Brucella popplesii B14 capable of increasing milk yield and milk fat percentage of ruminants and its application

Abstract

The present invention relates to the field of microbial technology, and particularly to a Prevotella bryantii B14 capable of increasing the milk yield and milk fat percentage of ruminants and its application. A strain of Prevotella bryantii B14, with the Latin name Prevotella bryantii; the preservation number is CCTCC NO: M 20242730. The Prevotella bryantii B14 provided by the present invention can increase the milk yield and milk fat percentage of ruminants by increasing the concentrations of total volatile fatty acids, acetic acid, propionic acid and valeric acid in the rumen of ruminants. In addition, it also has the function of synthesizing niacin, and can activate the mTORC1 signaling pathway in a GPR109A-dependent manner in the mammary gland of ruminants, promoting the expression of lipid synthesis genes to promote milk fat synthesis. Prevotella bryantii B14 also has the function of reducing the abundance of methanogenic archaea in the rumen, so it is expected to improve the energy utilization efficiency by reducing the methane emissions of ruminants.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a strain of Prevotella brisebilharzia B14 capable of improving milk production and milk fat rate of ruminants and application thereof. Background Art

[0002] The milk yield and fat content of ruminants are two key indicators for measuring lactation performance. They not only affect the output and nutritional value of dairy products, but also directly determine the market economic benefits of dairy products. However, in actual production, the fluctuation of milk yield and the frequent occurrence of fat inhibition in dairy animals have seriously restricted the stable development of the dairy industry. Rumen microorganisms produce key metabolites such as volatile fatty acids through biological fermentation, providing important carbon sources and precursors for the synthesis of milk, fat and other milk components. For the synthesis of fat and milk in ruminants, the rumen plays an indispensable role as the center of the host-feed metabolic network, which has led to a large number of related works on regulating the lactation performance of ruminants with rumen microorganisms as the target. Existing work mainly focuses on single lactation phenotypes such as milk yield and fat content of ruminants. The milk yield of ruminants is usually inversely proportional to the content of key nutrients in milk such as fat content. Therefore, there is a lack of systematic understanding of the coordinated regulation between milk yield and fat content.

[0003] Prevotella is the largest functional group in the rumen of ruminants. It performs multiple metabolic functions in the rumen ecosystem, especially in the decomposition of carbohydrates, protein metabolism, nitrogen cycle and vitamin synthesis. It can efficiently decompose complex carbohydrates such as cellulose, hemicellulose and starch in the diet, generate metabolic molecules such as volatile fatty acids and vitamins, thereby providing energy for ruminants and regulating their physiological activities. Therefore, it is a key issue that technicians in this field need to solve urgently to explore and isolate functional Prevotella strains in the rumen of ruminants, and use these strains to improve rumen fermentation, feed utilization and lactation performance of ruminants, so as to achieve precise nutritional regulation and improve economic benefits. Summary of the invention

[0004] The object of the present invention is to provide a Prevotella bryantii B14 capable of increasing the milk yield and milk fat percentage of ruminants and its application. The Prevotella bryantii B14 provided by the present invention has the function of synthesizing nicotinic acid, and its active form, nicotinamide, can activate the mTORC1 signaling pathway in the mammary gland of ruminants in a GPR109A-dependent manner, promoting the expression of lipid synthesis genes such as ACCα, SREBP, FASN, SCD1, and PPARγ to promote milk fat synthesis. In addition, Prevotella bryantii B14 can improve rumen fermentation in ruminants, increase the concentrations of total volatile fatty acids (VFAs), acetic acid, propionic acid, and valeric acid in the rumen, so as to increase the milk yield and milk fat percentage. Further, Prevotella bryantii B14 has the function of reducing the abundance of methanogenic archaea in the rumen, so it is expected to improve the energy utilization efficiency of ruminants by reducing methane emissions from ruminants.

[0005] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a strain of Prevotella bryantii B14, with the Latin name Prevotella bryantii; the preservation number is CCTCC NO: M 20242730.

[0007] The present invention also provides the application of the above-mentioned Prevotella bryantii B14 in the production of nicotinic acid.

