Probe and method for identifying sgRNA sequence

Abstract

The invention provides a probe and a method for identifying an sgRNA sequence or identifying impurities in a functional region. The probe comprises a catalytic structural domain, a first substrate binding arm and a second substrate binding arm, the nucleotide sequence of the catalytic structural domain is GGCTAGC TACAACGA, and the cleavage site of the catalytic structural domain is purine-pyrimidine, preferably AU or GU; the first substrate binding arm and the second substrate binding arm are located on the two sides of the catalytic structural domain respectively and recognize sequences on the two sides of a target sgRNA cleavage site respectively, and the length of at least one of the first substrate binding arm and the second substrate binding arm is larger than 10 nt. The method is simple and direct, data analysis is convenient, the sequence coverage degree can reach 100%, specificity is good, the application range is wide, and the cutting efficiency is high and reaches 86% or above.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] The present invention claims priority to a prior application with patent application number 202310945092.X filed with the State Intellectual Property Office of China on July 28, 2023, entitled “A probe and method for identifying sgRNA sequences”. The entire text of the prior application is incorporated into the present invention by reference. Technical Field

[0003] The present invention relates to the field of nucleic acid identification technology, and in particular to a probe and method for identifying sgRNA sequences. Background Art

[0004] In recent years, gene editing technology based on CRISPR / Cas9 has been widely used in various disease fields, such as cancer treatment, genetic disease treatment, neurodegenerative disease treatment, HIV treatment, cardiovascular disease treatment, viral disease treatment and epigenetic disease treatment. As a key part of the CRISPR / Cas9 system, sgRNA binds and guides the Cas9 nuclease to perform site-specific cleavage on the target gene. The sgRNA molecule usually contains 100 bases, and certain specific nucleosides are modified by phosphorylation and glycosylation to enhance its stability and gene editing efficiency. Since the sequence of sgRNA determines the cleavage site of the target gene, a method that can accurately identify the sequence of sgRNA molecules is essential.

[0005] Existing technologies usually use reverse transcriptase to convert RNA into cDNA, and then obtain RNA sequence information through next generation sequencing (NGS). However, chemical modification information is lost during the sample preparation process involving cDNA transcription. Therefore, NGS can only identify the composition and order of each base in the sequence, but cannot identify the modification of a specific base, and the test cycle is long.

[0006] In addition, there are few reports in the industry on the research of impurities in the functional regions of sgRNA. For chemically synthesized sgRNA sequences, even after purification, there will be NX impurities. If such NX impurities occur in the functional regions, they may affect the efficiency of gene editing. Therefore, the identification of NX impurities in the functional regions must be done. There are currently only a few reports on impurity identification in this field, such as primary mass spectrometry characterization by LCMS, but this method cannot accurately characterize the specific sequence structure of the impurities.

[0007] LC MS / MS technology has been widely used in protein sequencing and proteomics research. Small oligonucleotides up to 30 bases in length can be sequenced by top-down mass spectrometry (top down MS), and molecular ion fragmentation is used for complete sequencing using collision-induced dissociation (CID). For longer RNA oligonucleotides, it is impossible to directly identify the complete sequence of long-chain oligonucleotides by mass spectrometry. At present, there are reports on the use of RNase T1, RNase A and RNase U2 enzymes to treat the full-length target sequence of sgRNA and then identify it. However, the use of RNase T1, RNase A and RNase U2 enzymes will cut the entire sgRNA sequence into a large number of small segments, accompanied by multiple repeat sequences and individual single bases and dinucleosides, making the data complex and fragmented, resulting in a relatively low final sequence coverage. The sequence coverage of the above single enzyme cutting scheme is only 71%-84%. Regarding the identification of sgRNA impurities, the industry has reported that LCMS is used to first separate sgRNA to a certain extent, and then the separated impurities are characterized by primary mass spectrometry to characterize the specific molecular weight of the impurities. However, this method is still unable to identify the specific sequence and modification of the impurities. Summary of the invention

[0008] In view of the deficiencies in the prior art, the present invention provides a method for identifying the sgRNA sequence information by cutting the sgRNA using a probe complementary to the sgRNA sequence and performing LC MS / MS mass spectrometry analysis on the cut fragments.

[0009] The present invention further provides a probe for site-specific cleavage of sgRNA sequences, which can achieve cleavage at specific sites, thereby solving the problem of low sequence coverage and inability to identify impurity sequences in sgRNA functional regions during mass spectrometry analysis caused by non-specific cleavage of enzymes in the prior art.

[0010] The probe for identifying the sgRNA sequence provided by the present invention comprises a catalytic domain, a first substrate binding arm and a second substrate binding arm.

[0011] The nucleotide sequence of the catalytic domain is GGCTAGCTACAACGA, and its cleavage site is purine-pyrimidine, preferably AU or GU;

[0012] The first substrate binding arm and the second substrate binding arm are respectively located on both sides of the catalytic domain, and the first substrate binding arm and the second substrate binding arm are respectively bound to the sequences on both sides of the sgRNA cleavage site to be analyzed, and the length of at least one of the first substrate binding arm and the second substrate binding arm is greater than 10nt, and the binding refers to the complementary binding of the bases of the substrate binding arm and the corresponding region of the sgRNA to be analyzed, including complete complementarity or partial complementarity.

