Medicine for treating obesity and preparation method thereof

Abstract

The invention belongs to the field of pharmaceutical preparations, and particularly relates to a medicine for treating obesity. The active ingredient of the medicine is virus particles secreted by mammalian cells, and the cells are transfected with a recombinant vector with a sequence as shown in SEQ ID NO.1. According to the invention, point mutation glucagon receptor genes of birds and human beings are constructed into an adeno-associated virus vector, and cells are transfected by using the recombinant adeno-associated virus vector, so that a secretory gland-associated virus is used as a medicinal component. In human subcutaneous adipose tissues, the adeno-associated viruses can express point mutation glucagon receptors of birds or human beings, so that fat metabolism is promoted, and obesity treatment is realized.

Description

Technical Field

[0001] The invention belongs to the field of pharmaceutical preparations, and in particular relates to a drug for treating obesity and a preparation method thereof. Background Art

[0002] Obesity is a systemic endocrine metabolic disease. Clinically, a body mass index (BMI) > 24 is considered an obese patient. The root cause of obesity is the imbalance between energy intake and output, which leads to excessive accumulation of fat in the body. Various factors such as genes, endocrine, physiological, nutritional and social environment can cause energy imbalance. Obesity not only affects body shape and activity, but is also closely related to hyperlipidemia, atherosclerosis, hypertension, coronary heart disease, diabetes, mental illness, etc. Obesity has become one of the most important public health problems in the world.

[0003] There are many treatments for obesity, such as reducing the size of the stomach and the amount of food intake through bariatric surgery, thereby achieving the effect of weight loss. However, bariatric surgery has the risk of serious surgical and metabolic complications, and the surgery is very expensive. Currently, there are 5 kinds of weight loss drugs used in clinical practice, including orlistat capsules, lorcaserin, phentermine and topiramate (qsymia) sustained-release capsules, as well as naltrexone hydrochloride, bupropion hydrochloride compound sustained-release tablets (contrave) and liraglutide injection. These 5 drugs have serious adverse reactions such as gastrointestinal or cardiovascular complications, as well as safety issues such as mood changes and suicide. Appetite control and satiety are also the core mechanisms of action of anti-obesity drugs. They can suppress appetite and induce satiety through norepinephrine stimulation, release dopamine, and reduce weight, but are often accompanied by side effects such as nausea, headache, constipation, dizziness, vomiting and dry mouth. The adverse reactions of the drugs currently used in clinical practice limit their long-term use in anti-obesity drugs. The number of obese people is increasing day by day, but the development of anti-obesity drugs is far from meeting clinical needs. Discovering more effective and safer anti-obesity drugs has great clinical value and urgency. Summary of the invention

[0004] To solve the above problems, the present invention provides a recombinant vector, which is a vector connected with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2; the vector is an adeno-associated virus expression vector.

[0005] Furthermore, the adeno-associated virus expression vector includes plasmid H10881pAAV-CAG-EGFP-3xFLAG-tWPA.

[0006] The present invention also provides a recombinant cell, which is a mammalian cell transfected with the above-mentioned recombinant vector.

[0007] Furthermore, the mammalian cells include AAV-293 cells.

[0008] The present invention also provides a drug for treating obesity, which is a preparation prepared by taking the virus particles expressed and secreted by the above-mentioned recombinant cells as active ingredients and adding pharmaceutically acceptable auxiliary materials.

[0009] Furthermore, the preparation is an injection.

[0010] Furthermore, the injection is a powder injection or a solution for injection.

[0011] The present invention also provides a method for preparing the above-mentioned medicine, which comprises the following steps:

[0012] 1) Taking the gene fragment shown in the nucleotide sequence SEQ ID NO.1 or SEQ ID NO.2, introducing it into an adeno-associated virus expression vector to obtain a recombinant vector;

[0013] 2) Take the recombinant vector in step 1) and co-transfect mammalian cells with the adeno-associated virus packaging plasmid, lyse the transfected cells, collect the lysate, centrifuge, and take the supernatant.

[0014] Furthermore, in step 1), the adeno-associated virus expression vector is plasmid H10881pAAV-CAG-EGFP-3xFLAG-tWPA; in step 2), the adeno-associated virus packaging plasmid is plasmid pHelper and plasmid pAAV-RC; and the mammalian cell is AAV-293 cell.

[0015] Finally, the present invention provides a use of the above-mentioned drug in preparing a drug for treating obesity.

