecular marker has the following nucleotide sequence: TATGCTACTGAATGTTTGCCATCATATCAAACCTC[G / T]GGGTCAAGAATGATTCGAACTCTAGTCGACATTGG; The primer set is a complete primer set consisting of upstream primers shown in SEQ ID No. 1 and SEQ ID No. 2 and a downstream primer shown in SEQ ID No.

3.

2. Use any of the following methods: Method A: A method for comparing the copper content of wheat grains to be tested, comprising the following steps: (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence of SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (A2) determining the copper content of the wheat grains to be tested as follows: the copper content of the wheat grains to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is G is higher than the copper content of the wheat grains to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is T or a heterozygote of G and T; Method B: A method for breeding or screening wheat lines or strains having relatively high copper content in wheat grains, comprising the following steps: (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence of SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (B2) selecting a wheat strain to be tested that is homozygous for G at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome as a parent for breeding, and selecting wheat strains or lines that are homozygous for G at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome in each breeding generation, ultimately obtaining a wheat strain or line with a relatively high grain copper content; Method C: A method for breeding or screening wheat lines or strains having relatively low copper content in wheat grains, comprising the following steps: (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (C2) selecting a wheat strain to be tested that is homozygous for T at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome as a parent for breeding, and selecting wheat strains or varieties that are homozygous for T at the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome in each breeding generation, ultimately obtaining a wheat strain or variety having a relatively low grain copper content.

3. Use of the use according to claim 1 or the method according to claim 2 in molecular marker-assisted breeding of copper content in wheat grains.

Images