[0013] Furthermore, the terminal group of the first substrate binding arm or the second substrate binding arm located on the catalytic domain side binds to U in the cleavage site.

[0014] Furthermore, when at least one of the first substrate binding arm or the second substrate binding arm is longer than 10 nt, the length of the other substrate binding arm is longer than 2 nt.

[0015] Furthermore, the nucleotide sequence of the sgRNA is as follows: X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20G(21)UUUUAGAGCUAGAAA(36)UAGCAAG(43)UUAAAA(49)UAAGGCUAGUCCGUUA(58)UCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU, wherein X1-X20 are functional regions, and X1-X20 are optionally A\U\G\C.

[0016] Preferably, the sgRNA comprises a modification.

[0017] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.1.

[0018] Furthermore, the cleavage sites are GU at site 21, AU at site 36, GU at site 43, AU at site 49, and GU at site 58 of the sgRNA (calculated from the 5' end sequence).

[0019] Preferably, GU at site 21, AU at site 36, and GU at site 43 are used for functional region or functional region impurity sequence identification, and AU at site 49 and GU at site 58 are used for sgRNA full-length sequence identification.

[0020] Furthermore, the probe recognizes and cuts the AU at position 49; preferably, the nucleotide sequence of the probe is shown in SEQ ID NO.2-4.

[0021] Furthermore, the probe recognizes and cuts the AU at position 36; preferably, the nucleotide sequence of the probe is shown in SEQ ID NO.8-10.

[0022] Further, the probe comprises a modification in the first substrate binding arm or the second substrate binding arm; preferably, comprises 2'-fluoroarabinose nucleic acid (FANA), 2'-methoxy or locked nucleic acid (LNA) modification; more preferably, comprises 2'-methoxy modification.

[0023] In another aspect, the present invention provides a method for identifying sgRNA sequences, using the above-mentioned probe to perform site-specific cutting of sgRNA, followed by LC MS / MS analysis to obtain sgRNA sequence information or functional region impurity sequence information.

[0024] Furthermore, the method for identifying the sgRNA sequence can identify the sequence of the functional region or the impurity sequence of the functional region.

[0025] Further, the following steps are included:

[0026] S1: Combine the probe with sgRNA to obtain a reaction mixture;

[0027] S2: adding metal ions to the reaction mixture to cut the sgRNA to obtain cut fragments;

[0028] S3: Analyze and identify the cleavage fragments using LC MS / MS mass spectrometry.

[0029] Further, step S1 includes: S11: mixing the probe, sgRNA, annealing buffer and water to obtain an annealing mixture; S12: annealing the annealing mixture to obtain a reaction mixture;

[0030] Preferably, in step S11, the molar ratio of the probe to the sgRNA is 1-3:1, more preferably 2:1;

[0031] Preferably, in step S11, the annealing buffer comprises Tris and NaCl;

[0032] Preferably, in step S12, the annealing temperature is 75-40° C., and the annealing time is at least 10 minutes.

[0033] Further, step S2 comprises: the concentration of the metal ions is 20-100 mM,

[0034] Preferably, the metal ion is a magnesium ion;

[0035] Preferably, the cutting temperature is 37°C and the cutting time is at least 3 hours.

[0036] Further, step S3 includes: S31: performing primary mass spectrometry detection on the cleaved fragments; screening parent ions according to the signal intensity of the primary mass spectrometry, and breaking the parent ions into daughter ions for secondary mass spectrometry detection;

[0037] S32: Analyze the obtained primary and secondary mass spectrometry detection data to identify the sgRNA sequence, functional region sequence or functional region impurity sequence.

[0038] In another aspect, the present invention provides the use of the above-mentioned probe in sgRNA sequence identification.

[0039] In another aspect, the present invention provides a kit comprising the above-mentioned probe for sgRNA sequence identification.

[0040] The present invention also provides a method for performing mass spectrometry analysis on a long-chain RNA sequence, comprising the following steps:

[0041] S1: determining a number of cleavage sites on the RNA sequence to be analyzed, wherein the cleavage sites are purine-pyrimidine, preferably AU or GU;

[0042] The cleavage site divides the RNA sequence into several fragments not exceeding 80 nt;

[0043] S2: According to the cleavage site determined in S1, several probe sequences are designed, wherein the probes include a catalytic domain, a first substrate binding arm and a second substrate binding arm;

[0044] The nucleotide sequence of the catalytic domain is GGCTAGCTACAACGA,

[0045] The first substrate binding arm and the second substrate binding arm are respectively located on both sides of the catalytic domain, and respectively bind to the sequences on both sides of the cleavage site determined by S1), and at least one of the lengths of the first substrate binding arm and the second substrate binding arm is greater than 10nt; further, when at least one of the first substrate binding arm or the second substrate binding arm is greater than 10nt, the length of the other substrate binding arm is greater than 2nt.