[0016] The present invention has shown through experimental studies that: bird GCGR has constitutive activity, that is, it continuously activates downstream signals in the absence of ligands, while mammalian (mouse) wild-type GCGR does not have constitutive activity. In addition, bird GCGR is expressed at high levels in subcutaneous adipose tissue, and the transcription level is similar to that of liver tissue, while mammalian (mouse) GCGR is not expressed in subcutaneous adipose tissue. At the same time, by screening the single nucleotide polymorphism SNP library of human GCGR, a point mutation was found at position 339, in which histidine (H) was replaced by arginine (R) (H339R). In vitro, hsGCGR H339R The mutations exhibit weak constitutive activity. They will express avian GCGR and human GCGR respectively. H339R The virus particles act on the liver and adipose tissue, and can regulate lipid metabolism.

[0017] The present invention is a drug for treating obesity, which is obtained by respectively modifying the avian glucagon receptor gene GCGR and the human GCGR H339R , constructed into an adeno-associated virus vector, and the cells transfected with the recombinant adeno-associated virus vector secrete adeno-associated virus as the active ingredient, which can express avian glucagon receptor and human GCGR in the subcutaneous fat tissue of the human body respectively. H339R , promoting the body's fat metabolism to achieve obesity treatment, and has practical promotion and application value.

[0018] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0019] The above contents of the present invention are further described in detail below through specific implementation modes in the form of embodiments, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 :Constitutive activity of GCGR in different species on the Gs pathway.

[0021] Figure 2 : Detection of constitutive activity of GCGR on Gs, β-arrestin and Gq pathways (A: Gs; B: β-arrestin; C, D: Gq).

[0022] Figure 3 : Activation of the Gs(A) and β-arrestin(B) pathways downstream of GCGR by the endogenous ligand GCG.

[0023] Figure 4 :Effects of constitutively active GCGR on the body weight of DIO mice (A Schematic diagram of the experimental process; B Detection of the expression of the exogenous gene ggGCGR transferred by AAV in the subcutaneous adipose tissue of mice; C Body weight monitoring of mice);

[0024] Figure 5 :Effects of constitutively active GCGR on subcutaneous adipose tissue of DIO mice (A subcutaneous adipose tissue marker genes; B lipid synthesis and lipid degradation; C beige; D proliferation and differentiation-related genes);

[0025] Figure 6 :Effects of constitutively active GCGR on blood glucose and lipid metabolism in DIO mice (A Expression of endogenous GCGR (mmGCGR) and exogenous GCGR (ggGCGR) in liver tissue of mice; B Blood glucose of mice; C Changes in free fatty acid concentration in serum);

[0026] Figure 7 :Effects of the natural human point mutation GCGRH339R on the body weight and downstream genes of DIO mice (A-CGCGRH339R constitutive activity detection, D experimental flow chart; E mouse weight monitoring; F mouse blood glucose monitoring; G AAV-transferred exogenous gene GCGR in subcutaneous adipose tissue of mice H339R Expression detection of; H mouse lipid synthesis and lipid decomposition; I thermogenesis and beige related genes);

[0027] Figure 8 :Effects of constitutively active GCGR on body weight of DIO mice (A Schematic diagram of experimental flow; B Detection of expression of exogenous gene (GCGR) transferred by AAV in subcutaneous adipose tissue of mice; C Body weight monitoring of mice);

[0028] Fig. 9 :Effects of constitutively active GCGR on subcutaneous adipose tissue of DIO mice (A subcutaneous adipose tissue marker genes; B lipid synthesis and lipid degradation; C beige; D proliferation and differentiation-related genes);

[0029] Fig.10 :Effects of constitutively active GCGR on blood glucose and lipid metabolism in DIO mice (A Expression of endogenous GCGR (mmGCGR) and exogenous GCGR (ggGCGR) in liver tissue of mice; B Blood glucose of mice; C Changes in free fatty acid concentration in serum);

[0030] Fig.11 :H10881 pAAV-CAG-EGFP-3xFLAG-tWPA vector map;

[0031] Fig.12 :pAAV-CAG-GCGR-V5 tag-tWPA vector map. DETAILED DESCRIPTION

[0032] The raw materials and equipment used in the specific implementation of the present invention are all known products, which are obtained by purchasing commercially available products. Among them, the nucleotide sequence of the bird GCGR (ggGCGR) gene is SEQ ID NO: 1

[0033] atgtcccagccacgtctcctcaccctgctggtactgctgctctgctgccagggtccttctgcccagatcacggataacgttgtggagagatggaaggagtacag

[0034] cgaggagtgccagcgcaacatgagccgcctgcccgcgcccacagagctcgtctgtaaccgcaccttcgacaagttctcctgctggcccgacacgatgccca

[0035] acagcacagccagtgtgccctgcccctggttcctgccctggtaccagaaagtgaagaacagacacgtcttcaagacctgtgggccagacggacagtgggtg

