G protein coupled estrogen receptor recombinant and application thereof

Abstract

The invention relates to the technical field of G protein coupled estrogen receptors, in particular to a G protein coupled estrogen receptor recombinant and application thereof. The recombinant is a protein formed by inserting a sequence as shown in SEQ ID NO.2 between 241-250aa amino acid sequences of the human G protein coupled estrogen receptor as shown in SEQ ID NO.1 and removing 25-35 amino acids at the N end and 30-45 amino acids at the C end of the human G protein coupled estrogen receptor. The recombinant has the biological activity of G protein coupled estrogen receptor, and has a wide application prospect in development of agonist drugs for starting a GPER activation mode.

Description

Technical Field

[0001] The present application relates to the technical field of G protein-coupled estrogen receptors, and in particular to a recombinant G protein-coupled estrogen receptor and its application. Background Art

[0002] G protein-coupled estrogen receptor (GPER) is a new type of estrogen receptor with seven transmembrane domains, which has about 30% homology with the reported G protein-coupled estrogen receptors due to its amino acid sequence. It can bind to and be activated by estrogen, mediate the rapid response of estrogen in cells, and regulate the expression of certain target genes. As one of the specific receptors for estrogen effects, GPER is widely expressed in various tissues and participates in the regulation of glucose and lipid metabolism, pancreas, kidney, bone density, skin pigmentation, heart rate regulation, immune system and nervous system functions. As an estrogen receptor, GPER has an important influence on the occurrence and development of female reproductive cancers such as breast cancer, ovarian cancer and endometrial cancer. For example, activation of GPER can promote the proliferation, hypoxia resistance and angiogenesis of triple-negative breast cancer cells; high expression of GPER is associated with poor prognosis of breast cancer and endometrial cancer, while high expression of GPER is a favorable prognostic factor for triple-negative breast cancer.

[0003] GPER is a new type of anticancer drug target. In March 2021, a GPER agonist LNS8801 was granted Fast Track designation by the U.S. FDA for the treatment of patients with metastatic or unresectable melanoma whose disease progressed after anti-PD-1 or anti-PD-L1 treatment, becoming the first GPER modulator drug used in clinical practice. Currently, no other GPER modulator anticancer drugs are available on the market at home and abroad. Compared with the classical estrogen receptor, the development of GPER modulator drugs has been slow. The main reason is that the preparation of the protein sample is very difficult, making drug screening research difficult to carry out.

[0004] The number of GPER-related studies has been increasing year by year in recent years. Therefore, this protein can be used as an important research material and is widely used in drug screening, antibody preparation, western blot, ELISA, immunoassays of tissues and cells, etc., and has broad market prospects. The GPER protein products currently on sale are all protein monomers. The activation method that relies on the formation of dimers is called dimerization activation. GPER dimers have unique transient activation structures and protein functions, which are crucial for studying the signal transduction mechanism of GPER receptors in the human body and developing agonist drugs that initiate the GPER activation mode. Summary of the invention

[0005] The inventors of this application have obtained a recombinant G protein-coupled estrogen receptor that can exist in the form of a dimer and has a structure and protein function that can be activated instantaneously, which has broad application prospects for the development of agonist drugs that initiate the GPER activation mode. To this end, this application discloses at least the following technical solutions:

[0006] In the first aspect, the embodiments of the present application disclose a recombinant G protein-coupled estrogen receptor, which is a protein formed by inserting a sequence as shown in SEQ ID NO.2 at any position between the amino acid sequence of 241 to 250aa of the human G protein-coupled estrogen receptor as shown in SEQ ID NO.1, and removing 25 to 35 amino acids at the N-terminus and 30 to 45 amino acids at the C-terminus of the human G protein-coupled estrogen receptor.

[0007] In a second aspect, the embodiments of the present application disclose a G protein-coupled estrogen receptor dimer, which is formed by the recombinant described in the first aspect.

[0008] In a third aspect, the present application discloses a DNA molecule for preparing a recombinant G protein-coupled estrogen receptor, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0009] In a fourth aspect, an embodiment of the present application discloses a recombinant expression plasmid carrying the DNA molecule described in the third aspect.

[0010] In a fifth aspect, an embodiment of the present application discloses a host cell carrying the recombinant expression plasmid described in the fourth aspect.