[0046] S3: Use the probe obtained in S2 to cut the RNA sequence to be analyzed;

[0047] S4) analyzing the fragments obtained in S3 using an LC MS / MS method to identify the RNA sequence or its modification;

[0048] The ultralong RNA sequence has a length ranging from 80 to 800 nt, preferably 140 to 500 nt.

[0049] In a specific embodiment of the present invention, step S3 includes:

[0050] S31: combining the probe with the RNA to be analyzed to obtain a reaction mixture;

[0051] S32: adding metal ions to the reaction mixture to cleave the RNA to obtain cleavage fragments;

[0052] Features:

[0053] Step S31 includes:

[0054] S311: mixing the probe, RNA, annealing buffer and water to obtain an annealing mixture;

[0055] S312: annealing the annealing mixture to obtain a reaction mixture;

[0056] Preferably, in step S311, the molar ratio of the probe to the RNA is 1-3:1, preferably 2:1;

[0057] Preferably, in step S311, the annealing buffer comprises Tris and NaCl;

[0058] Preferably, in step S312, the annealing temperature is 75-40°C, and the annealing time is at least 10 minutes;

[0059] and / or

[0060] Step S32 includes:

[0061] The concentration of the metal ion is 20-100 mM;

[0062] Preferably, the metal ion is a magnesium ion;

[0063] Preferably, the cutting temperature is 37°C and the cutting time is at least 3 hours.

[0064] In a specific embodiment of the present invention, step S4 includes: S41: performing primary mass spectrometry detection on the cleaved fragments; screening parent ions according to the signal intensity of the primary mass spectrometry, and breaking the parent ions into daughter ions for secondary mass spectrometry detection;

[0065] S42: Analyze the obtained primary and secondary mass spectrometry detection data to identify the RNA sequence or its modification information.

[0066] The present invention also provides a kit for the above method, wherein the kit comprises the plurality of probes described in step S2;

[0067] Preferably, the kit further comprises an annealing buffer and metal ions.

[0068] Compared with the prior art, the present invention has the following beneficial effects:

[0069] (1) The method of the present invention is simple and direct, data analysis is convenient, and the sequence coverage can reach 100%.

[0070] (2) The method of the present invention has good specificity, no non-specificity of protein nuclease, and a single cleavage site.

[0071] (3) The method for identifying sgRNA sequences and functional region sequences or functional region impurity sequences described in the present invention has a wide range of applications, and the probe has universal applicability. The sequence of the probe molecule of the present invention is combined with the scaffold sequence at the 3' end of the sgRNA, and the scaffold sequence composition of all sgRNAs is consistent, so the probe is applicable to all sgRNA sequences.

[0072] (4) The cutting efficiency of the method of the present invention is high, reaching more than 86%.

[0073] (5) The method of the present invention can also be used for the analysis and identification of long-chain RNA sequences. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 Schematic diagram of probe cutting in Example 1 of the present invention.

[0075] FIG. 2 is a schematic diagram of the cleavage of sgRNA_A captured by the probe in Example 1 of the present invention ( Figure 2A The AU cleavage site is shown; Figure 2B The GU cleavage site is indicated).

[0076] Figure 3 This is the deconvolution map of the sgRNA_A cleavage product in Example 1 of the present invention.

[0077] Figure 4 This is the secondary mass spectrum of sgRNA_A_5 in Example 1 of the present invention.

[0078] Figure 5 This is a secondary mass spectrometry matching result diagram of sgRNA_A_5 in Example 1 of the present invention.

[0079] Figure 6 This is the secondary mass spectrum of sgRNA_A_3 in Example 1 of the present invention.

[0080] Figure 7 This is the secondary mass spectrometry matching result of sgRNA_A_3 in Example 1 of the present invention.

[0081] Figure 8 This is the UV detection spectrum of probe 1-5 cutting site 49 in Example 2 of the present invention.

[0082] Fig. 9 This is the UV detection spectrum of the cutting of site 36 by probe 6-8 in Example 2 of the present invention.

[0083] Fig.10 This is the UV detection spectrum for the ratio screening of the probe samples in Example 3 of the present invention.

[0084] Fig.11 This is the UV detection spectrum for screening Mg ion concentration in Example 4 of the present invention.

[0085] Fig.12 This is the deconvolution spectrum for Mg ion concentration screening in Example 4 of the present invention.

[0086] Fig.13 This is a diagram of the functional region mapping results of sgRNA_A in Example 5 of the present invention.

[0087] Fig.14 This is a diagram showing the sgRNA_A cleavage site in Example 5 of the present invention.