[0036] acaggcccgcggggacagtccctgcgcgatgccacacagtgtgagcaggatgacgaggacctaaaggcacaggaaaaatttgccaagacctatggcagct

[0037] tcaaggtgatgtacactgtgggctactctgtgtccctgtgtgcgctgctgcttgccctggccctgctgctgggcttcagcaagctgcactgcatgaggaactacat

[0038] ccacatgaacctcttcgcctccttcatcctgaagggcgtctccgtgctggtcatcgacgccctgctcaaaacccactacagcgacaagatcgacggctacaac

[0039] gtgcaagtgtggctgagtgacgaggcagctgcaggctgccgggcagccacggtcttcatgcagtacggcatcgtggccaactactgctggctgctggtgga

[0040] aggcatctacctgcacaacctgctggtggtggccgtcttctccgagaggagctacttcaccctctacctgtgcatcggctggggggcacccatgctcttcctcat

[0041] tccctgggtcattgtgaagttcctctacgaaaacatacagtgctggtccacgaacaacaacatgggcttctggtggattcttcgcttccccgtgttcctggccatcc

[0042] tgatcaacttcttcatcttcatccgcatcattcagatccttgtttccaagctccgtgcacaccagatgcgctacactgactacaagttcaggctggccaggtccacg

[0043] ctgacgctcatcccgctgctgggcatccacgaggtggtctttgccttcatcacggacgagcacgcccagggcaccctgcgctacgtcaagctcttcttcgacct

[0044] cttcctgagctccttccagggtttgctggtggccattctctactgcttcgtcaacaaggaggtgcaggcagagctgctgaagcggtggcagcgctggaagctgg

[0045] ggaaggacctggctgaggagtacaagcacacctacagccacgcacccagtgcccgcaatggcgctggcagcacctgcgagaagcaccagctggtgagc

[0046] ggctgcaccaacgggctggggcgcagcctggccccccaggccggctcccagcgcctggagaggagcgggcgcagcactgccgagcacctcgccctgg

[0047] ggggccatcaccactgctatgagtttcctgagaccacggccgagagccacttc

[0048] Human natural point mutation GCGR (hsGCGR H339R

[0049] 1. Construction of recombinant plasmid

[0050] The ggGCGR represented by the nucleotide sequence SEQ ID NO: 1 was introduced into the vector plasmid H10881pAAV-CAG-EGFP-3xFLAG-tWPA ( Fig.11 ) and cloned into H21259pAAV-CAG-GCGR-V5 tag-tWPA ( Fig.12 ).

[0051] 2. Cell transfection

[0052] 1) Take AAV-293 cells with a confluence of 70-80%, remove the original cell culture medium, and add 10 ml of Opti-MEM medium;

[0053] 2) Dissolve 32 μg of the viral vector plasmid to be transfected (pHelper: pAAV-RC: recombinant plasmid pAAV-CAG-GCGR = 2:1:1) in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 minutes;

[0054] 3) Dissolve Obio transfection reagent in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 minutes;

[0055] 4) Add the Obio transfection reagent dilution obtained in step 3) dropwise to the plasmid dilution obtained in step 2), gently mix while adding, and place at room temperature for 20 minutes to obtain a stable transfection complex;

[0056] 5) taking the transfection complex obtained in step 4), adding it to the cell culture plate obtained in step 1), and changing the medium after transfection;

[0057] 6) After 6 hours, aspirate the culture medium, wash once with PBS, and add 10 ml of fresh complete culture medium for culture.

[0058] 3. Virus Harvest and Purification

[0059] 1) 60 hours after transfection, scrape the cells with a cell scraper and collect them into a centrifuge tube;

[0060] 2) Centrifuge at 1500g for 5 min at 4°C and resuspend the cell pellet in 7 ml of 10 mM Tris-HCl buffer;

[0061] 3) Take the cell lysate and freeze-thaw it repeatedly in a dry ice / ethanol bath and a 37°C water bath for 8 times;

[0062] 4) Use 10mM Tris-HCl to adjust the lysate volume to 21ml;

[0063] 5) Ultrasound for 7 minutes;

[0064] 6) Add 2 ml DNase I (3 mg / ml) and incubate at 37°C for 30 min;

[0065] 7) Ultrasound again for 7 minutes;

[0066] 8) Add 2.5 ml 10% sodium deoxycholate and 2.1 ml 0.25% trypsin-EDTA, mix well, incubate at 37°C for 30 min, and place on ice for 20 min;

[0067] 9) Add 16.9 g CsCl. Mix well and incubate at 37°C for 20 min, shaking in between until the CsCl is completely dissolved.