[0011] In a sixth aspect, the present application discloses a method for preparing a recombinant G protein-coupled estrogen receptor. The recombinant is a protein formed by inserting a sequence as shown in SEQ ID NO.2 at any position between the amino acid sequence of 241 to 250aa of the human G protein-coupled estrogen receptor as shown in SEQ ID NO.1, and removing 25 to 35 amino acids at the N-terminus and 30 to 45 amino acids at the C-terminus of the human G protein-coupled estrogen receptor. The preparation method comprises:

[0012] Obtaining a first plasmid containing a first target fragment of a GPER encoding gene, wherein the nucleotide sequence of the first target fragment is as shown in SEQ ID NO.4;

[0013] Inserting the coding sequence of the sequence shown in SEQ ID NO.2 into the first plasmid to obtain a second plasmid containing a second target fragment, wherein the nucleotide sequence of the second target fragment is shown in SEQ ID NO.5;

[0014] obtaining a culture fluid of the host cell into which the second plasmid has been transferred;

[0015] The recombinant is obtained from the culture fluid of the host cell into which the second plasmid has been transferred.

[0016] In a seventh aspect, the application of the recombinant described in the first aspect is selected from: at least one of preparing a kit for screening small molecule drugs and preparing an agonist drug for initiating the GPER activation mode.

[0017] The technical effects of the recombinants, dimers, DNA molecules, recombinant expression plasmids, host cells, preparation methods and applications disclosed in the examples of the present application will be described in detail in the specific implementation manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a schematic diagram of the first plasmid structure provided in an embodiment of the present application.

[0019] Figure 2 Agarose electrophoresis diagram of the first target fragment and the second target fragment provided in the examples of the present application: a) DNA ladder (Thermo Fisher, 10-250 kDa); b) the first target fragment; c) the second target fragment.

[0020] Figure 3 This is a blue-white plate image of DH10Bac transformed with the second plasmid provided in the example of the present application. In the image, the white spots marked with red circles are positive clones.

[0021] Figure 4 Identification of the recombinant GPER provided in the examples of this application. Figure A: SDS-PAGE of the effluent after the GPER protein passed through the molecular sieve. The numbers are the tube numbers of the effluent collected through the molecular sieve. Figure B: Western Blotting of the GPER protein dimer. D and M in the figure refer to dimer and monomer, respectively.

[0022] Figure 5 This is the UV absorption spectrum of the recombinant GPER provided in the examples of the present application.

[0023] Figure 6 This is a circular dichroism spectrum of the recombinant GPER provided in the examples of the present application.

[0024] Figure 7 This is a schematic diagram of the three-dimensional structure of the recombinant GPER provided in the examples of the present application (the part indicated by the arrow is the region where SEQ ID NO.2 is inserted).

[0025] Figure 8The fluorescence titration provided in the examples of the present application shows that the recombinant GPER can bind to estradiol (E2). Figures A, B, C, and D are respectively the UV image and fluorescence spectrum of E2 titrating the dialysate, the fluorescence spectrum of E2 titrating the GPER protein solution, and the linear fitting diagram of the binding constant of GPER and E2. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0027] It should be noted that the terms "first", "second", etc. in the specification and claims of the present invention and the above-mentioned drawings are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequence, nor do they play a substantial limiting role on the subsequent technical features. It should be understood that the data used in this way can be interchanged where appropriate, so that the embodiments of the present invention described herein can be implemented in an order other than those illustrated or described herein. In addition, the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions, for example, a process, method, system, product or device that includes a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.

[0028] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers used in this application to express the amount, percentage, and other numerical values ​​should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0029] The present application discloses a recombinant G protein-coupled estrogen receptor (GPER). The recombinant is a protein formed by inserting a sequence as shown in SEQ ID NO.2 at any position between the amino acid sequence of 241 to 250aa of the human G protein-coupled estrogen receptor as shown in SEQ ID NO.1, and removing 25 to 35 amino acids at the N-terminus and 30 to 45 amino acids at the C-terminus of the human G protein-coupled estrogen receptor.

[0030] The term "recombinant" refers to a novel protein having the same biological function as GPER obtained by recombination with other amino acid sequences inserted or deleted relative to the wild-type GPER.