[0088] Fig.15 This is the secondary mass spectrometry matching result of the 200nt RNA in Example 6 of the present invention. DETAILED DESCRIPTION

[0089] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0090] The technical principle of the present invention is: in the prior art, since sgRNA usually contains 100 or more bases, these macromolecules are difficult to obtain the signal of primary mass spectrum in the case of high resolution. Even if the information of primary mass spectrum can be obtained, it is also difficult to fragment the molecular ions of primary mass spectrum by the collision (HCD or CID) of the instrument, and it is also impossible to obtain abundant daughter ion information, so as to achieve the purpose of sequence identification. The enzymes such as RNase T1, RNase A and RNase U2 generally used at present, due to the poor specificity of the enzyme, it is difficult to obtain specific sequence fragments for sequence identification. Moreover, excessive enzyme cutting can obtain a lot of small fragments of different lengths, accompanied by multiple repeated sequences and individual single bases and dinucleosides, making the detection system complicated, and data analysis is cumbersome, resulting in the final sequence coverage being relatively low.

[0091] The inventors found through a large number of experiments that the probe primer is annealed with the sgRNA to capture the target sequence for hybridization, forming a catalytic center at a specific site (AU / GU). Then metal ions (magnesium ions) are added, and under the catalysis of the metal ions, a specific site is cut at a fixed point, which is located at any purine-pyrimidine junction. After cutting, two complementary fragments will be obtained (this method is only effective at the AU / GU junction and weakly effective at AC / GC). The two sequences are scanned by Full MS and MSMS respectively by LC MS / MS technology to obtain their actual fragment ion information. Using BioPharmaFinder data analysis software, the experimental data is matched with the theoretically generated fragment information to achieve the identification of the full-length sequence of sgRNA and impurities in the functional region of sgRNA.

[0092] Specifically, Full MS / ddms2 is used for the identification of sgRNA sequences. This method includes scanning of primary mass spectrometry and secondary mass spectrometry. After the primary mass spectrometry analysis, the 10 parent ions with the highest signal intensity are screened out by the quadrupole according to the signal intensity and sent to the HCD collision cell for fragmentation. Fragmentation generally occurs on the phosphate backbone. The fragmented daughter ions will be sent to the detector for analysis again to obtain the mass-to-charge ratio information of the daughter ions, that is, the secondary mass spectrometry information. The daughter ion information theoretically formed by the fragment is calculated by BioPharmaFinder, and the daughter ion information actually detected is matched with it. If the corresponding daughter ion can be found at each break position, the matching degree of the sequence is 100%. Thereby achieving the effect of sgRNA full-length sequence identification. Therefore, the identification of the full-length target sequence of sgRNA by probe capture combined with enzyme cleavage is accurate and reliable, which can not only identify the sequence but also various modifications on the bases.

[0093] The above technology can also be used to achieve sequence identification of other RNAs. According to the RNA sequence, several cleavage sites are determined, and the cleavage sites are purine-pyrimidine, preferably AU or GU; the cleavage sites divide the RNA sequence into several fragments of no more than 70 nt; according to the determined cleavage sites, several probe sequences are designed, and the probes include a catalytic domain, a first substrate binding arm and a second substrate binding arm, and the nucleotide sequence of the catalytic domain is GGCTAGCTACAACGA, the first substrate binding arm and the second substrate binding arm are respectively located on both sides of the catalytic domain, and respectively bind to the sequences on both sides of the determined cleavage site, and at least one of the first substrate binding arm and the second substrate binding arm has a length greater than 10 nt; after the RNA sequence to be analyzed is cut, the obtained fragments are analyzed using secondary mass spectrometry to identify the RNA sequence or its modification.

[0094] The identification of impurities in the functional region of sgRNA is similar to the identification of sgRNA sequences. The impurity (NX) sequence in the functional region is subjected to primary mass spectrometry and secondary mass spectrometry analysis respectively to obtain the primary mass spectrometry molecular weight. BioPharma Finder will retrieve the impurity molecular weight based on the input functional region sequence, and then obtain a retrieved impurity sequence, and the molecular weight of the impurity sequence is consistent with the actual detected molecular weight of the impurity. Next, BioPharma Finder will calculate the theoretical daughter ion information of the impurity sequence, and match the secondary mass spectrometry daughter ion data of the impurity with the software calculation. If the corresponding daughter ion can be found at each break position, the matching degree of the sequence is 100%, thereby achieving the purpose of identifying the impurity.

[0095] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0096] Technical terms

[0097] In the present invention, sgRNA (single guide RNA) is fused from natural tracrRNA (transactivatingcrRNA) and crRNA (CRISPR RNA), and its 5' includes a 20nt protospacer sequence (functional region), which is complementary to the target DNA sequence to achieve double-stranded cleavage; 3' is a fixed scaffold sequence with a stem-loop structure, which interacts with the positively charged groove of the Cas9 protein to form a ribonucleoprotein complex (RNP).

[0098] The sgRNA of the present invention may include any structural modification or base modification, and the method of the present invention is particularly suitable for quality control of chemically synthesized sgRNA.

[0099] During the synthesis process, a certain number of base deletions may occur in the functional region sequence, thereby affecting the function of the functional region. In the present invention, the functional region with missing bases is referred to as a functional region impurity (NX), where X is the number of missing bases.

