Saccharomyces cerevisiae with high glucose tolerance and high fermenting power and application thereof

Abstract

The invention relates to the technical field of microorganisms, and discloses saccharomyces cerevisiae with high glucose resistance and high fermenting power and application of the saccharomyces cerevisiae, the name is saccharomyces cerevisiae INM3120, the preservation number is GDMCC No: 65310, and the preservation address is Institute of Microbiology, Guangdong Academy of Sciences, Floor 59, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City. The Saccharomyces cerevisiae INM3120 can quickly respond and select cane sugar as a fermentation carbon source in a high cane sugar fermentation environment, efficiently converts the cane sugar into energy required by fermentation, has good tolerance and growth advantages, and has remarkable high fermentation capacity; when the yeast is applied to bread fermentation as a leavening agent, the bread can have better flavor and taste, is fragrant, is sour, sweet and delicious, and the hardness of the bread is remarkably reduced.

Description

Technical Field

[0001] The present application relates to the field of microbial technology, and in particular to a brewer's yeast with high sugar tolerance and high fermentation capacity and its application. Background Art

[0002] During bread fermentation, yeast needs to deal with a variety of different carbon sources, such as glucose, fructose, sucrose and starch. The characteristics of simultaneous saccharification and fermentation make this system more complicated. Yeast not only needs to select the dominant carbon source from a variety of carbon sources, but also must quickly adapt to changing environmental conditions. This requires yeast to have the ability to respond quickly and ferment efficiently - quickly select the dominant carbon source from the multiple carbon sources being converted and use it efficiently for fermentation.

[0003] Sucrose is one of the main fermentable carbon sources for dough fermentation. It is not only easily used by yeast, but also quickly converted into the energy required for fermentation. Therefore, it is a dominant carbon source in the fermentation process. However, the yeast strains currently used do not have a significant rapid response and efficient utilization of sucrose, and their rapid response and efficient fermentation capabilities need to be further improved. Summary of the invention

[0004] In order to efficiently ferment bread, make the bread soft for a long time and give it a unique flavor and taste, the present application provides a brewer's yeast with high sugar tolerance and high fermentation power and its application.

[0005] The above-mentioned object of the present invention is achieved through the following technical solutions: A brewer's yeast with high sugar tolerance and high fermentation ability, named brewer's yeast INM3120, was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the deposit number GDMCC No: 65310, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

[0006] Further: The ITS gene sequence of Saccharomyces cerevisiae INM3120 is: TTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTT CGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGT TGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGC CCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAAATCCAT.

[0007] Further: Saccharomyces cerevisiae INM3120 grows in a budding state. The cell size of Saccharomyces cerevisiae INM3120 is usually 2.5-10 μm, and the isolated strain is 2.5-5 μm.

[0008] Further: Saccharomyces cerevisiae INM3120 was cultured on yeast extract peptone glucose plate medium (YPD) for 48 hours, and the colony diameter reached 5-6 mm; the colonies were smooth and opaque, round and smooth in surface, with a convex center, and the colony edges were neat and slightly convex.

[0009] Further: Saccharomyces cerevisiae INM3120 was cultured in YP + 30% sucrose medium at 30°C and 220 rpm / min for 24 h, and the OD 600 Greater than 0.23.

[0010] The high-sugar-tolerant and high-fermentation-capacity brewer's yeast INM3120 of the present application can quickly respond to and select sucrose as a fermentation carbon source in a high-sucrose fermentation environment, efficiently convert it into the energy required for fermentation, has good tolerance and growth advantages, and has significantly high fermentation capacity.

[0011] Application of a brewer's yeast with high sugar tolerance and high fermentation ability in yeast preparations.

[0012] The application of the high-sugar-tolerant and high-fermentation Saccharomyces cerevisiae INM3120 in the yeast preparation of the present application can increase the fermentation rate of the yeast preparation and improve the texture and hardness of the bread. The toast bread made with the yeast preparation has a better taste after fermentation, and the hardness of the product is significantly reduced.

[0013] Application of a brewer's yeast with high sugar tolerance and high fermentation power in bread fermentation.

[0014] The invention discloses an application of brewer's yeast with high sugar tolerance and high fermentation power in bread fermentation, characterized in that the bread includes but is not limited to whole wheat bread, high sugar bread and bread with added gluten.