[0008] The present invention also provides the application of the above-mentioned Prevotella bryantii B14 in improving rumen fermentation in ruminants and promoting the concentrations of total VFAs, acetic acid, propionic acid, and valeric acid in the rumen.

[0009] The present invention also provides the application of the above-mentioned Prevotella bryantii B14 in the preparation of a feed additive that can improve the energy utilization efficiency of ruminant feed.

[0010] The present invention also provides the application of the above-mentioned Prevotella bryantii B14 in the preparation of a feed additive that reduces methane emissions from ruminants.

[0011] The present invention also provides the application of the above-mentioned Prevotella bryantii B14 in the preparation of a feed additive that promotes rumen fermentation in ruminants.

[0012] The present invention also provides the application of the above-mentioned Prevotella bryantii B14 in the preparation of a feed additive that promotes milk fat synthesis and increases the milk fat percentage.

[0013] The present invention also provides a feed additive, comprising the above-mentioned Prevotella bryantii B14.

[0014] Preferably, the cell concentration of Prevotella bryantii B14 in the feed additive is 1×108 ~1×10 11 CFU / mL.

[0015] The present invention also provides a method for producing nicotinic acid, which comprises inoculating the Propionibacterium freudenreichii B14 in a medium containing a precursor for nicotinic acid synthesis and culturing.

[0016] Preferably, the medium containing the precursor for nicotinic acid synthesis is Medium 159 medium.

[0017] The Propionibacterium freudenreichii B14 provided by the present invention can be suitably added to the conventional feed components of ruminants such as cattle and sheep. For example, it can be used for adding to pharmaceutical compositions, feeds, feed additives, probiotic agents, and appropriate excipients can also be added. The excipients can be excipients, diluents, fillers, absorption promoters, etc.; it can also be prepared into various dosage forms, such as powders, lozenges, granulations, microcapsules, liquid preparations, etc.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The Propionibacterium freudenreichii B14 provided by the present invention has the function of reducing the abundance of methanogenic archaea in the rumen of ruminants, so as to improve the energy efficiency of ruminants and reduce the feeding cost.

[0020] The Propionibacterium freudenreichii B14 provided by the present invention can also increase the concentrations of total VFAs, acetic acid, propionic acid, and valeric acid in the rumen of ruminants, thereby improving rumen fermentation.

[0021] The Propionibacterium freudenreichii B14 provided by the present invention can stimulate the activation of the mTORC1 signaling pathway in the mammary gland of ruminants by synthesizing nicotinic acid and stimulating it in the active form of nicotinamide, thereby increasing the expression of milk fat synthesis genes ACCα, SREBP, PPARγ, FASN, and SCD1 to promote milk fat synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0023] Figure 1In Example 1 of the present invention, it was confirmed based on the whole-genome annotation of Prevotella bryantii B14 and in vitro pure culture experiments that it can synthesize nicotinic acid using aspartic acid as a precursor; A shows the morphological information of Prevotella bryantii B14 under electron microscopy and the results of whole-genome annotation, B shows the concentration of aspartic acid in the culture medium after Prevotella bryantii B14 was cultured for 0 h or 24 h, and C shows the concentration of nicotinic acid in the culture medium after Prevotella bryantii B14 was cultured for 0 h or 24 h;

[0024] Figure 2 In Example 2 of the present invention, the effects of Prevotella bryantii B14 on the abundance of methanogenic archaea and methane production in an artificial rumen fermentation system; A is a schematic diagram of the artificial rumen fermentation system, and B - D respectively show the changes in gas production, methane production, and the copy number of methanogenic archaea in the artificial rumen fermentation system before and after treatment with Prevotella bryantii B14;