[0068] 10) Centrifuge at 3000 g for 30 min at 4°C and carefully transfer the cell lysate to an ultracentrifuge tube (about 5 ml / tube);

[0069] 11) Centrifuge at 4°C and 53,000 rpm for 30 h, take out the virus particles after centrifugation, and add acceptable excipients in the drug to prepare an injection solution.

[0070] Example 2 Preparation of drugs for treating obesity

[0071] hsGCGR shown in nucleotide sequence SEQ ID NO: 2 H339R Gene transfer plasmid H10881pAAV-CAG-EGFP-3xFLAG-tWPA ( Fig.11 ) and cloned into H21259pAAV-CAG-GCGR-V5 tag-tWPA ( Fig.12 ). The rest is the same as in Example 1.

[0072] The beneficial effects of the present invention are further illustrated by test examples below.

[0073] Experimental Example 1 Study on Gene Drugs for the Treatment of Obesity

[0074] 1. Construction of plasmid vector

[0075] The geneID numbers and specific CDS sequences of GCGR genes of different species were downloaded from NBCI, including Homo sapiens, Phascolarctoscinereus, Monodelphis domestica, Vombatus ursinus, Gallus gallus, Camarhynchus parvulus, Falco cherrug, Neopelma chrysocephalum, Xenopus tropicalis, Nanoranaparkeri, Danio rerio, Paramormyrops kingsleyae, etc. The GCGR genes of the corresponding species were synthesized and inserted into the pcDNA3.1 vector to construct the GCGR expression plasmids of each species. (The GCGR expression plasmids of each species involved in the experiment were prepared by General Biotechnology (Anhui) Co., Ltd.).

[0076] 2. In vitro expression verification of GCGR vector

[0077] (1) GCGR protein expression determination

[0078] First, the luciferase reporter gene system (CRE luciferase activity) was used to detect the activation of the glucagon receptor gene GCGR in different species on the Gs signaling pathway. The specific steps were as follows: one day before transfection (12-18 hours), approximately 2×10 4 Cell quantity: Well-growing HEK293 cells were inoculated into 96-well plates for culture. When the cell density of each well reached 80%, GCGR plasmids of different species were transfected using Lipofectamine2000 (provided by Thermofisher). Cells were collected 36-48 hours after transfection, and the cells were fully lysed on a microplate oscillator after adding cell lysis buffer. The supernatant was aspirated and added with luciferase reagent, and the relative luminescence units were measured by a multifunctional microplate reader.

[0079] Then, the GCGR plasmids of different species were transfected in vitro in increasing amounts, and the accumulation of downstream signals was detected as the amount of plasmid transfection increased. It was detected that there were differences in the in vitro expression levels of the GCGR plasmids encoding different species. Glucagon receptors with similar expression ranges were sorted together for comparison, and it was found that except for placental mammals, the receptors of other species (fish, amphibians, reptiles, birds, and non-placental mammals) all showed constitutive activity, that is, in the absence of exogenous ligand stimulation, the receptor-coupled Gs signal increased with the increase in receptor expression ( Figure 1 ).

[0080] Three species of receptors, human (hsGCGR), chicken (ggGCGR) and bearded dragon (pvGCGR), were selected for G q The constitutive activity of the NFAT-RE luciferase activity and HTRF ratio) and β-arrestin (Tango luciferase activity) pathways was detected. The results showed that: (1) ggGCGR and pvGCGR constitutively activated G s and β-arrestin pathways, but has no constitutive activity on the Gq pathway; (2) hsGCGR has no constitutive activity on the three pathways ( Figure 2 AC). G was stained with HTRF-IP1 kit. q The activation of the pathway was verified and it was found that the receptor could not induce G q Downstream IP1 accumulation ( Figure 2 D).

[0081] The endogenous ligand GCG of different species (human, chicken and bearded dragon) was synthesized to explore whether the downstream pathway can be further activated by the ligand. The results showed that the constitutively active ggGCGR and pvGCGR, the downstream coupled G s and β-arrestin pathways can be further activated by their respective endogenous ligands GCG; whereas for hsGCGR, which does not have constitutive activity, the endogenous ligand GCG can activate downstream G s pathway, but does not activate the β-arrestin pathway ( Figure 3 ).

[0082] Although ggGCGR and pvGCGR have the same mechanism of action on the detected signal pathway, ggGCGR showed a higher intensity of signal pathway. Therefore, ggGCGR was subsequently selected to construct a recombinant vector, transfect cells to prepare AAV-GCGR, and conduct obesity effectiveness experiments.