[0015] The application of the high-sugar-tolerant and high-fermentation-power brewer's yeast INM3120 in the present application in bread fermentation has better flavor and taste after fermentation, with a strong aroma, sweet and sour taste, and the hardness of the product is significantly reduced.

[0016] Description of biological deposit: The high-sugar-tolerant and high-fermentation brewer's yeast INM3120 of the present invention was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the deposit number: CGMCC NO: 65310, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, Institute of Microbiology, Guangdong Academy of Sciences, and was classified and named Saccharomyces cerevisiae. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 OD for screening yeast strains for high sucrose tolerance 600 Test result graph; Figure 2 This is the fermentation ability test of yeast - dough floating fermentation ability test result diagram; Figure 3 This is the bread slice diagram obtained from the fermentation capacity retest in high-sugar dough; Figure 4This is a diagram showing the bread storage hardness test results obtained from the retest of fermentation capacity in high-sugar dough; Figure 5 This is a picture of the colony status of the S-4 strain morphological identification; Figure 6 This is a picture of the growth activity of the S-4 strain morphological identification. DETAILED DESCRIPTION

[0018] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used are all available from commercial sources unless otherwise specified.

[0019] Taxonomic characteristics and conservation The invention discloses a brewer's yeast with high sugar tolerance and high fermentation ability which is separated and screened from sour dough samples in Pingyang County, Wenzhou City, Zhejiang Province.

[0020] The strain was named Saccharomyces cerevisiae INM3120 and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the accession number: CGMCC NO: 65310. The storage address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, Institute of Microbiology, Guangdong Academy of Sciences.

[0021] The ITS sequence obtained from the strain of the invention has a similarity of 99.33% with that of Saccharomyces cerevisiae, belongs to Saccharomyces cerevisiae, and can be applied to the food fermentation industry.

[0022] The ITS gene sequence of Saccharomyces cerevisiae INM3120 is:.

[0023] The colony characteristics of Saccharomyces cerevisiae INM3120 are as follows: after culturing on yeast extract peptone glucose plate medium (YPD) for 48 hours, the colony diameter reaches 5-6 mm, is milky white, round and smooth in surface, with neat and slightly convex colony edges; after culturing on YP+30% sucrose medium, 30°C, 220rpm / min, for 24 hours, the OD 600 Greater than 0.23.

[0024] The brewer's yeast INM3120 used the national standard GB / T14613-2008 dough floating fermentation ability test, and the fermentation ability of the strain was verified after the strain was cultured overnight, and the floating time was no more than 1 hour.

[0025] The fermentation ability of brewer's yeast INM3120 in high-sugar dough was retested. The dough was made according to the method in the national standard GB14612-2008, and the added sugar content was changed to 30%. The sugar content was increased. The retested strain was still able to maintain high fermentation ability under high sugar, and the hardness of the bread made was still less than 500g after 3 days.

[0026] Culture medium formulation 1. Yeast extract peptone dextrose medium (YPD): 2wt% glucose, 2wt% peptone, 1wt% yeast extract, 95wt% water.

[0027] 2. Yeast extract peptone glucose agar medium: 2wt% glucose, 2wt% peptone, 1wt% yeast extract, 2wt% agar powder, 93wt% water.

[0028] 3. Homemade culture medium: Each 1000 ml culture medium contains 15 g agar, 10.2 g peptone, 22 g monascus red pigment, and 0.5 g chloramphenicol, and is sterilized after preparation.

[0029] 4. Yeast peptone medium (YP): 2wt% peptone, 1wt% yeast extract, 97wt% water.

[0030] 5.YP+30% sucrose medium: 20g peptone, 10g yeast and 300g sucrose per 1000mL culture medium, sterilized after preparation.

[0031] Example 1 Isolation, screening and identification of yeast 1. Acquisition and purification of strains Sample collection: 10 g of sourdough dough from different origins in Pingyang County, Wenzhou City, Zhejiang Province were selected and placed in 100 mL of sterile yeast extract peptone glucose medium and mixed thoroughly. Sample expansion culture: Place the yeast extract peptone glucose medium containing sourdough in a shaker at 30°C and 220 rpm for overnight culture; Sample separation: dilute the overnight cultured samples in a gradient of 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , take 10 -4 , 10 -5 100 μL of the diluted sample was evenly spread on the homemade culture medium and cultured in a 30°C constant temperature incubator for 48-72 h; Sample purification: After the colonies grow, pick out the red Saccharomyces cerevisiae on the homemade culture medium, and streak inoculate it into another sterile yeast extract peptone glucose agar medium, and culture it in a 30℃ constant temperature incubator for 48-72h. Repeat the above steps until a monoclonal colony of Saccharomyces cerevisiae is obtained, and name each monoclonal colony.