[0025] Figure 3 In Example 3 of the present invention, the nicotinic acid produced by Prevotella bryantii B14 can activate the mTORC1 signaling pathway in bovine mammary epithelial cells in a GPR109A-dependent manner in its active form, nicotinamide, enhancing the expression of lipid synthesis genes ACCα, PPARγ, SREBP, FASN, and SCD1, and promoting milk fat synthesis; Figure A shows the effects of nicotinamide on the levels of the mTORC1 downstream target proteins pT389-S6K and p-S6 in bovine mammary epithelial cells; Figure B shows the effects of nicotinamide on the lipid synthesis genes ACCα, PPARγ, SREBP, FASN, and SCD1 downstream of mTORC1 in bovine mammary epithelial cells; Figure C shows the effects of nicotinamide on the levels of the mTORC1 downstream target proteins pT389-S6K and p-S6 after specifically inhibiting the expression of GPR109A; Figure D shows the effects of nicotinamide on the expression of the mTORC1 downstream and lipid synthesis genes ACCα, PPARγ, SREBP, FASN, and SCD1 after specifically inhibiting the expression of GPR109A;

[0026] Figure 4 In Example 4 of the present invention, the effects of Prevotella bryantii B14 on the milk yield and milk fat percentage of late-lactation dairy goats; A is a bar graph showing the changes in the average milk yield during the adaptation period and the treatment period, and B is a line graph showing the changes in the milk fat percentage during the adaptation period and the treatment period;

[0027] Figure 5 In Example 4 of the present invention, the effects of Prevotella bryantii B14 on the rumen fermentation parameters of late-lactation dairy goats; Figures A - D respectively show the changes in the concentrations of total VFAs, acetic acid, propionic acid, and valeric acid in the rumen of late-lactation dairy goats before and after treatment with Prevotella bryantii B14 (Prevotellabryantii B14);

[0028] Figure 6Effect of Prevotella bryantii B14 on nicotinic acid concentration and methanogenic archaeal abundance in the rumen of late-lactation dairy goats in Example 4 of the present invention; Figure A shows the change in the copy number of Prevotella bryantii B14 in the rumen of dairy goats before and after treatment with Prevotella bryantii B14, Figure B shows the change in the nicotinic acid concentration in the rumen of dairy goats before and after treatment with Prevotella bryantii B14, and Figure C shows the change in the methanogenic archaeal abundance in the rumen of dairy goats before and after treatment with Prevotella bryantii B14.

[0029] Biological deposit description

[0030] A strain of Prevotella bryantii B14, with the Latin name Prevotella bryantii;

[0031] This strain was deposited at the China Center for Type Culture Collection CCTCC (Address: Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University) on December 05, 2024; the deposit number is CCTCC NO: M 20242730. Detailed implementation manners

[0032] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] The reagents required for the preparation of the culture media and solutions involved in the following embodiments were all purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. The late-lactation Guanzhong dairy goats were provided by Shaanxi Bofule Guanzhong Dairy Goat Breeding Co., Ltd. The ChamQ Universal SYBR qPCR MasterMix used on the real-time quantitative PCR system was purchased from Nanjing Novozymes Biotech Co., Ltd.

[0034] Example 1 In vitro isolation and culture of Prevotella bryantii B14 and verification of nicotinic acid synthesis ability

[0035] 1.1 Isolation of Prevotella bryantii B14 from the rumen digesta of high milk fat rate (HH) dairy goats

[0036] Suspend 1 mL of rumen fluid from high milk fat rate (milk fat rate greater than 3.93%) dairy goats in phosphate buffer and dilute it serially to 10 -8 . Apply 80 μL of the diluted sample onto Bacteroides mineral salt agar under a CO 2 gas flow condition.

[0037] The formula is as follows (g / L): glucose 15 g / L, potassium dihydrogen phosphate 4 g / L, disodium hydrogen phosphate 2 g / L, ammonium sulfate 0.5 g / L, sodium chloride 9 g / L, magnesium chloride 0.15 g / L, calcium chloride 0.01 g / L, manganese chloride 0.1 g / L, cobalt chloride 0.1 g / L, cysteine 0.8 g / L, sodium bicarbonate 1.5 g / L, heme 0.01 g / L, vitamin B12 0.005 g / L, ferrous sulfate 0.001 g / L, nalidixic acid 0.01 g / L, vancomycin 0.003 g / L, purified agar 20 g / L. After culturing for 3 days, pick the white, convex circular single colonies for strain identification and purification culture to obtain the target strain Prevotella bryantii B14. The sequencing results of the 16s rRNA gene sequence of Prevotella bryantii B14 are as follows:

[0038]

[0039] 1.2 Enrichment culture and preparation of Brucella suis B14 bacterial solution

[0040] Select a purified single colony and inoculate it into the modified Medium 159 medium. The formula of Medium 159 is as follows: 4.5 g of standard Medium 159 (https: / / www.dsmz.de / microorganisms / medium / pdf / DSMZ_Medium159.pdf) with an additional 0.1% cellobiose (w / v), 0.1% maltose (w / v), and 0.1% soluble starch (w / v) dissolved in 700 mL of sterile distilled water to prepare the modified Medium 159 medium for standby; thereafter, 300 mL of sterile clarified rumen fluid is additionally added to the modified Medium 159 culture solution, and autoclaved at 121 °C and 103 kPa for 20 min. Place the autoclaved culture solution in a CO 2 air stream for 60 min for preliminary deoxygenation.

[0041] Thereafter, transfer the preliminarily deoxygenated culture solution into an anaerobic incubator and dispense it into Hungate tubes. Loosen the tube caps and place them for more than 48 h to displace the dissolved oxygen. After the culture solution becomes clear and transparent, inoculate the Brucella suis B14 bacterial solution stored in a 50% glycerol solution at an inoculation amount of 5%. Incubate statically under anaerobic conditions at 37 °C. Centrifuge the Brucella suis B14 bacterial solution enriched for 24 h at 5000 r / min and 4 °C for 10 min, discard the supernatant, wash and resuspend it with physiological saline, and then perform gradient dilution to adjust the concentration of the bacterial solution for storage and standby.

[0042] 1.3 Brucella suis B14 encodes a complete nicotinic acid synthesis pathway

[0043] Download the complete genome of Brucella suis B14 through the DSMZ official website link (https: / / www.ncbi.nlm.nih.gov / nuccore / NZ_FOEM00000000). Use Prodigal (v2.6.3) to predict ORFs and obtain protein sequences. Perform KEGG annotation using KofamScan (v1.1.0) under the condition of a cutoff value of 1e-5 to evaluate the ability of Brucella suis B14 to synthesize nicotinic acid at the genomic level. Figure 1 Figure A shows the morphological information of Brucella suis B14 under an electron microscope and confirms that Brucella suis B14 encodes the complete enzyme genes in the nicotinic acid synthesis pathway, preliminarily determining that Brucella suis B14 can synthesize nicotinic acid using aspartic acid as a precursor.

[0044] 1.4 In vitro pure culture to verify the ability of Brucella suis B14 to synthesize nicotinic acid

[0045] To investigate the ability of **Prevotella bryantii** B14 to synthesize niacin under in vitro conditions, **Prevotella bryantii** B14 cultured to the logarithmic phase was counted using a hemocytometer. 500 μL of a bacterial suspension of **Prevotella bryantii** B14 at 1×10 8 CFU / mL and 500 μL of a heat-inactivated (100 °C, 10 min) bacterial suspension of **Prevotella bryantii** B14 at 1×10 8 CFU / mL were inoculated into the culture media of the **Prevotella bryantii** B14 group (PB, n = 3) and the heat-inactivated group (DPB, n = 3), respectively. The cultures were statically incubated at 37 °C in an anaerobic workstation. After centrifugation of the culture broths of the PB and DPB groups at 4000 r / min for 10 min at 0 h and 24 h of culture, the supernatants were collected for subsequent assays. Since the components of Medium 159 include niacin and its synthetic precursor aspartic acid, an enzyme-linked immunosorbent assay kit (ELISA) was used to measure the concentrations of aspartic acid and niacin in the culture supernatants of the PB and DPB groups according to the manufacturer's instructions. Figure 1 Panel B shows the changes in the concentrations of aspartic acid and niacin in the culture media of **Prevotella bryantii** B14 at 0 h and 24 h of culture.

[0046] The results showed that after 24 h of culture in the PB group, the concentration of aspartic acid, the precursor of niacin synthesis in the culture medium, decreased significantly, while the concentration of the target product niacin increased significantly (P < 0.05).