[0031] In some embodiments, the amino acid sequence of the recombinant is shown as SEQ ID NO.3.

[0032] The present application also discloses a G protein-coupled estrogen receptor dimer, which is formed by the recombinant provided in the above embodiment. Figure 2 As shown, the recombinant expressed recombinant was subjected to SDS-PAGE and Western-blot detection, and the results showed that the recombinant protein samples collected in this part mainly existed in the form of GPER dimers. This suggests that these dimers formed by the recombinant (GPER) have dimer activation potential, and GPER dimers have unique structures and protein functions, which are crucial for studying the GPER receptor signaling mechanism in the human body and developing agonist drugs that initiate the GPER activation mode.

[0033] In addition, these recombinants of G protein-coupled estrogen receptors can also be used as targets for small molecule drug screening and prepared into kits for small molecule drug screening. To this end, the present application also discloses the application of the recombinant, which is selected from at least one of: preparing a small molecule drug screening kit and preparing an agonist drug that activates the GPER activation mode.

[0034] For example, a small molecule drug kit includes: a protein standard (recombinant GPER), a protease solution, a buffer 1, and a buffer 2. The small molecule drug to be tested (estradiol) is diluted with buffer 1 to form a series of concentration gradients, and the protein standard is incubated with different concentrations of the small molecule drug to be tested at room temperature for 15 to 30 minutes, and the concentration of the protein standard in each reaction system is kept consistent. Buffer 1 is used as a blank control. Then the protease solution is added to each of the above reaction systems and incubated at room temperature for 5 to 10 minutes ( Figure 3 After the reaction, add buffer 2, boil at 100℃ for 5min, and perform SDS-PAGE and Western blotting analysis. This kit utilizes the target stability principle of drug affinity reaction. Compared with the group with only protease added, the band corresponding to GPER is thicker after the small molecule drug is co-incubated with the protein sample ( Figure 3 ). This indicates that the small molecule drug binds to GPER to enhance the thermodynamic stability of GPER, thereby enhancing the resistance of GPER to enzymatic hydrolysis and protecting GPER from protease hydrolysis, indicating that the small molecule has a direct interaction with GPER and is a potential GPER modulator drug.

[0035] The examples of the present application also use a recombinant expression method to prepare the above-mentioned recombinant. For example, the examples of the present application disclose a DNA molecule for preparing a recombinant G protein-coupled estrogen receptor, and its nucleotide sequence is shown in SEQ ID NO.8.

[0036] The embodiment of the present application discloses a recombinant expression plasmid carrying the DNA molecule.

[0037] The embodiment of the present application discloses a host cell carrying the recombinant expression plasmid.

[0038] The present application discloses a method for preparing a recombinant G protein-coupled estrogen receptor. The recombinant is a protein formed by inserting a sequence as shown in SEQ ID NO.2 at any position between the amino acid sequence of 241 to 250aa of the human G protein-coupled estrogen receptor as shown in SEQ ID NO.1, and removing 25 to 35 amino acids at the N-terminus and 30 to 45 amino acids at the C-terminus of the human G protein-coupled estrogen receptor. The preparation method comprises:

[0039] Obtaining a first plasmid containing a first target fragment of a GPER encoding gene, wherein the nucleotide sequence of the first target fragment is as shown in SEQ ID NO.4;

[0040] Inserting the coding sequence of the sequence shown in SEQ ID NO.2 into the first plasmid to obtain a second plasmid containing a second target fragment, wherein the nucleotide sequence of the second target fragment is shown in SEQ ID NO.5;

[0041] obtaining a culture fluid of the host cell into which the second plasmid has been transferred;

[0042] The recombinant is obtained from the culture fluid of the host cell into which the second plasmid has been transferred.

[0043] In some embodiments, the step of obtaining the first plasmid comprises:

[0044] The wild-type GPER encoding gene plasmid was amplified by PCR, and the PCR product and pFasBac1 were digested by restriction enzymes, respectively. The digested products were ligated by T4 DNA enzyme, and the ligated products were transformed into Escherichia coli. Positive clones were screened, and the plasmids in the positive clones were extracted.