[0083] 3. Preparation and detection of AAV-GCGR

[0084] 3.1. Prepare plasmid

[0085] Vector H10881 was selected, the exogenous gene (ggGCGR) sequence was synthesized, and cloned into H21259pAAV-CAG-GCGR-V5 tag-tWPA. The constructed viral vector (pAAV-CAG-GCGR), pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) plasmids were subjected to large-scale extraction.

[0086] 3.2. AAV-293 cell culture

[0087] 3.2.1 AAV-293 cell recovery

[0088] 1) Preheat the culture medium;

[0089] 2) Take out the cell cryopreservation tube from the liquid nitrogen tank, quickly put it into a water bath filled with 37°C water, shake it from time to time, thaw it as soon as possible, wipe it with 70% alcohol for disinfection, and move it to the clean bench;

[0090] 3) Aspirate the cell suspension and add it to 3 ml of culture medium, then add 5 ml of culture medium to dilute and gently blow it away;

[0091] 4) Centrifuge at 1000 rpm for 3 min to collect cells;

[0092] 5) Resuspend the cells in appropriate amount of culture medium for inoculation;

[0093] 3.2.2 AAV-293 cell passage (using a 10 cm dish as an example)

[0094] 1) Discard the old culture medium, add 10 ml of sterile PBS, shake gently to wash the cell growth surface, and then discard the PBS;

[0095] 2) Add 1 ml of trypsin digestion solution and digest for 1 to 2 minutes until the cells become round and begin to fall off;

[0096] 3) Add 2 ml of complete medium to terminate digestion and beat the cells at the bottom of the dish into single cells;

[0097] 4) Centrifuge and resuspend as needed for counting and inoculation, or mix the cells and directly transfer them to a new culture bottle for further culture;

[0098] 3.2.3 Cryopreservation of AAV-293 cells

[0099] 1) Take the cells that have been growing vigorously for 2 to 3 days, digest them according to the subculture procedure and beat them into single cells;

[0100] 2) Centrifuge at 1000 rpm for 3 min to collect cells;

[0101] 3) Add appropriate amount of PBS to resuspend the cells and count;

[0102] 4) Centrifuge at 1000 rpm for 3 min to collect cells;

[0103] 5) Resuspend the cells to 2×10 6 -5×10 6 / ml, and then dispense the cell suspension into 2ml cryovials, 1ml / tube;

[0104] 6) Place the vial in a programmed cooling box and freeze the box at -80°C overnight. The next day, transfer the vial containing the frozen cells to liquid nitrogen for long-term storage.

[0105] 3.3. Cell transfection

[0106] 1) Inoculate AAV-293 cells in a 10 cm dish and use for transfection 48 hours later. The confluence should reach 70-80% during transfection.

[0107] 2) 1 hour before transfection, take out the cell culture plate, remove the original cell culture medium, and add 10 ml of Opti-MEM medium;

[0108] 3) preparing a complex of a transfection reagent and a plasmid;

[0109] a. Dissolve 32 μg of the viral vector plasmid to be transfected (pHelper: pAAV-RC: recombinant plasmid pAAV-CAG-GCGR = 2:1:1) in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 min;

[0110] b. Dissolve Obio transfection reagent in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 minutes;

[0111] c. Add the Obio transfection reagent dilution obtained in step b dropwise to the plasmid dilution obtained in step a, gently mix while adding, and place at room temperature for 20 minutes to allow the DNA and Obio transfection reagent to fully combine to form a stable transfection complex;

[0112] 4) Take out the cell dish, add the prepared DNA-transfection reagent complex to the cell culture plate in step 2), and change the medium after transfection;

[0113] 5) After 6 hours, the culture medium was removed, the cells were washed once with PBS, and 10 ml of fresh complete culture medium was added for culture; 3.4. Virus harvesting and purification

[0114] 1) 60 hours after transfection, scrape the cells with a cell scraper and collect them into a centrifuge tube;

[0115] 2) Centrifuge at 1500g for 5 min at 4°C and resuspend the cell pellet in 7 ml of 10 mM Tris-HCl buffer;

[0116] 3) Take the cell lysate and freeze-thaw it repeatedly in a dry ice / ethanol bath and a 37°C water bath for 8 times;

[0117] 4) Use 10mM Tris-HCl to adjust the lysate volume to 21ml;

[0118] 5) Ultrasound for 7 minutes;

[0119] 6) Add 2 ml DNase I (3 mg / ml) and incubate at 37°C for 30 min;

[0120] 7) Ultrasound again for 7 minutes;

[0121] 8) Add 2.5 ml 10% sodium deoxycholate and 2.1 ml 0.25% trypsin-EDTA, mix well, incubate at 37°C for 30 min, and place on ice for 20 min;

[0122] 9) Add 16.9 g CsCl, mix well, and incubate at 37°C for 20 min, shaking in between, until the CsCl is completely dissolved;

