Carya illinoensis CiSPL3 gene and application of carya illinoensis CiSPL3 gene in regulation and control of plant flowering time and adversity stress ability

Abstract

The invention discloses a Carya illinoensis CiSPL3 (Carya illinoensis CiSPL3) gene. The nucleotide sequence of the Carya illinoensis CiSPL3 gene is as shown in SEQ ID NO. 1. The CiSPL3 provided by the invention is an important gene which affects the morning and evening of the Carya illinoensis Boney blooming, drought resistance and salt stress resistance, the overexpression of the CiSPL3 gene makes the blooming time of the plant earlier, the drought resistance is enhanced, the sensitivity to salt stress is enhanced, and the identification and application of an SPL gene family are expanded.

Description

Technical Field

[0001] The present invention relates to the application of CiSPL3 gene separated from walnut, and in particular to the application of CiSPL3 gene of walnut in regulating the flowering time and adverse stress of plants, belonging to the technical field of plant genetic engineering. Background Art

[0002] Carya illinoinensis (Wangehn.) K. Koch is a plant of the genus Carya in the Juglandaceae family. It is also known as American pecan, pecan, and longevity fruit. Its nuts are large, thin-shelled, and have a high kernel yield. The kernels are delicious and fragrant, have no astringency, and are rich in nutrients. They are ideal health foods. Carya illinoinensis is also an important woody oil tree species. The oil content of its kernels exceeds 70%, of which the content of unsaturated fatty acids is as high as 97%. It is storable and is a high-quality edible oil. With the development of the economy and the improvement of people's living standards, the demand for carya illinoinensis in the domestic and foreign markets is increasing day by day, and the carya illinoin industry has a huge market prospect. At present, it has been promoted on a large scale in the adapted areas of Jiangsu, Yunnan, Zhejiang, Anhui and other provinces.

[0003] The thin-shelled pecan has a long vegetative growth period, late flowering and fruiting, low early yield, and poor economic benefits, which are the bottlenecks restricting its industrial development. Under ideal conditions, young thin-shelled pecan trees (grafted seedlings) need 4-5 years to bear fruit (yield is only 2.8-3.5 kg / mu), 7-8 years to 10-12.5 kg / mu, and the single-tree yield and economic benefits in the first 10 years are far lower than those of walnuts of the same age. Therefore, in order to improve the early output and benefits of thin-shelled pecan planting and promote the healthy and rapid development of its industry, it is urgent to regulate the balance between vegetative growth and reproductive growth, promote the transformation of vegetative growth into reproductive growth (flowering transformation), start the expression of flowering factors, shorten the fruiting year, promote flower bud differentiation, and increase the amount of fruit. Drought stress is one of the most important abiotic stresses for plants. Drought stress will have a negative impact on the morphology, development, metabolism and various aspects of physiological regulation of plants. A large area of ​​southern China belongs to seasonal drought areas, mainly including Jiangsu, Anhui, Zhejiang, Jiangxi, Hunan, Hubei, Sichuan and other provinces in the Yangtze River Basin. Seasonal droughts in these areas occur frequently and with great intensity, and droughts and heat are basically synchronized, resulting in large evaporation, which seriously affects the physiological metabolism, growth and development, fruit yield and quality of economic trees. During its growth and development, the thin-shelled pecan is easily affected by water deficiency. Therefore, only by meeting its water needs in the introduction area can its normal growth and better fruit yield and quality be guaranteed.

[0004] SPL transcription factors are a plant-specific gene family that is widely present in plants. The SPL gene family is widely involved in regulating plant growth and development and responding to adverse stress. Overexpression of switchgrass SPL7 and SPL8 can promote flowering, and downregulating the expression of SPL7 or SPL8 alone can delay flowering to a certain extent. ZmSPL13 and ZmSPL29 can significantly promote maize flowering, and there is a certain functional redundancy between the two. SPL is a key regulatory factor for plant stress response. The miR156 / SPL module regulates salt tolerance by upregulating MdWRKY100 in apple. The variation of OsSPL10 confers drought tolerance by directly regulating the expression of OsNAC2 and the production of ROS in rice. At present, most of the reported studies on the conservative SPL functions are mainly concentrated in plants such as Arabidopsis and rice. However, in the economic forest tree Carya vesiculata, the study of SPL gene function has not been reported. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a CiSPL3 gene that affects the flowering time and adverse stress resistance of thin-shelled pecan "Boni". CiSPL3 is an important gene that affects the early and late flowering and drought and salt stress resistance of thin-shelled pecan "Boni". Overexpression of the CiSPL3 gene can advance the flowering time of the plant, enhance drought resistance, and enhance sensitivity to salt stress.