[0045] In some embodiments, the step of obtaining the second plasmid comprises:

[0046] Obtain a coding sequence as shown in SEQ ID NO.2; and insert the coding sequence into the first plasmid.

[0047] The present application will be described below with more specific examples, but they do not constitute limitations on the implementation methods of the present application.

[0048] In some embodiments, a method for preparing a recombinant G protein-coupled estrogen receptor comprises the following steps:

[0049] 1. Construction of the first plasmid

[0050] Figure 1 The structure of the first plasmid is shown, and the first plasmid is a plasmid obtained by inserting the first target fragment based on the pFastBac1 plasmid (HG-VKI0132, Invitrogen). The first target fragment is the GPER gene sequence (containing the coding sequence after the N-terminal 32 amino acids and C-terminal 30 amino acids of GPER are removed), and the nucleotide sequence of the first target fragment is shown in SEQ ID NO.4.

[0051] In some embodiments, the GPER wild-type encoding gene plasmid (HsCD00005110, BC011634, pDNR-Dual, ampicillin resistance, 2218 bp, DNASU plasmid library) is PCR amplified, the PCR product and pFasBac1 are digested, the digested products are ligated by T4 DNA enzyme, the ligated products are transformed into Escherichia coli, positive clones are screened, and the plasmid in the positive clones is extracted, which is the first plasmid.

[0052] In some embodiments, the reaction system for PCR on the GPER wild-type encoding gene plasmid is 50 μL, including 1 μL of the wild-type encoding gene plasmid, 1 μL of forward primer, 1 μL of reverse primer, 4 μL of 2.5 mM dNTPs, 10 μL of 5×Buffer, 0.5 μL of high-fidelity enzyme, and the balance is ddH2O.

[0053] In some embodiments, the reaction procedure for PCR on the GPER wild-type encoding gene plasmid includes: 98°C, 2 min; 98°C, 10 s; 65°C, 30 s; 72°C, 30 s (15-30 s / kb); 35 cycles; 72°C, 10 min; 4°C.

[0054] In some embodiments, the PCR amplification product of the GPER wild-type encoding gene plasmid was subjected to gel electrophoresis, and the gel block containing the target band was cut and gel recovered (gel extraction kit (QIAGEN)). After the PCR product was extracted, the concentration was measured to be 61.2 ng / μL.

[0055] In some embodiments, the reaction system for enzymatic digestion of the PCR amplified product of the GPER wild-type encoding gene plasmid is 50 μL, including 2 μg of PCR product, 20 U Asc I and 20 U Fse I (12 μL in total), 5 μL Chutsmart buffer, and the balance is ddH 2 O. The enzymatic digestion reaction conditions are: 37° C., 2 h.

[0056] In some embodiments, the pFasBac1 vector enzyme digestion reaction system is 50 μL, including 2 μg pFasBac1 vector plasmid, 2.6 μL Asc I (10000u / ml), 13 μL Fse I (2000u / ml), 6.48 μL Cutsmart buffer, and the balance is ddH2O. The enzyme digestion reaction conditions are: 37°C, 2h.

[0057] In some embodiments, the T4 DNA enzyme ligation reaction system is 20 μL, including 1 μL of pFasBac1 vector digested with enzymes, 8 μL of GPER wild-type encoding gene plasmid digested with enzymes for PCR amplification, 1 μL of T4 DNA ligase (Invitrogen), 2 μL of 10× buffer, and the balance is ddH2O. The reaction conditions are: room temperature, 20 min.

[0058] In some embodiments, the step of transforming Escherichia coli with the T4 DNA enzyme ligation reaction product includes: adding 20 μL of the ligation product to 50 μL of Top10 cells, incubating for 20 minutes, heat shocking at 42°C for 60 to 90 seconds, returning and incubating for 2 minutes, and then adding 600 μL of LB medium. Oscillating at 37°C and 200 rpm for 30 minutes, then spreading on an LB plate (containing 25 μg / ml ampicillin), and incubating at 37°C overnight. Check the growth of the colonies, select three single clones from each plate, and perform Taq enzyme (ThermoFisher) PCR rapid identification, and the identification reaction program includes: 98°C, 30s; 98°C, 10s; 55°C, 90s; 72°C, 30s; 25 cycles; 72°C, 10min; 4°C. The Taq enzyme PCR rapid identification reaction system is 20 μL, including: picking single clone colonies with 2 inoculation loops, adding 1 μL 10 μM forward primer (attggcgcgccgctgtcccacccgctcctg, shown in SEQ ID NO.6), 1 μL 10 μM reverse primer (attggccggcccggcaaatttgttttctg, shown in SEQ ID NO.7), 2 μL dNTPs (2.5 mM), 2 μL 10× buffer, 0.25 μL Taq enzyme (5 U / μL), and the balance is ddH2O.

