Gene LOCOs12g36880 for regulating and controlling chalkiness of rice seeds and application of gene LOCOs12g36880

Abstract

The invention discloses a gene LOCOs12g36880 for regulating and controlling chalkiness of rice seeds and application of the gene LOCOs12g36880. The nucleotide sequence of the LOCOs12g36880 gene is shown as SEQ ID NO.1, the chalkiness of rice seeds is influenced, and the chalkiness of the seeds of a LOCOs12g36880 gene knockout strain is improved. Therefore, the invention provides application of overexpression of the LOCOs12g36880 gene in the aspect of reducing chalkiness of rice seeds.

Description

Technical field:

[0001] The invention belongs to the field of rice breeding and relates to a gene LOC_Os12g36880 for regulating rice seed chalkiness and an application thereof. Background technology:

[0002] Chalkiness is the white opaque part of the endosperm that is not filled tightly due to insufficient grain filling. It directly affects the appearance quality, cooking and eating quality, processing quality and market value of rice seeds. Reducing chalkiness can meet the increasing demand for high-quality rice and is an important breeding goal for genetic improvement of high-quality rice.

[0003] Chalkiness includes the percentage of grain with chalkiness (PGWC) and the degree of endosperm chalkiness (DEC). It is a typical quantitative trait that is affected by both genetic and environmental factors, which makes the genetic study of chalkiness challenging. Although genes controlling chalkiness have been discovered one after another, the chalkiness index of most rice cultivars is still high. Therefore, the genetic improvement of rice chalkiness has important scientific value and production guidance significance.

[0004] In view of this, the present invention is proposed. Summary of the invention:

[0005] The purpose of the present invention is to provide the function of the LOC_Os12g36880 gene in regulating seed chalkiness, and to provide technical support for improving seed chalkiness using the LOC_Os12g36880 gene.

[0006] The first object of the present invention is to provide a LOC_Os12g36880 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides the use of the LOC_Os12g36880 gene in regulating seed chalkiness.

[0008] Preferably, the knockout of LOC_Os12g36880 gene is used to increase the chalkiness of rice seeds.

[0009] The second object of the present invention is to provide a method for improving rice seed chalkiness, which is to knock out the LOC_Os12g36880 gene in rice.

[0010] Preferably, the knockout target of the LOC_Os12g36880 gene in the knockout rice is: ATTGCGGTCGAGGGGAACGG.

[0011] The third object of the present invention is to provide the application of LOC_Os12g36880 gene in rice breeding.

[0012] Preferably, the application in rice breeding is application in seed chalkiness improvement.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] (1) The present invention provides the function of LOC_Os12g36880 gene in regulating seed chalkiness. We have demonstrated through transgenic technology that LOC_Os12g36880 gene can regulate seed chalkiness.

[0015] (2) Although some chalky genes have been reported, few of them have been actually used to improve rice chalkiness. After the LOC_Os12g36880 gene was knocked out in the present invention, the chalkiness of rice increased significantly. Therefore, the application of overexpression of the LOC_Os12g36880 gene in reducing rice chalkiness is provided. Description of the drawings:

[0016] Figure 1 :Knockout targets and detection results of LOC_Os12g36880 gene. ZH11 is the control material, pbz1-1 and pbz1-2 are gene knockout strains.

[0017] Figure 2 :The function of LOC_Os12g36880 gene in regulating the chalky grain rate and chalkiness of seeds. One-sided t-test was used for statistical comparison, * indicates a significant difference of p < 0.05 in t-test, ** indicates a significant difference of p < 0.01 in t-test. Specific implementation method:

[0018] The following examples are provided to further illustrate the present invention, but not to limit the present invention. Specific experimental conditions and methods are not specified in the following examples, and the technical means adopted are conventional means well known to those skilled in the art.