[0100] The "LC MS / MS method" in the present invention includes the gradient of LC and the analysis parameters of the primary / secondary mass spectrometry, which is called the Full MS / ddms2 analysis method. The instrument simultaneously performs primary mass spectrometry / secondary mass spectrometry scanning and data acquisition on the two sequences. After the analysis is completed, the primary mass spectrometry data is first analyzed, and the two sequence compositions cut by the enzyme can be clearly obtained through the data analysis. Then the two sequence information obtained in the experiment (including the main sequence and modification) is entered into BioPharmaFinder, and then the secondary mass spectrometry data is mapped to obtain the matching results of the secondary mass spectrometry. Finally, the identification of the full-length target sequence of the entire sgRNA sequence and its modifications is completed based on the matching results of the two sequences.

[0101] The experimental instruments and equipment used in the present invention are shown in the following table:

[0102] Device Name Specifications Equipment No. factory Electrostatic Field Orbital Well Liquid Mass Spectrometry (LC-MS) Q_Exactive RSP2220755 Thermo PCR instrument MiniAmp GR200110670 Thermo Pipette 0.5-10uL L53336J Eppendorf Pipette 20-200uL I33796J Eppendorf

[0103] The experimental reagents and consumables used in the present invention are shown in the following table:

[0104]

[0105] Example 1 Probe synthesis and sgRNA identification

[0106] 1. Synthesis of probe

[0107] The probes and SgRNA were synthesized by a biological company according to the sequences shown in Table 1.

[0108] Table 1 Sequences of sgRNA and probes

[0109]

[0110] The probe sequence is a DNA sequence, consisting of arm I, arm II and an active center sequence. The active center consists of a set of fixed sequences (5'-GGCTAGCTACAACGA-3'), where arm I and arm II specifically bind to the sgRNA partial sequence, and the 3' end of arm I pairs with the pyrimidine at the purine-pyrimidine junction to form a swing arm, thereby forming a catalytic center at the cleavage site. The catalytic center is located at the AU or GU position in the middle of the sgRNA sequence, such as Figure 1 shown.

[0111] 2. sgRNA identification

[0112] (1) Preparation of LC MS mobile phase

[0113] LC MS buffer A: Add 10 mL HFIPA + 500 μL DIEA to 1 L water, mix well and sonicate as mobile phase A.

[0114] LC MS buffer B: Add 10 mL HFIPA + 500 μL DIEA + 200 mL water into 800 mL acetonitrile, mix well and sonicate before using as mobile phase B.

[0115] (2) Annealing

[0116] 1) Prepare annealing mixture

[0117] Mix sgRNA_A, probe, Tris, NaCl and water. The amounts of each reagent are shown in Table 2.

[0118] Table 2 Composition of annealing mixture

[0119] water Make up to 98 μL NaCl (5M), RNase-free 2μL Tris (1M), pH 8.0, RNase-free 5μL SgRNA_A 16μL (1nmol) Probe 40μL (2nmol)

[0120] 2) Annealing

[0121] The annealing mixture in step 1) is annealed according to the procedure shown in Table 3.

[0122] Table 3 Annealing schedule

[0123] Temperature(℃) Time (min) Cooling rate (℃ / min) 95 2 3 75 2 3 60 2 3 55 2 0.5 50 2 0.5 40 2 0.5 22 / 0.5

[0124] 3) Cutting

[0125] After annealing, take out the PCR tube, add 2 μL mM MgCl2 to the annealing mixture after annealing, and react at 37 degrees for 3 hours to obtain a reaction mixture.

[0126] As shown in Figure 2, during the annealing and cutting process, the probe sequence formed a catalytic center at the AU junction of the sgRNA, and under the action of metal ions, the cutting was completed at the AU junction.

[0127] 4) Ultrafiltration

[0128] After the reaction is completed, the reaction mixture in step 3) is placed in a 3K ultrafiltration tube and centrifuged at 15,000 rpm for 12 min to obtain an ultrafiltration membrane supernatant.

[0129] 5) Sample LC MS / MS analysis

[0130] Take out the ultrafiltration membrane supernatant, take 50 μL and add it to the inner insert tube, inject 10 μL into LC MS / MS and perform primary mass spectrometry. The results are as follows Figure 3 shown.

[0131] Depend on Figure 3 From a, we can see that TIC is mainly composed of three peaks. The first peak is the product peak, and the other two are the probe peak and the main sequence that has not been cut. Figure 3b Deconvolution results show that the cleavage product is two complete complementary fragment sequences. According to the molecular weight information, the products can be compared as shown in Table 4.

[0132] Table 4 Cleavage product sequences

[0133]

[0134] Note: m indicates 2'OMe modification, * indicates phosphorothioate modification, r indicates RNA, and P indicates 3' end phosphate (trivalent) modification

[0135] As shown in Table 4, the catalytic center formed when sgRNA_A was captured by the probe cut the connection of AU under the action of metal ions, dividing the complete sequence into two segments.