[0047] Example 2 **Prevotella bryantii** B14 reduces methane production by decreasing the abundance of methanogenic archaea

[0048] The effect of **Prevotella bryantii** B14 on methane production was investigated using an artificial rumen fermentation system. Fresh rumen fluid from a dairy goat was collected via rumen cannulation before morning feeding and poured into an anaerobic bag (parity: 2, lactation age = 123), and then taken back to the laboratory in an incubator preheated to 39 °C. All experimental operations were carried out under a CO 2 gas flow condition. For each anaerobic bottle, first, 0.6 g of total mixed ration (TMR) (purchased from Shaanxi Yangling Fushite Biotechnology Co., Ltd.), which had been crushed and dried, was added. Then, the rumen fluid was mixed with preheated artificial saliva (1:4), and 60 mL of the mixture was drawn and injected into the anaerobic bottle.

[0049] The formula for artificial saliva is as follows: Solution A: CaCl 2 ·2H 2 O (13.2 g), FeCl 3 ·6H 2 O (8.0 g), MnCl 2 ·4H 2 O (10.0 g), CoCl 2 ·6H 2O (1.0 g), made up to 100 mL with deionized water; Solution B: NH 4 HCO 3 (4.0 g), NaHCO 3 (35.0 g), made up to 1000 mL with deionized water; Solution C: Na 2 HPO 4 (5.7 g), MgSO 4 ·7H 2 O (0.6 g), KH 2 PO 4 (6.2 g), made up to 1000 mL with deionized water; Resazurin solution: 0.1 g resazurin dissolved in 100 mL deionized water; Reducing agent solution: 1 M NaOH (4 mL), Na 2 S·9H 2 O (0.625 g), made up to 100 mL with deionized water; Artificial saliva was prepared by mixing 400 mL of distilled water + 0.1 mL of Solution A + 200 mL of Solution B + 200 mL of Solution C + 1 mL of resazurin solution + 40 mL of reducing agent solution.

[0050] In the anaerobic bottle of the control group (SN), 2 mL of the culture supernatant of Prevotella bryantii B14 that had been centrifuged and filtered through a 0.22 μm filter membrane to remove bacteria was added.

[0051] In the Prevotella bryantii B14 group (PB), 2 mL of a Prevotella bryantii B14 bacterial solution with a concentration of 1×10 8 CFU / mL was added. The tops of all anaerobic bottles were connected to an anaerobic gas collection bag equipped with a three-way valve and then placed in a thermostatic shaker preheated to 39.5 °C and fermented at 60 rpm for 24 h. After fermentation, a syringe equipped with a three-way valve was used to measure the gas volume in each gas collection bag. A gas chromatograph was used to measure the methane concentration.

[0052] The gas chromatograph was equipped with a TDX-1 chromatographic column, and the set parameters were as follows: injection port temperature 100 °C, detector temperature 100 °C, carrier gas (argon) flow rate 30.0 mL / min, detection time 6 min / sample, injection volume 10 mL. The total methane production was calculated according to the formula: total methane production = total gas production × methane concentration. After fermentation, the anaerobic bottles were placed on ice to terminate fermentation, and the fermentation precipitates in each anaerobic bottle were collected for quantifying the copy number of methanogenic archaea in the fermentation precipitates. The specific quantification method was: using real-time quantitative PCR (qRT-PCR) to measure the copy number of methanogenic archaea in the fermentation precipitates.

[0053] Using Forward: GAGGAAGGAGTGGACGACGGTA, Reverse: ACGGGCGGTGTGTGCAAG (as shown in SEQ ID NO: 2, 3) as specific primers, and the feasibility of the primers was verified by Primer-BLAST. The qRT-PCR assay was performed on a 96-well real-time quantitative PCR system using ChamQ Universal SYBR qPCR Master Mix.

[0054] The reaction system was as follows: Forward Premier and Reverse Premier 0.4 μL, ChamQ Universal SYBR qPCR Master Mix 10 μL, cDNA 1 μL, and deionized water 8.2 μL. The reaction program was: 95°C for 30 s, 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles.