[0032] 2. Screening for high sucrose tolerance The monoclonal colonies without foreign bacteria were inoculated into YP + 30% sucrose medium, and placed in a shaker at 30°C and 220 rpm / min. After culturing for 24 h, the OD was measured. 600 .

[0033] In addition, the control group was prepared with the laboratory ACY283 strain and two commercially available baker's yeast strains ACY297 and ACY298. 600 The test results are shown in Figure 1 shown.

[0034] Six yeast strains with strong high sugar tolerance were screened out: S-4, S-5, S-39, S-40, S-70, and HN-10. 600 The values ​​were significantly higher than those of the strains purified from other samples, and the OD values ​​of the S-4, S-5, S-39, and S-70 strains were 600 All of them are superior to ACY283, ACY297, and ACY298 strains, so S-4, S-5, S-39, and S-70 have stronger growth ability in a high-sugar environment.

[0035] 3. Determination of yeast fermentation capacity Using the national standard GB / T14613-2008 dough floating fermentation ability experiment, the fermentation ability of S-4, S-5, S-39, S-40, S-70, HN-10, ACY283, ACY297, and ACY298 strains was verified after overnight culture.

[0036] The specific experimental methods are as follows: 4g of whole wheat flour, containing 5.010 10 Mix yeast solution with 1000 micrograms of bacteria and 2.25mL of sterile water to form a spherical dough, and put it into 30℃ water. Due to the fermentation of yeast, the carbon dioxide content in the spherical dough increases continuously, and the volume also increases accordingly, the specific gravity decreases, and it floats to the water surface. The floating time is measured, and it is observed every 15 minutes to see if it floats. The shorter the floating time, the stronger the fermentation ability. The test results are as follows Figure 2 shown.

[0037] From the test results, it can be seen that the floating time of the dough corresponding to S-4, S-5, S-39, S-40, and S-70 is shorter than that of HN-10 and ACY283. Therefore, S-4, S-5, S-39, S-40, and S-70 have better fermentation ability, and the above 5 strains were selected for subsequent screening.

[0038] 3. Retest of fermentation capacity in high sugar dough The dough was made according to the method in the national standard GB14612-2008, and the added sugar content was changed to 30% of the flour weight to make high-sugar bread. The fermentation effect of different strains in a high-sugar environment was observed and the fermentation ability of the strains under high sugar was retested by measuring the specific volume and hardness of the bread.

[0039] The specific experimental methods are as follows: a. Formula for making medium dough: Mix 60g wheat flour with 1g yeast, add 36g water and knead into a smooth and soft dough, and ferment in a fermentation box at 30℃ and relative humidity of 85% for 4h.

[0040] b. Make the main dough: add 2g salt, 30g white sugar, 40g wheat flour and 24g water, stir until there is no dry powder, then add the medium dough, knead into a dough with fully expanded gluten, add 3g butter and stir until it is absorbed. The dough is fermented in the fermentation box for 30 minutes before being formed, and then proofed in the proofing box at 35℃ and 85% relative humidity for 1 hour.

[0041] c. Baking: Bake in an oven at 215°C upper heat and 200°C lower heat for 30 minutes to make bread.

[0042] The sliced ​​bread is shown in the attached picture. Figure 3 The storage hardness test results of bread made from different strains are shown in the attached Figure 4 shown.

[0043] Combination Figure 3 and Figure 4 The high-sugar bread produced by strain S-4 had better specific volume and the lowest hardness.

[0044] Through systematic verification of sucrose tolerance and fermentation ability in a high-sugar environment, the screened S-4 strain can not only maintain a good growth state in a high-sugar environment, but also show significant advantages in high-sugar bread fermentation.

[0045] Identification of yeast strains 1 Morphological identification The S-4 strain was inoculated and cultured in 100 mL YPD sterile liquid culture medium, and cultured in a shaker at 30°C and 220 rpm for 24 h. The multi-terminal budding reproduction state of Saccharomyces cerevisiae was observed under an optical microscope (×40). It can be observed that the strain grows in a budding state. The cell size of Saccharomyces cerevisiae is usually 2.5-10 μm, and the isolated strain is 2.5-5 μm (e.g. Figure 6 shown).