[0136] 6) Secondary mass spectrometry data analysis

[0137] Two completely complementary sequences, sgRNA_A_5 and sgRNA_A_3, were selected for secondary mass spectrometry data collection. The corresponding parent ions were screened out by the quadrupole, collided with high-purity nitrogen molecules in the collision cell, and the chemical bonds were broken by high-energy collision dissociation (HCD) to obtain c, y, w and AB ions, thereby obtaining the specific daughter ion information of each parent ion, such as Figure 4 and Figure 6 After the secondary mass spectrometry data is collected, the secondary mass spectrometry data is analyzed through the data analysis software, BioPharma Finder. The software will calculate the theoretical daughter ion information based on the information of the target sequence (the target sequence here is sgRNA_A_5 and sgRNA_A_3). Matching it with the actual measured daughter ion information and finding the daughter ion information formed at each break position can prove that the sequence is 100% confirmed. If it is a perfect match, the fragment coverage map will show 1.0 residues, such as Figure 5 and Figure 7 .

[0138] Finally, the full-length sequence of sgRNA_A was analyzed, proving that its full-length target sequence was completely correct, and the various modifications on its bases were also completely correct. The secondary mass spectrometry data of the two sequences cut into pieces were analyzed to achieve the identification of the full-length sequence of sgRNA.

[0139] Example 2 Screening of probe arm length

[0140] 1. Synthesis of probe

[0141] The probes and sgRNA were synthesized by a biological company according to the sequences shown in Table 5.

[0142] Table 5 sgRNA and probe sequences

[0143]

[0144] The above probe sequences 1-5 cut the AU junction of site 49 of sgRNA_A. The first substrate binding arm (also called arm I) and the second substrate binding arm (also called arm II) of these five probes are of different lengths. The specific lengths are shown in Table 5. Probe sequences 6-8 cut the AU junction of site 36 of sgRNA_A. This experiment is used to study the effect of the length of probe arm I and arm II on RNA sequence cutting.

[0145] 2. Identification of sgRNA

[0146] (1) Preparation of LC MS mobile phase

[0147] Same as (1) in step 2 of Example 1.

[0148] (2) Annealing

[0149] Same as (2) in step 2 of Example 1.

[0150] (3) Cutting

[0151] Same as (3) in step 2 of Example 1.

[0152] (4) Ultrafiltration

[0153] Same as (4) in step 2 of Example 1.

[0154] (5) Sample LC MS / MS analysis

[0155] The ultrafiltration membrane supernatant was taken out, 50 μL of the components cut by probes 1-5 were added to the inner insert tube, and 10 μL was injected into the LC MS for primary mass spectrometry analysis. The results are as follows: Figure 8 Take 50ul of the components cut from probe 6-8 and add them to the inner insert tube, inject 10μL into LC MS, and perform primary mass spectrometry analysis. The results are as follows Fig. 9 shown.

[0156] Depend on Figure 8 It can be seen that probes 4 and 5 did not cut, only probes 1, 2 and 3 achieved cutting. The difference between probes 4 and 5 and probes 1, 2 and 3 is the length of arm I and arm II, which is determined by Figure 8 It can be seen that at least one of the arms I and II of the probe must be longer than 10 bases to effectively cut the sgRNA.

[0157] Depend on Fig. 9 It can be seen that probe 6 did not undergo cleavage, while probes 7 and 8 were cleaved at site 36. Therefore, when one of the binding arms is longer than 10 nt, the length of the other binding arm must be greater than 2 nt to achieve cleavage.

[0158] Example 3 Screening of probe sample ratios

[0159] 1. Synthesis of probe

[0160] The probes and sgRNA were synthesized by a biological company according to the sequences shown in Table 6.

[0161] Table 6 sgRNA and probe sequences

[0162]

[0163] 2. Identification of sgRNA

[0164] Similar to step 2 of Example 1, the difference is that the molar ratio of the probe to the sample in the annealing mixture is different, and the probe-sample ratio is set to 1:1; 2:1; 3:1 respectively, and divided into three groups of experiments, as shown in Table 7:

[0165] Table 7 Composition of annealing mixture

[0166]

[0167] Test results such as Fig.10 As shown in the results, the cutting efficiency is between 78% and 86.6%. Considering the cost and efficiency comprehensively, the detection-to-sample ratio of 2:1 is more appropriate, and the cutting efficiency reaches 86.2%.

[0168] Example 4 Screening of metal ion concentration

[0169] Similar to Example 1, except that the magnesium ion concentrations were 20 mM, 50 mM, and 100 mM, respectively, and the experiment was divided into three groups. Fig.11 , Fig.12 As shown in the results, it can be seen that the metal ion has achieved a relatively good cutting efficiency at 20mM and is not accompanied by the appearance of tetravalent phosphate.