[0123] 10) Centrifuge at 3000 g for 30 min at 4°C and carefully transfer the cell lysate to an ultracentrifuge tube (about 5 ml / tube);

[0124] 11) Centrifuge at 53,000 rpm at 4°C for 30 h;

[0125] Titer determination

[0126] The current method for determining AAV titer is to measure the number of AAV viral particles by detecting the number of genomic copies of the AAV vector in the genome through quantitative PCR;

[0127] 1) Prepare samples and standards, and gradient dilute the standard plasmid and the sample to be tested to 10 of the original concentration. -5 , 10 -6 , 10 -7 , 10 -8 Second-rate;

[0128] 2) Calculate the total reaction tube volume based on the number of reactions (X) (make two replicate wells for each gradient and prepare one more well for every 10 reactions);

[0129] 3) Add 15 μl of reaction solution to each reaction well, and then add 5 μl of template;

[0130] 4) On the machine, set the annealing temperature to 60°C, obtain the Ct value according to standard operation and calculate the copy number in the AAV sample. (The virus titer is 1×10 13 VG);

[0131] 4. Experimental study on the effectiveness of AAV-GCGR obesity treatment drugs in mice under the same dietary conditions

[0132] In this experiment, the AAV-GCGR virus particles prepared under "3. Preparation and detection of AAV-GCGR" were used as the active ingredient to infect subcutaneous adipose tissue, and the virus particles prepared using the AAV-null vector in the same manner as under "3. Preparation and detection of AAV-GCGR" were used as the blank control.

[0133] Subcutaneous fat tissue infection was performed as follows: the mice were anesthetized with sodium pentobarbital. After complete anesthesia, the mice were laid flat and the area where the subcutaneous fat tissue was located was wiped and disinfected with 70% ethanol. The skin slightly above the hind legs was lifted with forceps, and AAV (1×10 11 VG / 40μl PBS). The subcutaneous fat tissues of both sides were injected in the same way, so the infection dose for each mouse was 2×10 11 VG.

[0134] Constitutively active GCGR was expressed in the subcutaneous adipose tissue and liver tissue of obese mice fed with high-fat diet, and the effect on lipid metabolism of mice was detected: the experimental mice were C57 / B6J male mice aged 14 weeks that were fed with 60% high-fat diet for 8 weeks. The experimental design was divided into 4 groups, with 6 mice in each group. Groups 1 and 3 were infected with virus particles prepared with control vector (AAV-null), and groups 2 and 4 were infected with constitutively active GCGR (AAV-GCGR); groups 1 and 2 were injected into the tail vein tissue, and groups 3 and 4 were injected in situ into subcutaneous fat. After infection, the 4 groups of mice continued to be fed with 60% high-fat diet, and the diet was changed every two days. The weight of the mice and the food intake of each group of mice were detected at the same time every day, and the feeding continued for 4 weeks. After 4 weeks, the mice were killed for sampling. The free fatty acid (FFA) content detection kit of Solarbio was used to measure the FFA of mice. The adipose tissue of mice was taken, RNA was extracted, and after conversion into cDNA, real-time quantitative (Real-time) PCR was used to observe the lipid metabolism regulation of mice.

[0135] The specific experiment also includes: 6-week-old C57 / BL6J male mice were selected and fed with 60% high-fat diet for 8 weeks. After that, the mice were divided into two groups for in situ injection of AAV subcutaneous fat tissue. One group was the avian constitutively active GCGR (ggGCGR) overexpression group (AAV-GCGR), and the other group was the control group (AAV-null). After that, the mice continued to be fed with 60% high-fat diet for 4 weeks, and the weight of the mice was monitored every day. Finally, the blood glucose, free fatty acids, and the expression of lipid metabolism-related genes in subcutaneous fat and liver tissues of the mice were detected after sampling ( Figure 4 ).

[0136] In the previous experiments, a single nucleotide polymorphism (SNP) library of human GCGR was screened and a point mutation was found at position 339, in which histidine (H) was replaced by arginine (R) (H339R). Therefore, human GCGR prepared in the same way as the viral particles of ggGCGR was H339R The virus particles were used to evaluate the effectiveness of obesity treatment experiments. Specifically, 6-week-old C57 / BL6J male mice were selected and fed with a 60% high-fat diet for 20 weeks. The mice were then divided into two groups: a group that received AAV subcutaneous adipose tissue in situ injection alone, and a group that received AAV subcutaneous adipose tissue in situ injection and tail vein injection at the same time. In each experiment, one group was human weak constitutively active GCGR (hsGCGR H339R ) overexpression group (AAV-hsGCGR H339R ), and the other group was the control group (AAV-null). The mice were then fed a 60% high-fat diet for 4 weeks, and their body weight was monitored every day. Finally, blood glucose, free fatty acids, and the expression of lipid metabolism-related genes in subcutaneous fat and liver tissues were measured. Figure 7 ).