[0006] In order to solve the above technical problems, the present invention discloses a CiSPL3 gene of Carya sylvestris, the nucleotide sequence of which is shown in SEQ ID NO.1:

[0007]

[0008] The present invention also provides a protein encoded by the CiSPL3 gene, whose amino acid sequence is shown in SEQ ID NO.2:

[0009]

[0010] Furthermore, the present invention also provides a primer pair for amplifying the above-mentioned CiSPL3 gene, including CiSPL3-F and CiSPL3-R; the nucleotide sequence of the CiSPL3-F is shown in SEQ ID NO.3; the nucleotide sequence of the CiSPL3-R is shown in SEQ ID NO.4.

[0011] At the same time, the recombinant expression vector, expression kit, transgenic strain or recombinant bacteria containing the above-mentioned CiSPL3 gene are also within the protection scope of the present invention.

[0012] The present application also provides a promoter of the CiSPL3 gene of Carya syringae, the sequence of which is shown in SEQ ID NO.9:

[0013]

[0014] CCTACTCTGAATCTATCATTACTATTTTTGAACATACTCGTAAGTAGAAACCCATGA

[0015] AATACATTGAGCAAATGTGGTAGAGAATTAAGTCACAGTAGCGCAGCCGGCCTAT

[0016] AAAGTAAAAATTATTCACGTTACTATTCAGACCCATTGGTATTGTGCTTTTGAAGC

[0017] CAATGGTGATGCTTGCTTTCTACCCGGACCTCACAATTATTCTTACGCTGACAGGG

[0018] GGAAAATGGAGTTGGTGGTCCTCGCATAAGTTCTTCTCCTTTTCCAACTTTCTCGA

[0019] GGTTATTTTTGCCTTCAAAATCCTCTTCACTGCTGCTTGCTAACTCCATCTGTCCCCTTGTCTGTCTACTCTTGTTTTGCCAAA (SEQ ID NO. 9).

[0020] The present application also provides a method for cloning the above promoter, wherein the sequence used for promoter cloning is:

[0021] Upstream primer: TGCCTGCAGGTCGACTCTAGATAAGCATATTGGTACGTGTGCTC;

[0022] Downstream primer: GGACTGACCACCCGGGGATCCTTTGGCAAAACAAGAGTAGACAG.

[0023] In a specific embodiment, the CiSPL3 gene is connected to the PHB vector to obtain a PHB-CiSPL3 overexpression vector, which is then transformed into Escherichia coli DH5α competent cells for amplification and screening to obtain a correctly sequenced PHB-CiSPL3 overexpression vector, which is further transformed into Agrobacterium GV3101 to finally obtain the GV3101-PHB-CiSPL3 engineered bacteria.

[0024] The present invention further proposes the use of the above-mentioned thin-shelled walnut CiSPL3 gene, the protein encoded by the CiSPL3 gene, or a recombinant expression vector, an expression kit, a recombinant bacterium and a transgenic strain containing the CiSPL3 gene, and the above-mentioned promoter in regulating plant flowering time and adverse stress.

[0025] Specifically, the method of regulating plant flowering is to overexpress the vegan pecan CiSPL3 gene in the plant, and the resulting transgenic plants have an earlier flowering time, enhanced resistance to drought stress, and reduced tolerance to salt stress.

[0026] Preferably, the plant is Carya serrata or Arabidopsis thaliana.

[0027] The application process includes the following steps:

[0028] 1) Providing the walnut CiSPL3 gene of claim 1;

[0029] 2) connecting the Carya syringae CiSPL3 gene to a vector to obtain a recombinant vector;

[0030] 3) transferring the recombinant vector into Agrobacterium to obtain recombinant Agrobacterium;

[0031] 4) Infecting plants with the recombinant Agrobacterium to obtain plants overexpressing the Carya elata CiSPL3 gene.

