Methylation gene related to lung cancer and detection kit thereof

Abstract

The invention relates to a methylation gene related to lung cancer and a detection kit thereof, in particular to a methylation gene related to lung cancer and a detection kit thereof, and the gene comprises HOXA7, HOXA9, SCT and SHOX2. The detection kit comprises a reagent for detecting the HOXA7 gene, primers as shown in sequences numbered 1-1 and 1-2, and probes as shown in sequences numbered 1-3; the reagent for detecting the HOXA9 gene contains primers as shown in sequences numbered 2-1 and 2-2 and probes as shown in sequences numbered 2-3; the reagent for detecting the SCT contains primers as shown in sequences numbered 3-1 and 3-2 and probes as shown in sequences numbered 3-3; the primers are as shown in the sequences numbered 3-4 and 3-5, and the probes are as shown in the sequences numbered 3-6; the reagent for detecting the SHOX2 gene contains primers as shown in sequences numbered 4-1 and 4-2 and a probe as shown in a sequence numbered 4-3.

Description

[0001] This invention application is a divisional application based on an invention patent application with an application date of July 30, 2019, application number 201910697653.2, and name “A methylation gene related to lung cancer and its detection kit”. Technical Field

[0002] The invention relates to a reagent for detecting genes, in particular to a methylation gene related to lung cancer and a detection kit thereof. Background Art

[0003] Pulmonary nodules are small focal, round-like shadows with increased density on imaging. They can be single or multiple, without atelectasis, hilar enlargement, or pleural effusion. There are many causes of pulmonary nodules, which are basically divided into two categories: benign nodules and malignant nodules. Benign nodules include benign tumors, tuberculosis, sarcoidosis, or inflammatory nodules. Malignant nodules include lung cancer and metastatic tumors. The occurrence of lung cancer goes through a series of stages, including hyperplasia, atypical hyperplasia, carcinoma in situ, and invasive cancer. The pattern is that it develops slowly at first, and then increases rapidly after reaching a certain stage.

[0004] Among malignant pulmonary nodules, lung cancer is one of the most common malignant tumors in my country. According to the latest cancer data in China released by the National Cancer Center in February 2017, lung cancer ranks first in both incidence and mortality rates (the mortality rate of lung cancer in large, medium and small cities is between 40% and 54%), which is about twice the double rate of the second-ranked cancer. The high mortality rate ranks first among cancers in 2017.

[0005] For lung cancer, early diagnosis and early treatment are the most effective ways to improve prognosis. If treated early, patients with early-stage lung cancer can expect a higher 5-year survival rate. Currently, the overall 5-year survival rate of stage I lung cancer can reach 80%. However, compared with patients with early-stage lung cancer, the clinical outcomes of patients with advanced lung cancer are much worse. Even for stage IV lung cancer patients, the overall 5-year survival rate is only about 10%. Therefore, the key to the diagnosis and treatment of lung nodules is to effectively differentiate lung nodules, quickly determine whether they are benign or malignant, remove malignant nodules as soon as possible, and avoid unnecessary overtreatment.

[0006] In recent years, the progress of lung cancer epigenetic research has far-reaching significance for the early diagnosis and treatment of lung cancer. There is evidence that hypermethylation of the CpG island of the promoter of tumor suppressor genes is an important mechanism of gene inactivation. The transcriptional inactivation of different genes will affect the cell cycle, DNA repair, apoptosis, etc., and is closely related to the occurrence and development of cancer. Gene methylation refers to the process in which cytosine (C) in the CpG dinucleoside on the DNA molecule selectively adds methyl groups to form 5'-methylcytosine under the action of enzymes. In lung cancer patients, CpG island methylation in the promoter region of genes is a relatively common phenomenon. Clinically, it is believed that the detection of methylated gene markers in tissue cells and body fluids (such as sputum, serum and plasma) of lung cancer patients is an effective auxiliary detection method for lung cancer, which has the value of improving the detection rate of lung cancer. Studies have shown that DNA methylation can be detected in the sputum of patients 3 years before the diagnosis of lung cancer. If it is combined with cytopathological detection, it can greatly improve the efficiency of lung cancer diagnosis, shorten the detection cycle, and improve the accuracy of diagnosis.

[0007] Methylation gene markers are of great significance in the identification of benign and malignant pulmonary nodules and the diagnosis of lung cancer. The methylation gene markers related to lung cancer that have been reported so far still have the defects of low sensitivity (35.5%) and low specificity (73%), which limits their application in clinical detection. Here, we need to briefly introduce the relevant knowledge: the high sensitivity of methylation gene markers for one or some cancers indicates that the missed diagnosis rate of the corresponding cancer is low; similarly, its high specificity indicates that the misdiagnosis rate of the corresponding cancer is low. Therefore, it can be seen that the sensitivity and specificity of methylation gene marker detection are two important indicators to measure its reference value. In summary, further in-depth research on methylation gene markers, finding highly sensitive and highly specific methylation genes related to lung cancer and their combined detection reagents, so as to provide more effective means for the accuracy and good prognosis of the identification of benign and malignant pulmonary nodules or the diagnosis of lung cancer, is an urgent problem to be solved in the current methylation gene marker detection technology. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a methylation gene related to lung cancer and a detection kit thereof, which can provide valuable reference information for the differentiation of benign and malignant lung nodules or the diagnosis of lung cancer through its high sensitivity and high specificity.