[0046] At the same time, the purified Saccharomyces cerevisiae was streaked and inoculated into the self-made culture medium, cultured in a constant temperature incubator at 30°C for 2 days, then taken out and placed at room temperature for 1-2 days. The colony state was red protrusion in the center, white edge, smooth and opaque (such as Figure 5 shown).

[0047] 2. Gene sequence identification The S-4 strain was subjected to ITS sequencing and identification. After comparative analysis, the 26S rRNA region sequence obtained from the S-4 strain was 99.33% similar to that of Saccharomyces cerevisiae, confirming that the S-4 strain was a strain of Saccharomyces cerevisiae.

[0048] The S-4 strain was genetically identified, and the 26S rRNA nucleotide sequence was shown in SEQ ID NO:1.

[0049] Yeast strain preservation The S-4 strain was identified as Saccharomyces cerevisiae INM3120, deposited in Guangdong Microbiological Culture Collection Center, with the deposit number: CGMCC NO: 65310, deposit address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, Institute of Microbiology, Guangdong Academy of Sciences, and classified as Saccharomyces cerevisiae. Therefore, INM3120 and S-4 refer to the same strain in this application.

[0050] Example 3 A fermentation agent comprises the saccharomyces cerevisiae INM3120 of Example 1.

[0051] The method for preparing the above-mentioned leavening agent comprises the following steps: S1. After activating Saccharomyces cerevisiae INM3120, 10 mL of the activated Saccharomyces cerevisiae INM3120 bacterial solution was taken and inoculated into 3 L of YPD liquid culture medium, and cultured in an incubator at 30°C to obtain a seed solution with an OD value (600 nm) of 2.0; 3 L of the seed solution was inoculated into the sterilized YPD liquid culture medium, and then placed in a fermenter, and cultured at 30°C for 24 hours, during which the rotation speed of the fermenter was 150 r / min and the ventilation volume was 15 CFM, to obtain a culture solution; S3. The culture solution was centrifuged at 15000 r / min using a tubular centrifuge to collect the bacterial cells, which were mixed with trehalose at a weight ratio of 0.0:20, and freeze-dried for 48 h at -60°C and 15 Pa using a freeze dryer to obtain a starter. The number of live bacteria of Saccharomyces cerevisiae KXMR006 in the starter was measured to be 5.0×10 10 CFU / g.

[0052] Example 4 Application of Saccharomyces cerevisiae INM3120 in the preparation of high-sugar bread.

[0053] When retesting the fermentation ability of brewer's yeast in high-sugar dough, the present application conducted a sensory evaluation on the resulting bread.

[0054] Sensory evaluation method: 8 evaluators, aged 21-28, 4 males and 4 females The samples were packaged in small plastic cups. After the sensory evaluators tasted each sample, they scored each test item from 0 to 10 and rinsed their mouths with water between tasting different samples.

[0055] The evaluation results are shown in Table 1 below.

[0056] Table 1. Sensory evaluation results of high-sugar bread Grouping sour taste bitterness Taste Overall Rating S-4 (Saccharomyces cerevisiae INM3120) 8.6 8.4 9.1 26.1 S-5 7.8 7.1 8.5 23.4 S-39 7.3 7.6 8.6 23.5 S-40 7.1 8.9 8.7 24.7 S-70 7.6 8.8 8 17.2 ACY283 8.3 7.5 8.4 24.2 ACY297 7.5 8.2 8.5 24.2 ACY298 7.2 8.8 8.7 24.7 Note: Each assessment has a maximum score of 10 points, with a scoring interval of 0.1. The comprehensive score is the sum of all items. The higher the score, the better the result.

[0057] Depend on Figure 5 As shown in the results of Table 1, in high-sugar bread, Saccharomyces cerevisiae INM3120 can not only significantly reduce the hardness of the bread and maintain a low hardness during the 3-day storage period, but also improve the flavor of the bread when used as a bread leavening agent. The metabolism of Saccharomyces cerevisiae INM3120 affects the sourness, bitterness and taste of the bread, improving the flavor and taste of the high-sugar bread.

[0058] Example 5 Application of Saccharomyces cerevisiae INM3120 in bread supplemented with gluten.

[0059] Saccharomyces cerevisiae INM3120 was used as a seed, and 5 wt% gluten was added based on the national standard GB 14612-2008 to make bread with gluten. In addition, strain ACY297 was used as a seed as a control group.