[0032] Beneficial effects: The CiSPL3 provided by the present invention is an important gene that affects the early or late flowering and drought and salt stress resistance of the thin-shelled pecan boni. Overexpression of the CiSPL3 gene advances the flowering time of the plant, enhances drought resistance, and enhances sensitivity to salt stress, thereby expanding the identification and application of the SPL gene family. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Phylogenetic analysis of plant SPL proteins;

[0034] Figure 2 The expression of CiSPL3 gene in different stages of female flower bud differentiation and different tissues of Carya sylvestris;

[0035] Figure 3 Functional analysis of CiSPL3 gene in Arabidopsis, A: Overexpression of CiSPL3 gene in Arabidopsis can significantly advance flowering of plants, B: Analysis of flowering days of CiSPL3 transgenic Arabidopsis and wild-type plants;

[0036] Figure 4 The electrophoresis result of PCR amplification of CiSPL3 gene promoter (primers with restriction enzyme cutting sites);

[0037] Figure 5 Analysis of cis-acting elements in the promoter of CiSPL3 gene;

[0038] Figure 6 To detect the activity of the promoter of CiSPL3 gene in different tissues of Arabidopsis by GUS staining;

[0039] Figure 7 Functional analysis of CiSPL3 gene in Arabidopsis, A: Growth of wild-type and transgenic Arabidopsis seedlings in MS medium containing 300 mM mannitol; B: Root length statistics after seedling germination; C: Plant phenotype after drought treatment;

[0040] Figure 8 Functional analysis of the CiSPL3 gene in Arabidopsis, A: Phenotypic results of wild-type and transgenic Arabidopsis seedlings 15 days after germination in MS medium containing 100mM and 200mM NaCl; B: Root length statistics after seedling germination; C: Phenotypes of wild-type and transgenic Arabidopsis lines 20 days on MS medium containing 100mM NaCl; D: Plant phenotypes under 300mM NaCl treatment. DETAILED DESCRIPTION

[0041] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0042] Example 1 Cloning of CiSPL3 gene.

[0043] Based on the cds sequence of CiSPL3 gene in the pecan genome database, we cloned the CiSPL3 gene using the cDNA of pecan female flower buds as a template.

[0044] Specifically, 7-8 year-old Carya illinoinensis Pawnee female flower buds were collected, and the total RNA of the Carya illinoinensis female flower buds was extracted using the TransZol Up Plus RNAKit kit, and the female flower bud RNA was reverse transcribed into cDNA according to the steps of the PrimeScriptTM RT reagent Kit (Takara) reverse transcription kit. Based on the CDS sequence of the Carya illinoinensis gene published in the Carya illinoinensis Pawnee genome (Carya illinoinensis Pawnee v1.1) on Phytozome 13.0, amplification primers were designed.

[0045] Upstream primer CiSPL3-F (SEQ ID NO. 3): ATGGAAACAGGCAGAGCTGAGGG;

[0046] Downstream primer CiSPL3-R (SEQ ID NO. 4): TCAATGTGAACCTTCTCCATAAG.

[0047] The PCR amplification product was detected by 1% agarose gel electrophoresis and photographed in a gel imaging system. The DNA target band was cut off, and the target fragment was recovered and purified using a gel recovery kit, and connected to the pMD19-T vector to obtain the pMD19-CiSPL3 recombinant vector, which was then transformed into E. coli DH5α competent cells, and the positive clones were picked and sent to the company for sequencing. Among them, the connection reaction of the target gene was carried out on a PCR instrument, and the reaction system was: pMD19-TSimple Vector 0.5μl, DNA fragment 4.5μl, Solution I 5μl. After mixing evenly, put it in a PCR instrument at a temperature of 16°C for about 10 hours or overnight. The transformation steps are: add the full 10μl system to 100μl DH5a E. coli competent cells and place on ice for 30 minutes. 42°C, 2 minutes, and then place on ice for 2-3 minutes (do not shake the centrifuge tube during this period). Take 800μl LB liquid culture medium (without antibiotics) on the clean bench, add it to the competent cell solution, and shake it at 37℃ for about 1 hour. Centrifuge at 37℃, 8000g for 5 minutes to precipitate the bacteria. Discard most of the supernatant on the sterile bench, leaving about 100μl. Use a pipette to blow up and down to suspend the bacteria, and evenly spread it on the LB solid culture medium containing Kan. After sealing with a sealing film, invert the plate in a 37℃ constant temperature incubator and culture overnight until a single colony grows. Pick a single colony and add it to the LB liquid culture medium with Kan, shake it at 37℃, 200rpm, for about 5 hours, use the bacterial solution as a template, perform bacterial solution PCR detection, and if there is a target fragment, send the bacterial solution for sequencing.