[0137] The results are as follows: Compared with the control group (AAV-null) mice, the experimental group (AAV-GCGR) mice (1) had exogenous constitutively active GCGR (ggGCGR) expression in subcutaneous adipose tissue ( Figure 4 B); (2) Body weight decreased after AAV injection, returned to initial weight after two weeks, and then the weight gain trend weakened ( Figure 4 C); (3) The expression of subcutaneous adipose tissue marker genes (Pparg, Cebpα and Adiponectin), lipid synthesis genes (Fasn and Acc) and lipid degradation genes (Atgl, Hsl and Lpl) were all downregulated ( Figure 5 A and 5B); (4) The expression of Ucp1 gene associated with adipocyte beige was significantly upregulated ( Figure 5 C); (5) The expression of Pdgfrα, a marker gene of preadipocytes, and Skp2, a gene related to adipocyte proliferation, was upregulated, while the expression of genes related to adipocyte differentiation (Car3 and Dlk1) was downregulated ( Figure 5 D). Thus, we believe that constitutively active GCGR promotes adipocyte proliferation and beigeness, inhibits adipocyte differentiation, and suppresses lipid metabolism in subcutaneous adipose tissue.

[0138] Based on the above results, it can be seen that the lipid metabolism function of the subcutaneous adipose tissue of the experimental group (AAV-GCGR) mice is blocked, so it is considered whether the lipid metabolism function in the liver will be enhanced. No expression of exogenous GCGR (ggGCGR) was detected in the liver of the experimental group mice, but the expression of endogenous GCGR (mmGCGR) in mice was found to be reduced ( Figure 6A). At the same time, the blood glucose level of the experimental group mice was significantly lower than that of the control group (AAV-null) mice ( Figure 6 B). The free fatty acid concentration in the serum of the experimental group mice was higher ( Figure 6 C).

[0139] In vitro, hsGCGR H339R Mutations exhibiting weaker constitutive activity ( Figure 7 AC).hsGCGR H339R High level overexpression in iWAT ( Figure 7 DG), and observed a 2-3% reduction in body weight compared with the AAV-null control group without affecting blood glucose ( Figure 7 E, G). We further detected the expression of lipid metabolism-related genes in the adipose tissue of mice and found that the expression of lipid decomposition genes Atgl, Lpl, and Hsl in the fat of the experimental group mice was significantly upregulated ( Figure 7 H), and the expression of heat-related genes was also significantly upregulated ( Figure 7 I).

[0140] In summary, the expression of constitutively active GCGR in subcutaneous adipose tissue of mice inhibits lipid metabolism in subcutaneous adipose tissue and promotes the proliferation and beigeization of adipocytes.

[0141] 5. Experimental evaluation of the effectiveness of AAV-GCGR obesity treatment drugs in mice under different dietary conditions

[0142] The above experimental design is to detect the effect of constitutively active GCGR expression in the adipose tissue of high-fat induced obese mice on mouse lipid metabolism. The simulation is to inhibit the weight gain of obese mice without changing the diet. Then, combined with the literature that GCG can promote the enhancement of liver lipid decomposition, consider if the dietary conditions are changed in the later stage and high-fat feeding is no longer carried out, whether the expression of constitutively active GCGR in the adipose tissue of high-fat induced obese mice will show different changes in the effect on mouse lipid metabolism-related genes compared with the previous experiment.

[0143] To this end, 6-week-old C57 / BL6J male mice were selected and fed with a 60% high-fat diet for 8 weeks. The mice were then divided into two groups for in situ injection of AAV into subcutaneous adipose tissue. One group was an avian constitutively active GCGR (ggGCGR) overexpression group (AAV-GCGR), and the other group was a control group (AAV-null). The mice were then fed with ordinary feed for 4 weeks, and their body weight was monitored every day. Finally, samples were collected to detect blood glucose, free fatty acids, and the expression of lipid metabolism-related genes in subcutaneous adipose and liver tissues ( Figure 8A). Compared with the control group (AAV-null) mice, the experimental group (AAV-GCGR) mice (1) expressed exogenous constitutively active GCGR in the subcutaneous adipose tissue ( Figure 8 B); (2) The trend of weight loss is more obvious ( Figure 8 C).