[0059] In some embodiments, the first plasmid extraction step includes: picking up positive clones identified by Taq enzyme with a 100 μL pipette tip, placing them in 5 ml LB culture medium (containing 25 μg / ml ampicillin) and shaking them at 37°C and 200 rpm overnight. Taking 3 ml of the plasmid and using a plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.) to extract the plasmid, measuring the concentration, and sending them for sequencing (Beijing Qingke Biotechnology Co., Ltd.). The results showed that the first plasmid was successfully constructed.

[0060] 2. Construction of the Second Plasmid

[0061] In some embodiments, the step of constructing the second plasmid includes: obtaining a coding sequence as shown in SEQ ID NO.2; and inserting the coding sequence into the first plasmid.

[0062] In some embodiments, the coding sequence shown in SEQ ID NO.2 is amplified using the high-fidelity enzyme Phusion (Thermo Scientific). The PCR amplification reaction system is based on 20 μL, including: 4 μL 5×GC buffer; 1.6 μL, 2.5 mM dNTPs; 1 μL, 10 μM forward primer (atgaagaagtatacctgtaccgtctgcgga, shown in SEQ ID NO.8); 1 μL, 10 μM reverse primer (ttcctccacctcttcaaattggtcctt, shown in SEQ ID NO.9); 0.6 μL DMSO; 1 μL containing the SEQ ID NO.2 coding gene sequence as a template DNA; 0.2 μL high-fidelity enzyme Phusion; the balance is ddH2O.

[0063] In some embodiments, a high-fidelity enzyme is used to amplify the first plasmid. The PCR amplification reaction system is 20 μL and includes: 4 μL 5×GC buffer; 1.6 μL 2.5 mM dNTPs; 1 μL, 10 μM forward primer (tttgaagaggtggaggaacaccgtgggctgcggc, shown in SEQ ID NO.10); 1 μL, 10 μM reverse primer (tacaggtatacttcttcatccggtgcgccctgacc, shown in SEQ ID NO.11); 0.6 μL DMSO; 1 μL first plasmid; 0.2 μL high-fidelity enzyme Phusion; the balance is ddH2O.

[0064] In some embodiments, the reaction program of high-fidelity enzyme amplification includes: 98°C, 30s; 98°C, 10s (25 cycles); 55°C, 30s (25 cycles); 72°C, 15s (25 cycles); 72°C, 10min; 4°C.

[0065] In some embodiments, the coding sequence of the sequence shown in SEQ ID NO.2 is inserted into the first plasmid. Specifically, 1 μL Dpn I enzyme (NEC) is added to 20 μL of the SEQ ID NO.2 coding gene sequence and the rapid amplification product of the first plasmid, respectively, and treated at 37°C for 1 hour. Then, 4 μL is mixed in a 1:1 ratio and placed on ice, 40 μL of Top10 cells are added, and incubated for 30 minutes. After heat shock at 42°C for 90 seconds, 350 μL LB medium is added. Shake and culture at 37°C, 250rpm for 1 hour. Centrifuge at 6000rpm for 2 minutes, resuspend with 50 μL LB medium, and then spread on an LB plate (containing 25 μg / ml ampicillin). 37°C overnight. Pick a single colony and add 10 μL sterile H2O, take 1 μL and use Taq enzyme to identify the SEQ ID NO.2 coding gene. In some embodiments, the extraction step of the second plasmid includes: picking up a single clone identified by Taq enzyme with a 100 μL pipette tip, placing it in 5 ml LB culture medium (containing 25 μg / ml ampicillin) and shaking it at 37°C and 200 rpm overnight. Taking 3 ml of the plasmid and using a plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.) to extract the plasmid, measuring the concentration, and sending it for sequencing (Beijing Qingke Biotechnology Co., Ltd.). The results showed that the second plasmid was successfully constructed.