[0170] Example 5 Identification of impurities in sgRNA functional regions

[0171] The functional region of sgRNA refers to a sequence of about 20 bases on the 5' side. These 20 bases are completely cut out for analysis. According to the specificity of the probe, cutting is performed at the AU junction at position 36, which is the 36th base starting from the 5' side. The cut sequence includes the functional region sequence, so the impurity identification of the functional region is transformed into the impurity identification of the cut 36 base sequence.

[0172] 1. Probe synthesis

[0173] Same as step 1 in Example 3.

[0174] 2. Identification of sgRNA

[0175] Same as step 2 of Example 1.

[0176] After LC MS / MS analysis, the mapped data is as follows Fig.13 As shown in the figure, the impurities of NX include N-4, N-5, N-6, N-11, and N-15. It can be seen that even if the sample sequence has been purified, there will be some NX impurities. This method can be used to identify impurities in the functional region of sgRNA.

[0177] Due to the limitation of secondary mass spectrometry on the length of sequence fragments, the probes in the embodiments of the present invention are limited in the sites for the identification of the full-length sequence of sgRNA. Only sites 49 and 58 can achieve full-length identification (calculated from the 5-end sequence). For the identification of functional region impurity sequences, site 36 is the best. The complete sgRNA functional region sequence can be cut off, and the functional region can be analyzed for impurities separately. The effect of identifying NX impurity sequences can be achieved by LC MS / MS. Sites 21 or 43 can also achieve similar effects. Sites 49 and 58 (calculated from the 5-end) used for full-length sequence identification can also be used for impurity sequence identification, but it requires mass spectrometry analysis of longer sequence fragments to complete. The cutting site is shown in the figure below. Fig.14 shown.

[0178] Example 6 Sequence Identification of Ultralong Random Sequence RNA

[0179] In addition to having excellent effects on the sequence identification or impurity detection of sgRNA, the method of the present invention also maintains a good effect on ultra-long RNA sequences. Through the design of probes, multiple probes can be combined to form multiple cutting sites, and a 200nt RNA sequence can be cut into four segments of substantially equal size, each of which is no longer than 80nt, and mass spectrometry sequencing is performed separately. In this way, the sequence coverage reaches 100%.

[0180] The specific experimental operation steps are similar to those of Example 1, except that the original one probe sequence is replaced by three probe sequences. The three probe sequences will bind to the 200nt long-chain RNA respectively to form three catalytic centers respectively. Under the action of metal ions, the cleavage function is realized. The 200nt long chain is divided into four parts, and then LC MS / MS analysis is performed in sequence. The sequence coverage reaches 100%. The analysis results are shown in Fig.15 .

[0181] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A probe for sgRNA sequence identification, characterized in that: The probe comprises a catalytic domain, a first substrate binding arm and a second substrate binding arm; The nucleotide sequence of the catalytic domain is GGCTAGCTACAACGA, and its cleavage site is purine-pyrimidine, preferably AU or GU; The first substrate binding arm and the second substrate binding arm are respectively located on both sides of the catalytic domain, and are respectively bound to the sequences on both sides of the sg RNA cleavage site to be analyzed, and at least one of the first substrate binding arm and the second substrate binding arm has a length greater than 10 nt.

2. A probe for identifying sgRNA sequences according to claim 1, characterized in that: The terminal group located at one side of the catalytic domain in the first substrate binding arm or the second substrate binding arm binds to U in the cleavage site.

3. A probe for identifying sgRNA sequences according to claim 1, characterized in that When the length of one of the first substrate binding arm or the second substrate binding arm is greater than 10 nt, the length of the other binding arm must be greater than 2 nt.

4. A probe for identifying sgRNA sequences according to any one of claims 1 to 3, characterized in that: The nucleotide sequence of the sgRNA is as follows: X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCUUUU, wherein X1-X20 are functional regions, and X1-X20 are optionally A\U\G\C.

5. A probe for identifying sgRNA sequences according to claim 4, characterized in that The probe can identify the sequence of the functional region.

6. A probe for identifying sgRNA sequences according to claim 4 or 5, characterized in that: The probe can identify functional region impurity sequences.

7. A probe for identifying sgRNA sequences according to claim 4 or 5, characterized in that: The cleavage sites are GU at site 21, AU at site 36, GU at site 43, AU at site 49, and GU at site 58 of the sgRNA.

8. A probe for identifying sgRNA sequences according to claim 4 or 5, characterized in that: The AU at the cutting site 49 and the GU at the cutting site 58 are used to identify the full-length sequence of the sgRNA.

9. A probe for identifying sgRNA sequences according to claim 6, characterized in that: The cleavage sites 21, 36 and 43 are used for functional region or functional region impurity sequence identification, preferably site 36.

10. A probe for identifying sgRNA sequences according to claim 8, characterized in that: The probe recognizes and cuts the AU at position 49; preferably, the nucleotide sequence of the probe is as shown in SEQ ID NO.2-4; The probe recognizes and cuts the AU at position 36; preferably, the nucleotide sequence of the probe is shown in SEQ ID NO.8-10.