[0055] The final quantification of methanogenic archaea copy number was achieved by inputting the cycle threshold into the standard curve specific for each microorganism. The results were expressed as the copy number per gram of fermentation precipitate (log 10 ). Figure 2 A- represents a schematic diagram of the artificial rumen fermentation system device; Figure 2 B-D respectively represent the gas production, methane production, and the copy number of methanogenic archaea in the fermentation precipitate of the artificial rumen fermentation system before and after treatment with Prevotella bryantii B14.

[0056] The results showed that after inoculation and fermentation with Prevotella bryantii B14 for 24 h, the gas production, methane production, and the abundance of methanogenic archaea in the artificial rumen fermentation system were significantly decreased (P < 0.05), which confirmed that Prevotella bryantii B14 could adjust the energy efficiency of ruminants by reducing methane production.

[0057] Example 3 Prevotella bryantii B14 promotes milk fat synthesis in an mTORC1-dependent manner by synthesizing nicotinic acid

[0058] 1.1 Prevotella bryantii B14 activates the mTORC1 signaling pathway in bovine mammary epithelial cells by synthesizing nicotinic acid

[0059] Since nicotinamide is the main active form of niacin in the goat circulatory system, the niacin synthesized by *Prevotella bryantii* B14 should subsequently regulate milk fat synthesis in the mammary glands of ruminants in the form of nicotinamide (Chen, Juncai, Zhenguo Yang, and Guozhong Dong. "Niacin nutrition and rumen-protected niacin supplementation in dairy cows: an updated review." *British Journal of Nutrition* 122.10 (2019): 1103-1112.). Therefore, to reveal the key signaling pathways mediated by nicotinamide in regulating milk fat synthesis, bovine mammary epithelial cells were cultured in DMEM medium supplemented with 10% fetal bovine serum at 37 °C and 5% CO 2 . Bovine mammary epithelial cells were stored in a continuously humidified cell culture incubator under standard culture conditions.

[0060] Bovine mammary epithelial cells cultured for 24 h after resuscitation were taken, and the cell density and growth status were observed under a microscope. Subculture was performed when the cell density reached about 90%. Since the half-life of nicotinamide in goats is about 4 h, after incubating the subcultured bovine mammary epithelial cells with nicotinamide at concentrations of 0.0, 0.1, 0.5, 1.0, 2.5, and 5.0 mM for 4 h, they were frozen at -80 °C for subsequent qRT-PCR and Western blot assays. The results are shown in Figure 3 A.

[0061] It can be seen from the results that when the nicotinamide concentration was 0.5 mM, it could significantly increase the expression levels of the downstream target proteins pT389-S6K and p-S6 of mTORC1 in bovine mammary epithelial cells (P < 0.05). It should be emphasized that the concentration of 0.5 mM nicotinamide selected in this experiment was relatively consistent with the concentration of endogenous nicotinamide in the ruminant circulatory system.

[0062] 1.2 *Prevotella bryantii* B14 promotes the expression of lipid synthesis genes by synthesizing niacin

[0063] Table 1 Primer sequences of lipid synthesis genes

[0064]

[0065] Shown in SEQ ID NO: 4-17.

[0066] Total RNA was extracted from bovine mammary epithelial cells incubated with 0.1 mM and 0.5 mM nicotinamide using the TRIzol method. The concentration and purity of the extracted RNA were measured using a Nanodrop 2000 spectrophotometer, and the integrity of the extracted RNA was examined using agarose gel electrophoresis. Thereafter, the extracted total RNA was reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit to obtain cDNA. qRT-PCR was performed on a Light 96 Real-Time PCR System using ChamQ Universal SYBR qPCR MasterMix.

[0067] The reaction system was as follows: 0.4 μL each of Forward Premier and Reverse Premier, 10 μL of ChamQ Universal SYBR qPCR MasterMix, 1 μL of cDNA, and 8.2 μL of deionized water.