[0066] In some embodiments, the step of transforming DH10Bac (host cell) with the second plasmid includes: quickly taking out the DH10Bac competent state from the -80°C refrigerator and thawing it on ice; taking 50 μL of competent cells and placing them in a 1.5mL EP tube, adding 1 μL (250ng) of the second plasmid (extracted in the above embodiment) and mixing, and incubating on ice for 30 minutes; heat shock at 42°C for 90 seconds; after incubating on ice for 2 minutes, adding 300 μL of resistance-free LB medium, shaking and culturing at 200 rpm and 37°C for 4 hours; taking 20 μL of bacterial solution and coating it on a three-antibody culture dish with kanamycin, gentamicin and tetracycline coated with X-gal and IPTG in advance; after culturing at 37°C for 48 hours, picking a white monoclonal ( Figure 3 ) and transferred to 5 mL of triple-antibody LB medium containing kanamycin, gentamicin and tetracycline, and cultured at 200 rpm and 37°C for 18 h. Collect the bacteria, extract the second plasmid using the Tiangen plasmid extraction kit, and measure the concentration using Nanodrop.

[0067] 3. Protein expression and purification

[0068] (1) Host cell preparation

[0069] Frozen insect SF-9 cells (Thermo Scientific) were taken out, thawed quickly at 37°C, and resuspended in ESF-921 insect cell culture medium (Experssion Systems), transferred into T25 cell culture flasks (Corning), and allowed to grow at 27°C. The cells were subcultured at a ratio of 1:4 every 2 days to obtain a cell density of about 1×10 6 Pieces / mL.

[0070] (2) Transfection

[0071] Add 250 μL of ESF-921 insect cell culture medium to each of the two 1.5 mL EP tubes, add 5 μg of the second plasmid extracted on the same day to one tube, and add 10 μL of transfection reagent to the other tube, and let stand at room temperature for 5 minutes. Add the bacmid suspension dropwise to the transfection reagent suspension and incubate at room temperature for 10 minutes. Take a 24-well plate and add 2 mL of the pre-diluted suspension culture cell suspension to each well. The total number of cells in each well is 1.5×10 6 The transfection complex was added to the cell suspension in a 24-well plate and cultured at 300 rpm and 27°C for 3 days. After three days, the cell suspension was centrifuged at 2000 rpm for 15 min and the supernatant (P0 virus) was taken.

[0072] (3) Preparation of P1 virus

[0073] In a 125 mL shake flask, add 40 mL of cell suspension with a cell density of 2 × 10 6 / mL, add 400μL P0 virus, add 400μL A01 P0 virus to one of the bottles, a total of seven bottles. Incubate at 27℃, 125rpm for 48h. After 48h, collect the cell suspension, take 5mL to break, centrifuge at 14000rpm for western to detect protein expression level. The remaining 35mL is centrifuged at 2000rpm for 15min, the supernatant is P1 virus, add 0.8mL 50% FBS, 2.5mg / L amphotericin and store at 4℃ in the dark.

[0074] (4) Target protein expression

[0075] Dilute the suspended SF-9 cells in advance to a cell concentration of 2 × 10 6 / mL, add 40mL cells and 400μL P1 virus to each 125mL shake flask, and culture at 27℃ and 125rpm for 48h. After 48h, collect the cell suspension into a 50mL centrifuge tube, centrifuge at 2000rpm for 15min, precipitate the biomass containing the target protein, and store at -80℃ for later use.

[0076] (5) Purification of target protein

[0077] 1) Resuspend the frozen precipitate with low salt buffer and place it on ice to thaw. Use a homogenizer to fully grind the biomass in an ice-water bath, and ultracentrifuge it at 40,000 rpm and 4°C for 30 min. Resuspend the precipitate with high salt buffer and 1 mM PMSF, and grind it again with a homogenizer in an ice-water bath, and ultracentrifuge it at 40,000 rpm and 4°C for 30 min. Resuspend the precipitate with low salt buffer, grind it in an ice-water bath with a homogenizer, and ultracentrifuge it at 40,000 rpm and 4°C for 30 min. Discard the supernatant, add 2 mL of low salt buffer with 15% glycerol to the precipitate, resuspend the precipitate, and freeze it at -80°C for later use.