11. A probe for identifying sgRNA sequences according to any one of claims 1 to 10, characterized in that: The probe comprises a modification in the first substrate binding arm or the second substrate binding arm; preferably, comprises a 2'-fluoroarabinose nucleic acid, a 2'-methoxy or locked nucleic acid modification; more preferably, comprises a 2'-methoxy modification.

12. A method for identifying sgRNA sequences, characterized in that: The sgRNA is site-specifically cut using the probe described in any one of claims 1 to 11, and then LC MS / MS mass spectrometry analysis is performed to obtain sgRNA sequence information.

13. A method for identifying sgRNA sequences according to claim 12, characterized in that: The method can identify the sequence of the functional region or the functional region impurity sequence.

14. A method for identifying sgRNA sequences according to claim 12 or 13, characterized in that: The following steps are involved: S1: Combine the probe with sgRNA to obtain a reaction mixture; S2: adding metal ions to the reaction mixture to cut the sgRNA to obtain cut fragments; S3: Analyze and identify the cleavage fragments using LC MS / MS mass spectrometry.

15. A method for identifying sgRNA sequences according to claim 14, characterized in that: Step S1 includes: S11: mixing the probe, sgRNA, annealing buffer and water to obtain an annealing mixture; S12: annealing the annealing mixture to obtain a reaction mixture; Preferably, in step S11, the molar ratio of the probe to the sgRNA is 1-3:1, preferably 2:1; Preferably, in step S11, the annealing buffer comprises Tris and NaCl; Preferably, in step S12, the annealing temperature is 75-40° C., and the annealing time is at least 10 min; Preferably, step S2 comprises: the concentration of the metal ions is 20-100 mM; Preferably, the metal ion is a magnesium ion; Preferably, the cutting temperature is 37°C and the cutting time is at least 3h; Preferably, step S3 comprises: S31: performing primary mass spectrometry detection on the cleaved fragments; screening parent ions according to the signal intensity of the primary mass spectrometry, and breaking the parent ions into daughter ions for secondary mass spectrometry detection; S32: Analyze the obtained primary and secondary mass spectrometry detection data to identify the sgRNA sequence, functional region sequence or functional region impurity sequence.

16. Use of the probe according to any one of claims 1 to 11 in identifying sgRNA sequences.

17. A kit for use in the method according to any one of claims 12 to 15, the kit comprising the probe according to any one of claims 1 to 11; Preferably, the kit further comprises an annealing buffer and metal ions.

18. A method for mass spectrometry analysis of long-chain RNA sequences, comprising the following steps: S1: determining a number of cleavage sites on the RNA sequence to be analyzed, wherein the cleavage sites are purine-pyrimidine, preferably AU or GU; The cleavage site divides the RNA sequence into several fragments not exceeding 80 nt; S2: According to the cleavage site determined in S1, several probe sequences are designed, wherein the probes include a catalytic domain, a first substrate binding arm and a second substrate binding arm; The nucleotide sequence of the catalytic domain is GGCTAGCTACAACGA, The first substrate binding arm and the second substrate binding arm are respectively located on both sides of the catalytic domain, and respectively bind to the sequences on both sides of the cleavage site determined in S1), and at least one of the lengths of the first substrate binding arm and the second substrate binding arm is greater than 10 nt; when one of the lengths of the first substrate binding arm or the second substrate binding arm is greater than 10 nt, the length of the other binding arm must be greater than 2 nt; S3: Use the probe designed in S2 to cut the RNA sequence to be analyzed; S4) analyzing the fragments obtained in S3 using an LC MS / MS method to identify the RNA sequence or its modification; The long-chain RNA sequence has a length of 80-800 nt, preferably 140-500 nt.

19. The method of claim 18, wherein step S3 comprises: S31: combining the probe with the RNA to be analyzed to obtain a reaction mixture; S32: adding metal ions to the reaction mixture to cleave the RNA to obtain cleavage fragments; Features: Step S31 includes: S311: mixing the probe, RNA, annealing buffer and water to obtain an annealing mixture; S312: annealing the annealing mixture to obtain a reaction mixture; Preferably, in step S311, the molar ratio of the probe to the RNA is 1-3:1, preferably 2:1; Preferably, in step S311, the annealing buffer comprises Tris and NaCl; Preferably, in step S312, the annealing temperature is 75-40°C, and the annealing time is at least 10 minutes; and / or Step S32 includes: The concentration of the metal ion is 20-100 mM; Preferably, the metal ion is a magnesium ion; Preferably, the cutting temperature is 37°C and the cutting time is at least 3 hours.

20. The method according to claim 18, step S4 comprises: S41: performing primary mass spectrometry detection on the cleaved fragments; screening parent ions according to the signal intensity of the primary mass spectrometry, and breaking the parent ions into daughter ions for secondary mass spectrometry detection; S42: Analyze the obtained primary and secondary mass spectrometry detection data to identify the RNA sequence or its modification.

21. A kit for use in the method according to any one of claims 18 to 20, the kit comprising the plurality of probes described in step S2; Preferably, the kit further comprises an annealing buffer and metal ions.

Images