[0048] The cloned CiSPL3 gene sequence is 444 bp in length and encodes 147 amino acids. Its base sequence is shown in SEQ

[0049] The amino acid sequence of the expressed protein is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2.

[0050] The relative molecular weight, theoretical isoelectric point and hydrophilicity of CiSPL3 were analyzed using the online website ExPASy (https: / / web.expasy.org / protparam / ). The protein conserved domain was analyzed using the NCBI Conserved Domain Search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) website. The homologous sequences of CiSPL3 protein were searched by BLAST in the NCBI database, and the phylogenetic tree was constructed using MEGA5.0 software.

[0051] According to ExPASy ProtParam online prediction, the molecular weight of CiSPL3 protein is 16.67kD, the theoretical isoelectric point (pI) is 7.05, the instability coefficient is 73.36, the fatty acid amino acid index is 35.24, and the average hydrophilicity (GRAVY) is -1.227, so it is inferred to be an unstable hydrophilic protein. The analysis results of NCBI Conserved Domain Database (CDD) show that the CiSPL3 protein sequence contains an SBP domain between amino acids 63 and 137. The phylogenetic evolutionary tree of SPL3 proteins from different species shows ( Figure 1 ): CiSPL3 and walnut JrSPL3 proteins are on the same small branch and are genetically close to walnut.

[0052] We previously studied the external morphology and anatomical structure of the female flower buds of Hickory nuts, and divided them into five periods: FB1 (beginning of female flower development), FB2 (female inflorescence formation), FB3 (female flower primordium formation), FL1 (early flowering), and FL2 (peak flowering). Then we performed transcriptome sequencing analysis on the female flower buds of Hickory nuts at different differentiation periods. Figure 2 As shown in A, the CiSPL3 gene is mainly highly expressed during the transformation from the stem apical meristem to the floral meristem (undifferentiated stage-early differentiation stage-inflorescence formation stage), that is, the expression is significantly upregulated during the development of the flower bud into the female flower. The CiSPL3 gene is expressed in all tissues of Carya sylvestris, and the expression level in the female flower and fruit is significantly higher than that in other tissues, with the highest expression in the female flower ( Figure 2 B). The CiSPL3 gene provided in this application is expected to be applied to walnuts to regulate the flowering time and stress tolerance of plants.

[0053] Example 2 Construction of CiSPL3 gene overexpression vector.

[0054] Using the pMD19-CiSPL3 recombinant vector as a template, design primers containing restriction sites:

[0055] BamHI (SEQ ID NO.5):

[0056] CTCTCTCTCAAGCTT GGATCC ATGGAAACAGGCAGAGCTGAGGG;

[0057] PstⅠ (SEQ ID NO.6):

[0058] GATCAATTCGAGCTC CTGCAG TCAATGTGAACCTTCTCCATAAG. PCR amplification was performed using kod DNA polymerase (KOD-401, TOYOBO). 20 μl PCR reaction system: 2 μl 10× buffer, 2 μl 2 mM dNTPs, 2 μl DNA template, 1 μl DMSO, 0.8 μl 10 pmol / μl upstream and downstream primers, 0.5 U kod DNA polymerase (KOD-401, TOYOBO) and water was added to make up to 20 μl. PCR amplification program: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 30 s, 50-64℃ annealing for 30 s, 68℃ extension for 1 min / kb, 40 cycles; 68℃ insulation for 8 min. DNA electrophoresis and recovery of target fragments.