[0068] The reaction program was: 30 s at 95 °C, 10 s at 95 °C, 30 s at 60 °C, for a total of 40 cycles. All primers used in the study were designed using Oligo 7 software and preliminarily verified using primer-blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The relative expression levels of mRNA were calculated using the comparative cycle method (2 -ΔΔCt ). The primer sequences for lipid synthesis genes are shown in Table 1, and the detailed results are shown in Figure 3 B.

[0069] The results showed that incubation with 0.5 mM nicotinamide could significantly upregulate the expression of lipid synthesis genes ACCα, SREBP, FASN, SCD1, and PPARγ in bovine mammary epithelial cells (P < 0.05), thus having the effect of promoting milk fat synthesis.

[0070] 1.3 Nicotinamide activates the mTORC1 signaling pathway via the GPR109A receptor

[0071] Nonspecific control small interfering RNA (siRNA) and GPR109A-specific siRNA were mixed with Lipofectamine 3000 at a ratio of 1:1. The mixture was diluted with serum-free medium and incubated at room temperature for 30 minutes. Subsequently, the diluted siRNA-Lipofectamine complex was added to a six-well plate containing bovine mammary epithelial cells and transfected for 24 hours. The transfected bovine mammary epithelial cells were seeded in a 12-well plate and incubated for 4 hours at nicotinamide concentrations of 0.0, 0.1, and 0.5 mM. The siRNA sequence used was as follows: 5′-GAACGAGGUUGAUCGAGAAUC-3′. As shown in SEQ ID NO: 18. For detailed results, see Figure 3 C-D.

[0072] The results showed that when the GPR109A receptor was silenced using specific siRNA, 0.5 mM nicotinamide could not regulate the expression of the downstream target proteins pT389-S6K, p-S6 of mTORC1, and lipid synthesis genes ACCα, SREBP, FASN, SCD1, and PPARγ (P>0.05), demonstrating that nicotinamide activates the mTORC1 signaling pathway in a GPR109A receptor-dependent manner.

[0073] Example 4 Effects of Prevotella bryantii B14 on rumen fermentation and lactation performance of late-lactation dairy goats

[0074] 1.1 Effects of Prevotella bryantii B14 on lactation performance of late-lactation dairy goats

[0075] Ten Guanzhong dairy goats at the late lactation stage (parity = 1, DIM = 215.30 ± 3.03, mean ± SD) were selected and raised in Fuping County, Weinan City, Shaanxi Province. The goats were evenly divided into a control group (CON) and a Prevotella bryantii B14 gavage group (PB) and raised in two pens separately. The entire experimental period was 17 days, and the local daily minimum and maximum average temperatures during the experimental period were 20.13°C and 30.88°C, respectively. The dairy goats in the CON and PB groups first experienced a 7-day adaptation period and then a 10-day treatment period. During the entire experimental period, the dairy goats in both groups had free access to water, and the milk yield of each group of dairy goats was recorded daily. During the adaptation period, the dairy goats in both groups were not treated with anything. For the treatment period, 20 mL of sterile saline was gavaged to the CON group before morning feeding every day; 20 mL of a Prevotella bryantii B14 bacterial solution with a concentration of 1×10 11 CFU / mL resuspended with sterile saline was gavaged to the PB group. Milk samples of the experimental goats were collected before milking in the morning and afternoon on the 7th day of the adaptation period, the 5th day of the treatment period, and the 10th day of the treatment period, and were mixed in a ratio of 3:2 for milk composition analysis. The results are shown in Figure 4 .

[0076] The results showed that intragastric administration of **Prevotella bryantii** B14 could significantly alleviate the decline in milk production of dairy goats at the end of lactation and significantly increase the milk fat percentage in goat milk (P<0.05). The above results indicated that **Prevotella bryantii** B14 could improve the lactation phenotype of dairy goats at the end of lactation.