[0078] 2) Take out the frozen material, centrifuge at 14000rpm and 4℃ for 15min, resuspend the precipitate with buffer and incubate at 4℃ for 2h. Then add 0.5% DDM and 0.1% CHS, incubate at 4℃ for 2h with inversion mixing, centrifuge at 14000rpm and 4℃ for 15min, aspirate the supernatant into a new pre-cooled 15mL centrifuge tube, add 2mL of nickel ion affinity chromatography column filler equilibrated with low salt buffer, and mix overnight with inversion mixing at 4℃.

[0079] 3) Wash the retained filler with Wash Buffer, and then use 10mL of eluent to elute the target protein in order of imidazole concentration from low to high. Collect 1mL / tube of the effluent with a 1.5mL EP tube. Then take samples of each component and stain with Coomassie Brilliant Blue to identify the purification of the target protein.

[0080] 4. Identification of GPER recombinants by Western Blot

[0081] After the polyacrylamide gel electrophoresis, the voltage was 100V and the membrane was transferred for 90 minutes. After the transfer, the NC membrane was removed and washed three times with 1×TBST. The membrane was then immersed in 40mL of 5% milk blocking solution and placed on a decolorizing shaker for 2 hours. After the blocking, the membrane was removed and washed three times with 1×TBST. GPER antibody (Invitrogen, PA5-28647) was added and incubated overnight. After washing with 1×TBST, the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG, ABclonal, AS014, BR) was added. After incubation at room temperature for 3 hours, the membrane was washed three times with 1×TBST. The color development results of DAB color development solution were as follows: Figure 4 B shows that the recombinant GPER can be stably expressed and achieve the expression of GPER protein dimers ( Figure 4 ).

[0082] 5. Detection of the UV characteristic absorption peak of the recombinant GPER by UV spectrophotometer

[0083] UV spectrophotometer results ( Figure 5) showed that the recombinant sample of GPER had a characteristic protein peak at about 260nm. According to the protein sequence in the recombinant plasmid, the molar extinction coefficient of the protein was predicted to be 48970 L·mol -1 cm -1 The calculated protein concentration was approximately 1.08 mg / mL.

[0084] 6. Circular dichroism spectroscopy identified that GPER recombinant is rich in α-helical structure

[0085] In order to study the secondary structure of GPER recombinant, the circular dichroism spectrum of the protein sample in the far ultraviolet region of 180-250nm wavelength range (protein secondary structure) was detected. Figure 6 As shown, the far-ultraviolet CD spectrum of GPER recombinant has two double negative peaks at 208nm and 222nm, which are characteristic signals of CD spectrum of α-helix, indicating that the recombinant structure of GPER is rich in α-helix secondary structure. After adding 1nM estradiol (E2), the CD spectrum changes, indicating that the GPER recombinant protein can bind to the natural ligand E2 of GPER.

[0086] 7. The recombinant GPER has a three-dimensional structure

[0087] Figure 7 It is a schematic diagram of the three-dimensional structure of the GPER recombinant homodimer, in which the GPER recombinant monomers all show the characteristic seven-helix structure of the GPCR family protein and can be used as experimental material for GPER drug screening research.

[0088] 8. Fluorescence titration to identify the binding of recombinant GPER protein to endogenous agonists

[0089] Dilute the GPER protein solution until the ultraviolet absorption at 280nm is about 0.2, and use the natural ligand E2 of GPER to titrate the diluted GPER protein solution. Set the excitation at 295nm, the width of both slits to 7.5nm, and the emission light recording band is 200-500nm. Scan three times and take the average value. According to the changes in the curve, add small molecule ligands from low to high concentrations. After mixing, repeat the above parameters to measure the change in fluorescence intensity until the fluorescence intensity no longer changes. After the sample measurement is completed, use the GPER protein buffer as the blank sample, and measure the blank control according to the parameter conditions of the previous step and the order of adding small molecule ligands.