[0019] Example 1: Construction of LOC_Os12g36880 knockout strain

[0020] The nucleotide sequence of the LOC_Os12g36880 gene is shown in SEQ ID NO.1. We designed the gene knockout target as: ATTGCGGTCGAGGGGAACGG. The transgenic vector was constructed with reference to the publicly published CRISPR / Cas9 system (Xingliang, Ma. "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants." Molecular Plant 8.8 (2015): 1274-1284.). The constructed knockout vector was transformed into Agrobacterium BGK03, and then the Agrobacterium was used to infect and transform the callus tissue of ZH11, and the obtained transgenic strain was separated by breeding. Primers (5'-GCTACAGGCATCAGTGGTC A-3', 5'-GTGTGACTTGAGCTTCCCCA-3') were used to detect gene editing, and the sequence of the control material ZH11 was compared to obtain the transgenic lines with homozygous knockout of the LOC_Os12g36880 gene. The two knockout lines were pbz1-1 and pbz1-2. pbz1-1 had a 6bp deletion at the target site, and pbz1-2 had a 1bp insertion at the target site ( Figure 1 ).

[0021] Example 2: Effect of LOC_Os12g36880 gene on chalky grain rate and chalkiness of rice seeds

[0022] After harvesting mature seeds of ZH11 and knockout lines (pbz1-1 and pbz1-2) and drying them naturally, the rice was husked by a rice husker (JLG-III, Sinograin) to obtain brown rice, which was then ground into polished rice using a small experimental whitening machine (NA-JCB, Beijing Jinbiao Guoan). The chalkiness rate and chalkiness of the polished rice were tested using a rice appearance quality tester (SC-E, Hangzhou). Figure 2 The results show that the chalky particle rate and chalkiness of pbz1-1 increased by 150% and 200% respectively compared with ZH11, and the chalky particle rate and chalkiness of pbz1-2 increased by 167% and 245% respectively compared with ZH11.

[0023] The gene sequence of LOC_Os12g36880 is as follows (SEQ ID NO.1):

[0024] ATGGCTCCGGCCTGCGTCTCCGACGAGCACGCCGTCGCGGTGTCGGCGGAGCGGCTTGTGGAAGGC

[0025] GTTCATGGACGCGTCCACTTTGCCCAAGGCCTGCGCCGGCTTGGTCGACGACATTGCGGTCGAGGG

[0026] GAACGGTGGTCCGGGCACCATCTACACCATGAAGCTTAACCCTGCCGCGGGTGTGGGAAGCACATA

[0027] CAAGACCCGGGTGGCGGTGTGCGACGCCGCAAGTCATGTCCTAAAAGTCGGATGTGCTCGAGGCAG

[0028] AAAGCAAGGTGGGGAAGCTCAAGTCACACTCGACGGAGACGAAGCTTGAGGCCACCGGCGATGG

[0029] CTCCTGTGTGGCCAAGCTCAAGGTGGAGTACGAGCTCGAGGACGGCAGCTCACTGTCGCCGGAGA

[0030] AGGAGAAGGACATCGTGGATGGCTACTATGGCATGCTCAAGATGATCGAGGACTACCTCGTCGCTC

[0031] ACCCTGCCGAATACGCCTAA.

Claims

1. A gene LOC_Os12g36880 that regulates rice seed chalkiness, characterized in that: The nucleotide sequence of the LOC_Os12g36880 gene is shown in SEQ ID NO.

1.

2. Application of LOC_Os12g36880 gene in regulating chalkiness of rice seeds, the nucleotide sequence of the LOC_Os12g36880 gene is shown in SEQ ID NO.

1.

3. The use according to claim 2, characterized in that: The invention relates to an application of knocking out the LOC_Os12g36880 gene to increase the chalkiness of rice seeds; or an application of over-expressing the LOC_Os12g36880 gene to reduce the chalkiness of rice seeds.

4. A method for improving the chalkiness of rice seeds, characterized in that: The LOC_Os12g36880 gene of claim 1 is knocked out in rice.

5. The method according to claim 4, characterized in that The knockout target of the LOC_Os12g36880 gene in the knockout rice is: ATTGCGGTCGAGGGGAACGG.

6. Application of LOC_Os12g36880 gene in rice breeding, the nucleotide sequence of the LOC_Os12g36880 gene is shown in SEQ ID NO.

1.

7. The use according to claim 6, characterized in that: The application in rice breeding is the application in improving seed chalkiness.

Images