[0077] 1.2 Effects of **Prevotella bryantii** B14 on rumen fermentation of dairy goats at the end of lactation

[0078] For the model establishment of dairy goats at the end of lactation treated with **Prevotella bryantii** B14, see 1.1. Rumen digesta of dairy goats was collected before morning feeding on the day after the end of the treatment period. The concentrations of various volatile fatty acids in the rumen digesta samples were determined by gas chromatography. The results are shown in Figure 5 。

[0079] Briefly, the rumen digesta was thawed at 4°C and centrifuged at 16,000 r / min for 10 minutes. Subsequently, 2 mL of the supernatant was mixed with 400 μL of 25% metaphosphoric acid and vortexed thoroughly. The mixture was allowed to stand at 4°C for 4 hours and then centrifuged again at 16,000 r / min for 10 minutes. 200 μL of the supernatant was mixed with 200 μL of cinnamic acid (10 g / L) and vortexed, and then filtered through a 0.45 μm membrane filter for analysis. The parameter settings of gas chromatography were as follows: the inlet temperature was maintained at 250°C; the column temperature was initially set at 45°C and then increased to 150°C at a rate of 20°C / minute and held for 5 minutes.

[0080] The results showed that intragastric administration of **Prevotella bryantii** B14 could increase the concentrations of total volatile fatty acids, acetic acid, propionic acid, and valeric acid in the rumen of dairy goats (P<0.05), thereby improving rumen fermentation of dairy goats.

[0081] 1.3 Effects of **Prevotella bryantii** B14 on the concentration of nicotinic acid and the abundance of methanogenic archaea in the rumen of dairy goats at the end of lactation

[0082] For the model establishment of dairy goats at the end of lactation treated with **Prevotella bryantii** B14, see 1.1. Rumen digesta of dairy goats was collected in triplicate before morning feeding on the day after the end of the treatment period, and was used for the determination of the concentration of nicotinic acid in the rumen of dairy goats (ELISA method), and the absolute quantification of the copy numbers of **Prevotella bryantii** B14 and methanogenic archaea, respectively. The absolute quantification method was the same as that described in Example 3. The results are shown in Figure 6 。

[0083] The results showed that the abundance of Prevotella bryantii in the rumen of PB dairy goats increased significantly (P<0.05), proving that it could stably colonize in the rumen of dairy goats. In addition, the treatment with Prevotella bryantii B14 could significantly increase the concentration of nicotinic acid in the rumen digesta of late-lactation dairy goats (P<0.05), and significantly reduce the abundance of methanogenic archaea (P<0.05). The nicotinic acid produced by Prevotella bryantii B14 could subsequently promote milk fat synthesis in the mammary gland in the active form of NAM, while the decrease in the abundance of methanogenic archaea could further reduce the loss of energy in the form of methane, thereby improving the energy efficiency of dairy goats.

[0084] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A strain of Prevotella brucei ( Prevotella bryantii ) B14, deposited in the China Center for Type Culture Collection (CCTCC) on December 5, 2024; the deposit number is CCTCC NO: M 20242730.

2. Use of the Prevotella brisebiliensis B14 according to claim 1 in improving rumen fermentation of ruminants, increasing the concentrations of total volatile fatty acids, acetic acid, propionic acid and valeric acid in the rumen, and promoting milk production and milk fat rate.

3. Use of the Prevotella brisebiliensis B14 according to claim 1 in the preparation of a feed additive capable of improving the energy utilization efficiency of ruminant feed.

4. Use of the Prevotella brisebiliensis B14 according to claim 1 in the preparation of a feed additive for reducing methane emissions from ruminants.

5. Use of the Prevotella brisebiliensis B14 according to claim 1 in the preparation of a feed additive for promoting rumen fermentation in ruminants.

6. Use of the Prevotella brisebiliensis B14 described in claim 1 in the preparation of a feed additive for promoting milk fat synthesis and increasing milk fat rate.

7. A feed additive comprising the Prevotella brisebilharzia B14 according to claim 1.

8. The feed additive according to claim 7, characterized in that The bacterial concentration of Prevotella brunneri B14 in the feed additive is 1×10 8 ~1×10 11 CFU / mL.

9. The use of Prevotella brisebiliensis B14 according to claim 1 in the production of nicotinic acid, characterized in that: The Prevotella brisebiliensis B14 according to claim 1 is inoculated into a culture medium containing a precursor for nicotinic acid synthesis and cultured.

10. The use according to claim 9, characterized in that: The culture medium containing nicotinic acid synthesis precursors is Medium 159 culture medium.

Images