[0060] The fermentation of the bread was observed and recorded, and the hardness, specific volume, and sensory evaluation of the bread were tested. The experimental results are shown in Table 2 below.

[0061] Table 2. Test and sensory evaluation results of bread with gluten added Note: Each item of sensory evaluation has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item. The results in Table 2 show that inoculating brewer's yeast INM3120 to make dough in the national standard formula can significantly increase the specific volume of the fermented dough and improve the hardness; in addition, it can also improve the sensory evaluation of bread, increase the aroma of bread, and improve the flavor and taste of gluten bread, making the gluten bread fragrant, sweet and sour.

[0062] Example 6 Application of Saccharomyces cerevisiae INM3120 in bread with added whole wheat bread.

[0063] Saccharomyces cerevisiae INM3120 was used as the species, and whole wheat flour was replaced with ordinary wheat flour based on the national standard GB 14612-2008 to make whole wheat bread. In addition, ACY297 strain was used as the species as the control group.

[0064] The fermentation of the bread was observed and recorded, and the hardness, specific volume, and sensory evaluation of the bread were tested. The experimental results are shown in Table 3 below.

[0065] Table 3 Detection and sensory evaluation results of whole wheat bread Note: Each item of sensory evaluation has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item. Combined with Table 3, the specific volume of bread fermented by Saccharomyces cerevisiae INM3120 and ACY297 strains is similar (as shown in Table 3), but the hardness of bread fermented by Saccharomyces cerevisiae INM3120 is significantly lower than that of ACY297 strain, and the taste and flavor evaluation is better than that of ACY297 strain.

[0066] Therefore, inoculating brewer's yeast INM3120 into whole wheat bread to make dough can significantly reduce the hardness of whole wheat bread; in addition, it can also improve the sensory evaluation of whole wheat bread, increase the aroma of whole wheat bread, improve the flavor and taste of whole wheat bread, and make the whole wheat bread fragrant, sweet and sour.

[0067] Based on the specific volume, hardness and sensory evaluation of the high-sugar bread in Example 3, the bread with added gluten in Example 5 and the whole wheat bread in Example 7, it can be seen that the brewer's yeast INM3120 of the present application exhibits excellent fermentation ability under different formulations and is suitable for further research and application as a high-sugar food fermentation agent.

[0068] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed. However, as long as the modifications are within the scope of protection required by the present application, they shall be protected by the patent law.

Claims

1. A high-sugar-tolerant and high-fermentation yeast, characterized in that: The name is Saccharomyces cerevisiae INM3120, and it was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024. The deposit number is GDMCC No: 65310. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

2. The high-sugar-tolerant and high-fermentation Saccharomyces cerevisiae according to claim 1, characterized in that: The ITS gene sequence of Saccharomyces cerevisiae INM3120 is:.

3. The high-sugar-tolerant and high-fermentation Saccharomyces cerevisiae according to claim 1, characterized in that: Saccharomyces cerevisiae INM3120 grows in a budding state. The cell size of Saccharomyces cerevisiae INM3120 is usually 2.5-10μm, and the isolated strain is 2.5~5μm.

4. The high-sugar-tolerant and high-fermentation Saccharomyces cerevisiae according to claim 1, characterized in that: Saccharomyces cerevisiae INM3120 was cultured on yeast extract peptone glucose plate medium (YPD) for 48 hours, and the colony diameter reached 5-6 mm; the colonies were smooth and opaque, round and smooth in surface, with a convex center, and the colony edges were neat and slightly convex.

5. The high-sugar-tolerant and high-fermentation Saccharomyces cerevisiae according to claim 1, characterized in that: Saccharomyces cerevisiae INM3120 was cultured in YP + 30% sucrose medium at 30°C and 220 rpm / min for 24 h, and the OD 600 Greater than 0.

23.

6. Use of the high-sugar-tolerant and high-fermentation Saccharomyces cerevisiae according to any one of claims 1 to 5 in yeast preparations.

7. Use of the high-sugar-tolerant and high-fermentation-capacity Saccharomyces cerevisiae according to any one of claims 1 to 5 in bread fermentation.

8. The application of the high-sugar-tolerant and high-fermentation Saccharomyces cerevisiae in bread fermentation according to claim 7, characterized in that: Bread includes but is not limited to whole wheat bread, high-sugar bread, and bread with added gluten.

Images