[0059] The CiSPL3 fragment and PHB vector (purchased from Shanghai Pujie Biotechnology Co., Ltd.) were double-digested with BamH I and PstⅠ restriction endonucleases, and the digested fragments were recovered and added to the EasyGenoDNA recombination system for connection (#VI201-02, Tiangen Biotechnology). The 10ul recombination system was as follows: 5ul 2×EasyGeno Assembly Mix, 2.5ul digested vector DNA, and 2.5ul fragment DNA. The reaction system was added to a 250ul EP tube, placed in a 50℃ water bath for 30 minutes, and then transformed into Escherichia coli plate. After 16 hours in a 37℃ incubator, the bacteria were picked and sent for sequencing. The positive bacterial solution was selected for sequencing confirmation, and the PHB-CiSPL3 overexpression vector was finally obtained. The PHB-CiSPL3 overexpression vector was transformed into Agrobacterium GV3101, and finally the GV3101-PHB-CiSPL3 engineered bacteria were obtained. Specifically, take the competent state of Agrobacterium stored at -80℃ and place it in the palm of your hand at room temperature for a while until it partially melts, and insert it into ice when it is in an ice-water mixing state. Add 0.1μg (volume not more than 10μl) plasmid DNA for every 100μl competent state, stir the bottom of the tube by hand to mix, and let it stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37℃ water bath for 5 minutes, and ice bath for 5 minutes. Add 700μl LB liquid culture medium without antibiotics, and culture at 28℃, 200rpm shaking for 2-3 hours. Centrifuge at 6000rpm for one minute to collect the bacteria, keep about 100μl of supernatant, gently blow and resuspend the bacteria block, apply it on the LB plate containing 50μg / ml kanamycin, and invert it in a 28℃ incubator for 2-3 days. Randomly select a single colony, do colony PCR, identify the correct Agrobacterium monoclone, and mark it for use.

[0060] Example 3 Functional identification of transgenic Arabidopsis thaliana.

[0061] The GV3101-PHB-CiSPL3 engineered bacteria obtained in Example 3 were used to infect wild-type Arabidopsis thaliana by the inflorescence infection method to obtain T0 generation transgenic seeds 35S:CiSPL3.

[0062] The steps of inflorescence infection are as follows: first, wild-type Arabidopsis seeds are sterilized with 5% sodium hypochlorite solution for 8 minutes, rinsed with sterile water 5 times, and the sterilized seeds are spread on a plate containing MS culture medium, vernalized in a refrigerator at 4°C for 2-3 days, and placed in an artificial climate chamber to start germination and growth. 7-12 days after germination, the seedlings with strong and uniform growth are selected and transplanted into the culture soil soaked with Huawuque compound fertilizer in advance, and the plastic wrap is covered on it, and removed after the seedlings are alive.

[0063] Water the plants that are currently flowering one day in advance, turn the small pot upside down, and place all the inflorescences in the pre-suspended bacterial solution for about 30 seconds. Repeat the transformation once 7 days later. After 2-3 weeks, water as little nutrient solution as possible to accelerate aging. Collect the mature seeds in a paper bag and put them in a desiccator for 7 days.

[0064] The T0 generation transgenic seeds were screened for resistant plants (30μg / ml HYG) using hygromycin resistance, and PCR was used to identify positive plants. After the positive plants obtained T1 seeds, the same method was used until the T3 generation stably inherited transgenic plants were obtained. Three CiSPL3 transgenic lines were taken, and they were named OE1, OE3 and OE10. Wild-type Arabidopsis and 35S:CiSPL3 transgenic T3 seeds were directly sown in the nutrient matrix (peat soil and vermiculite mixed in a ratio of 2:1) and cultured under normal conditions (16h light / 8h dark, temperature 22°C, light intensity of 150μmol / m 2 ·s) and observe the bolting and flowering time of each plant.

[0065] The results are as follows Figure 3 As shown, compared with the wild-type Arabidopsis, the flowering time of the three Arabidopsis transgenic lines (OE1, OE3 and OE10) was significantly advanced, about 5 days, indicating that overexpression of CiSPL3 has the function of promoting plant flowering.