[0144] Detection of genes related to lipid metabolism in subcutaneous adipose tissue revealed that compared with the control group (AAV-null) mice, the expression of subcutaneous adipose tissue marker genes (Pparg, Cebpα and Adiponectin), lipid synthesis genes (Fasn, Acc and Acot7) and lipid degradation genes (Atgl, Hsl and Lpl) in the experimental group (AAV-GCGR) mice (1) were downregulated ( Fig. 9 A and 9B); (2) The expression of Ucp1 gene associated with adipocyte beige was significantly upregulated ( Fig. 9 C); (3) The expression of adipocyte proliferation-related gene Skp2 was upregulated, while the expression of adipocyte differentiation-related genes (Car3 and Dlk1) was downregulated ( Fig. 9 D). Therefore, it is believed that constitutively active GCGR promotes adipocyte proliferation and beige, inhibits adipocyte differentiation, and inhibits lipid metabolism in subcutaneous adipose tissue. Overall, the results are similar to those of the previous group of mice.

[0145] Similarly, it is believed that the lipid metabolism function of the subcutaneous adipose tissue of the experimental group (AAV-GCGR) mice is blocked, so the changes in lipid metabolism-related genes in the liver were detected. Unlike the previous experimental mice, we did not detect the expression of exogenous GCGR (ggGCGR) in the liver of the experimental group mice, but found that the expression of mouse endogenous GCGR (mmGCGR) increased ( Fig.10 A). However, the blood glucose level of the experimental group mice was significantly lower than that of the control group (AAV-null) mice ( Fig.10 B). In addition, the concentration of free fatty acids in the serum of mice in the experimental group was higher ( Fig.10 C), which are similar to the results of the previous experimental mice. In summary, the expression of constitutively active GCGR in subcutaneous adipose tissue of mice inhibits lipid metabolism in subcutaneous adipose tissue and promotes the proliferation and beigeization of adipocytes.

[0146] In summary, the present invention has shown through experimental studies that the natural point mutation H339R of bird GCGR and human GCGR has constitutive activity, that is, it can continuously activate downstream signals in the absence of ligand, while mammalian (mouse) GCGR does not have constitutive activity. In addition, bird GCGR is highly expressed in subcutaneous adipose tissue, and the transcription level is similar to that of liver tissue, while mammalian (mouse) GCGR is not expressed in subcutaneous adipose tissue. Therefore, the expression of bird GCG and human natural point mutation gene GCGRH339R The virus particles act on adipose tissue and can regulate lipid metabolism. The present invention combines the avian glucagon receptor gene GCGR with the human natural point mutation gene GCGR H339R It is constructed into an adeno-associated virus vector, and the cells transfected with the recombinant adeno-associated virus vector secrete adeno-associated virus as the active ingredient. It can express the glucagon receptor of birds and humans with natural point mutation genes (H339R) in the subcutaneous white fat tissue of the human body, promote lipid metabolism and heat production (beige) in white fat to achieve obesity treatment, and has practical value for promotion and application.

Claims

1. A recombinant vector, characterized in that: It is a vector connected with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2; the vector is an adeno-associated virus expression vector.

2. The recombinant vector according to claim 1, characterized in that The adeno-associated virus expression vector is plasmid H10881 pAAV-CAG-EGFP-3xFLAG-tWPA.

3. A recombinant cell, characterized in that: It is a mammalian cell transfected with the recombinant vector according to claim 1.

4. The recombinant cell according to claim 3, characterized in that The mammalian cells include AAV-293 cells.

5. A drug for treating obesity, characterized in that: The preparation is prepared by taking the virus particles expressed and secreted by the recombinant cells as claimed in claim 3 as active ingredients and adding pharmaceutically acceptable excipients.

6. The drug according to claim 5, characterized in that The preparation is an injection.

7. The drug according to claim 6, characterized in that The injection is a powder injection or a solution for injection.

8. A method for preparing the drug according to any one of claims 5 to 7, characterized in that: It includes the following steps: 1) Taking the gene fragment shown in the nucleotide sequence SEQ ID NO.1 or SEQ ID NO.2, introducing it into an adeno-associated virus expression vector to obtain a recombinant vector; 2) Take the recombinant vector in step 1) and co-transfect mammalian cells with the adeno-associated virus packaging plasmid, lyse the transfected cells, collect the lysate, centrifuge, and take the supernatant.

9. The method according to claim 8, characterized in that In step 1), the adeno-associated virus expression vector is plasmid H10881 pAAV-CAG-EGFP-3xFLAG-tWPA; in step 2), the adeno-associated virus packaging plasmid is plasmid pHelper and plasmid pAAV-RC; and the mammalian cell is AAV-293 cell.

10. Use of the drug according to any one of claims 5 to 7 in the preparation of a drug for treating obesity.

Images