[0090] like Figure 8As shown in C, the peak of the endogenous fluorescence intensity of the diluted GPER protein solution appears at about 340nm. After the first addition of E2, the fluorescence intensity increases and red shifts. As E2 is added dropwise, the peak of the fluorescence intensity decreases as the concentration of E2 increases, but the peak position remains unchanged until the peak value no longer changes (the total volume change caused by the addition is controlled to be no more than 5%). E2 was titrated in the same way with the dialysate as a blank control, and the results (see Figure 8 B) shows that the dialysate has no effect on the fluorescence intensity. The fluorescence data of E2 titrated GPER protein solution was deducted from the data corresponding to E2 titrated dialysate. The fluorescence intensity curve conforms to ΔF max / ΔF=([E2]+K d ) / [E2] formula, where ΔF is the change in fluorescence intensity after each addition, ΔF max refers to the maximum fluorescence intensity change, [E2] is the concentration of E2, K d is the dissociation constant. With the inverse of E2 concentration as the X-axis, ΔF max / ΔF as the Y axis, the results are as follows Figure 8 D, Linear Fit K d is 0.0016nM, so the binding constant is 6.25×10 11 M -1 E2 titrated the dialysate in the same way and found no obvious UV absorption in the range of 300nm to 420nm ( Figure 8 A), excluding the possibility that the change in fluorescence value was caused by the change in UV absorption during the titration of GPER by E2. This result shows that the recombinant GPER has a strong binding ability with its natural ligand E2 and can be used as an experimental material for GPER drug screening studies including agonists.

[0091] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A recombinant G protein-coupled estrogen receptor, wherein the recombinant is a protein formed by inserting the sequence shown in SEQ ID NO.2 at any position between the amino acid sequence of 241 to 250aa of the human G protein-coupled estrogen receptor shown in SEQ ID NO.1, and removing 25 to 35 amino acids at the N-terminus and 30 to 45 amino acids at the C-terminus of the human G protein-coupled estrogen receptor.

2. The recombinant according to claim 1, wherein the amino acid sequence of the recombinant is shown in any one of SEQ ID NO.

3.

3. A G protein-coupled estrogen receptor dimer, which is formed by the recombinant according to claim 1 or 2.

4. A DNA molecule for preparing a recombinant G protein-coupled estrogen receptor, the nucleotide sequence of which is shown in SEQ ID NO.

5.

5. A recombinant expression plasmid carrying the DNA molecule according to claim 3. A host cell carrying the recombinant expression plasmid according to claim 4 .

7. A method for preparing a recombinant G protein-coupled estrogen receptor, wherein the recombinant is a protein formed by inserting a sequence as shown in SEQ ID NO.2 at any position between the amino acid sequence of 241 to 250aa of the human G protein-coupled estrogen receptor as shown in SEQ ID NO.1, and removing 25 to 35 amino acids at the N-terminus and 30 to 45 amino acids at the C-terminus of the human G protein-coupled estrogen receptor, the preparation method comprising: Obtaining a first plasmid containing a first target fragment of a GPER encoding gene, wherein the nucleotide sequence of the first target fragment is as shown in SEQ ID NO.4; Inserting the coding sequence of the sequence shown in SEQ ID NO.2 into the first plasmid to obtain a second plasmid containing a second target fragment, wherein the nucleotide sequence of the second target fragment is shown in SEQ ID NO.5; obtaining a culture fluid of the host cell into which the second plasmid has been transferred; The recombinant is obtained from the culture fluid of the host cell into which the second plasmid has been transferred.

8. The preparation method according to claim 7, wherein the step of obtaining the first plasmid comprises: The wild-type GPER encoding gene plasmid was amplified by PCR, and the PCR product and pFasBac1 were digested by restriction enzymes, respectively. The digested products were ligated by T4 DNA enzyme, and the ligated products were transformed into Escherichia coli. Positive clones were screened, and the plasmids in the positive clones were extracted.

9. The preparation method according to claim 7, wherein the step of obtaining the second plasmid comprises: Obtain the coding sequence of the sequence shown in SEQ ID NO.2; The coding sequence is inserted into the first plasmid.

10. The use of the recombinant according to claim 1 or 2, wherein the use is selected from at least one of: preparing a kit for screening small molecule drugs, and preparing an agonist drug for initiating a GPER activation mode.

Images