[0066] Example 4 GUS staining to detect the activity of the promoter of the CiSPL3 gene in different tissues of Arabidopsis thaliana.

[0067] (I) Cloning of the promoter of CiSPL3 gene:

[0068] The DNA of the thin-shelled pecan "Boni" was used as a template, and the following primer sequences were used:

[0069] Upstream primer (with XbaI restriction site, SEQ ID NO.7):

[0070] TGCCTGCAGGTCGACTCTAGATAAGCATATTGGTACGTGTGCTC;

[0071] Downstream primer (with BamHI restriction site, SEQ ID NO.8):

[0072] GGACTGACCACCCGGGGATCCTTTGGCAAAACAAGAGTAGACAG;

[0073] The sequence of the 1500-2000 bp region upstream of the start codon (ATG) of the CiSPL3 gene was amplified as a promoter, and a 1994 bp sequence of CiSPL was amplified, such as Figure 4 The promoter sequence is shown in SEQ ID NO. 9. The obtained sequence was sequenced and compared with the genomic data of Carya serrata, and it was found that they were all the expected promoter sequences.

[0074] The promoter sequence of CiSPL3 gene was analyzed using the online program PlantCARE, e.g. Figure 5 As shown, the promoter sequence of CiSPL3 contains 18 functionally annotated cis-acting elements, including ABRE, LTR, ARE, CGTCA-motif, RY-element, TGA-element, TGACG-motif, CAT-box, TCT-motif, MBS, and TC-rich repeats, among which 5 cis-acting elements related to light response are Box 4, G-box, I-box, G-Box, and TCT-motif, which are widely present in the promoters of plant genes. 9 cis-acting elements with other functions, 5 abscisic acid response-related elements (ABRE), 4 MeJA hormone response elements (CGTCA-motif, TGACG-motif), 1 auxin response element (TGA-element), 1 low temperature response element (LTR), 2 drought-induced elements (MBS), 1 defense and stress response cis-acting element (TC-rich repeats), 1 zein metabolism regulatory element (O2-site), 3 anaerobic-inducible regulatory elements (ARE), 1 seed-specific regulatory element (RY-element), and 1 meristem expression regulation-related element (CAT-box).

[0075] The P1300GN vector was selected to construct a GUS fusion expression vector (CiSPL3Pro::GUS recombinant expression vector) of the CiSPL3 gene promoter of Pecan, and the constructed CiSPL3Pro::GUS recombinant expression vector was transformed into Arabidopsis using the Agrobacterium-mediated inflorescence infiltration method. The seeds of the T0 generation were sown on a resistant medium, and two weeks later, T1 transgenic seedlings with hygromycin resistance were obtained. The wild-type Arabidopsis and CiSPL3Pro::GUS transgenic strain T1 seeds were sown in nutrient pots. When the plants grew to about 35 days, the leaves, roots, stem segments, flowers, and fruit pods were taken for histochemical staining. The results showed that the staining in the roots was very deep and the expression was relatively strong. The leaves were also stained, but the color was lighter than that in the roots. The staining in the stems was very light, and the staining in the flower buds and petals was very deep. There was also staining in the fruit pods ( Figure 6 ).

[0076] Example 5 Phenotypic observation and root length measurement of Arabidopsis seedlings under drought stress.

[0077] The sterilized wild-type and transgenic Arabidopsis T3 seeds were sown on MS plates and MS+300mM mannitol plates, vernalized for 2 days at 4℃ in the dark, and then placed vertically in a growth chamber at 23℃ with 16h of light and 8h of darkness. The root length was measured after 15 days. Figure 7 (A and B) In mannitol-containing medium, the root length of CiSPL3 gene OE3 seedlings was still significantly longer than that of wild-type Arabidopsis.

[0078] Arabidopsis wild-type and transgenic potted seedlings (35S:CiSPL3 transgenic plants) that had been grown for 5 weeks under normal watering were subjected to drought treatment for 15 days, and their morphological characteristics were observed. Figure 7 As shown in Figure C, under drought conditions, the wild-type control showed obvious wilting and withering 15 days after stress. Although the transgenic lines also showed wilting due to water loss, the symptoms were much lighter than those of the control, and they could continue to bolt and bloom. Three days after watering was restored, most of the transgenic lines began to revive, while most of the wild-type lines still withered. Therefore, overexpression of the CiSPL3 gene improves the tolerance of Arabidopsis plants to drought stress.

[0079] Example 6 Phenotypic observation and root length measurement of Arabidopsis thaliana under salt stress.

[0080] Wild-type and transgenic Arabidopsis T3 seeds were sterilized and placed on MS, MS+100mM NaCl, and MS+200mM NaCl culture media, respectively. The culture dishes were placed vertically and vernalized at 4°C for 2 days. They were then cultured normally in a light incubator. After 15 days, the root length was counted and photographed. Figure 8 As shown in A and 8B, in salt stress medium, the root length of Arabidopsis seedlings transgenic for CiSPL3 was significantly shorter than that of the wild-type control.

[0081] After the transgenic lines and wild-type (WT) Arabidopsis were grown on a medium containing NaCl (100 mM) for 20 days, 76.2%, 78.6%, and 52.4% of the three transgenic lines, respectively, became completely bleached and died, while the wild-type had a survival rate of more than 80% ( Figure 8 C).

[0082] The wild-type and transgenic Arabidopsis plants that had been grown for 5 weeks under normal watering were watered with 300 mM NaCl solution every three days for four times. After 15 days of salt stress treatment, the transgenic and wild-type plants showed significantly different traits. The leaves of the transgenic plants gradually withered and died, and the wild-type plants also showed varying degrees of yellowing, but were better than the transgenic plants ( Figure 8D). In summary, overexpression of the CiSPL3 gene significantly reduced the tolerance of transgenic plants to salt stress.

[0083] The present invention provides a CiSPL3 gene and its application ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A thin-shelled pecan gene, characterized in that: Said CiSPL3 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The protein encoded by the CiSPL3 gene according to claim 1, whose amino acid sequence is shown in SEQ ID NO.

2.

3. A method for amplifying the method according to claim 1 CiSPL3 A primer pair for a gene, characterized in that CiSPL3 -F and CiSPL3 -R; CiSPL3 -F's nucleotide sequence is shown in SEQ ID NO.3; CiSPL3 The nucleotide sequence of -R is shown in SEQ ID NO.

4.

4. Containing the composition according to claim 1 CiSPL3 Recombinant expression vector, expression kit, transgenic strain or recombinant bacteria of the gene.

5. A thin-shell pecan CiSPL3 A promoter of a gene, characterized in that Its sequence is shown in SEQ ID NO.

8.

6. The promoter cloning method according to claim 5, characterized in that: The sequence used for the promoter cloning is: Upstream primer: TGCCTGCAGGTCGACTCTAGATAAGCATATTGGTACGTGTGCTC; Downstream primer: GGACTGACCACCCGGGGATCCTTTGGCAAAACAAGAGTAGACAG.

7. The thin-shelled pecan according to claim 1 CiSPL3 Use of the gene or the protein encoded by the CiSPL3 gene according to claim 2, or the recombinant expression vector, expression kit, transgenic strain or recombinant bacteria according to claim 4, or the promoter according to claim 5 in regulating plant flowering time and adverse stress.

8. The use according to claim 5, characterized in that: The flowering regulating plant is to use Carya nutans CiSPL3 The gene is overexpressed in plants, and the resulting transgenic plants have an earlier flowering time, increased resistance to drought stress, and reduced tolerance to salt stress.

9. The use according to claim 5, characterized in that: The plant is Carya serrata or Arabidopsis thaliana.

10. The use according to claim 5, characterized in that: The steps include: (1) Providing the thin-shell pecan nuts as described in claim 1 CiSPL3 Gene; (2) The thin-shell pecan CiSPL3 The gene and the vector are connected to obtain a recombinant vector; (3) transferring the recombinant vector into Agrobacterium to obtain recombinant Agrobacterium; (4) Infecting plants with the recombinant Agrobacterium to obtain plants that overexpress Carya sylvestris CiSPL3 Genetic plants.

Images