[0009] In order to solve the above technical problems, the present invention provides a methylation gene associated with lung cancer, including one or more of HOXA7, HOXA9, SCT and SHOX2 genes, whose nucleotide sequences are shown in sequence 1, sequence 2, sequence 3 and sequence 4 in the sequence table; wherein the methylated cytosine sites of genes HOXA7, HOXA9, SCT and SHOX2 are marked in sequence 1, sequence 2, sequence 3 and sequence 4 in sequence.

[0010] In order to solve the above technical problems, the present invention provides a detection kit for the gene as described above, which is used to detect the methylated gene in the sample to be tested, comprising one or more of the following reagents:

[0011] A reagent for detecting the HOXA7 gene, comprising primers shown in sequences numbered 1-1 and 1-2 and a probe shown in sequences numbered 1-3;

[0012] A reagent for detecting the HOXA9 gene, comprising primers shown in sequences No. 2-1 and 2-2 and a probe shown in sequence No. 2-3;

[0013] A reagent for detecting the SCT gene, comprising the primers shown in the sequences numbered 3-1 and 3-2 and the probe shown in the sequence numbered 3-3; comprising the primers shown in the sequences numbered 3-4 and 3-5 and the probe shown in the sequence numbered 3-6;

[0014] The reagent for detecting the SHOX2 gene comprises the primers shown in the sequences of No. 4-1 and 4-2 and the probe shown in the sequence of No. 4-3.

[0015] Preferably, the detection kit also includes ACTB primers and probes for internal reference gene detection.

[0016] Preferably, the sample to be tested includes one or more of human blood, alveolar lavage fluid, alveolar washing fluid, sputum and lung tissue samples, and further includes bronchial brushing samples.

[0017] Preferably, the primer sets corresponding to HOXA7, HOXA9, SCT and SHOX2 genes are respectively composed of primers and probes contained in their respective reagents, and the concentrations of the components in the PCR reaction solution are: 0.2 μM primer set corresponding to the gene, 0.6 μM ACTB primer and probe, 3.5 mM MgCl2, 0.25 mM dNTP; in addition, it also contains 100 U of DNA polymerase, DNA extracted after counting of non-small cell HCC827 cell line for positive control, and sterile water for negative control.

[0018] Preferably, any two of the reagents in the detection kit are combined, or any three of the reagents are combined, or any four of the reagents are combined to form a combination kit.

[0019] Preferably, the primer sets corresponding to HOXA7, HOXA9, SCT and SHOX2 genes are respectively composed of primers and probes contained in their respective reagents, and the concentrations of the components in the PCR reaction solution are as follows: the primer sets corresponding to the genes in the combination are all set to 0.2 μM, 0.6 μM ACTB primers and probes, 3.5 mM MgCl2, 0.25 mM dNTP; in addition, it also contains 100 U of DNA polymerase, DNA extracted after counting of the non-small cell HCC827 cell line for positive control, and sterile water for negative control.

[0020] In order to solve the above technical problems, the present invention provides a method for obtaining the above-mentioned gene, comprising:

[0021] Whole genome methylation array analysis was performed on the samples to be tested, and 159 candidate genes related to the differentiation of benign and malignant pulmonary nodules or lung cancer were screened out;

[0022] Target genes HOXA7, HOXA9, SCT, and SHOX2 were selected from the candidate genes, and corresponding primers and probes were designed for the methylated DNA-specific fragments of the target genes. The designed primers and probes were respectively equivalent to, complementary to, or hybridized to at least 15 consecutive nucleotides or their complementary sequences in sequences 1-4 in the sequence table, and the performance indicators of the target genes that met the detection requirements were obtained and verified.

[0023] Preferably, the performance indicators of the target gene mentioned in the method include: sensitivity, specificity and the area under the receiver operating characteristic curve (AUC) value.

[0024] Preferably, the sample to be tested mentioned in the method comprises one or more of human blood, alveolar lavage fluid, alveolar washing fluid, sputum, lung tissue and bronchial brushing samples.

[0025] The present invention provides a methylation gene related to lung cancer and a detection kit thereof. Since the reagents in the kit include one or more corresponding primer sets of four methylation gene markers, namely, HOXA7, HOXA9, SCT and SHOX2, a whole genome methylation array analysis is performed on the detection sample, and a methylation gene marker with a special site is selected from 159 candidate genes. The sensitivity and specificity are high, which are not possessed by the existing methylation gene detection. Moreover, different combinations of the four methylation markers can further improve the sensitivity and specificity, thereby providing valuable reference information for the differentiation of benign and malignant lung nodules and the accuracy of lung cancer diagnosis and good prognosis.

[0026] Specifically, the present invention relates to the following:

[0027] 1. A methylation gene associated with lung cancer, comprising one or more of genes HOXA7, HOXA9, SCT and SHOX2, whose nucleotide sequences are shown in sequence 1, sequence 2, sequence 3 and sequence 4 in the sequence table; characterized in that the methylated cytosine sites of the genes HOXA7, HOXA9, SCT and SHOX2 are marked in sequence 1, sequence 2, sequence 3 and sequence 4 in sequence.

[0028] 2. A detection kit for the gene as described in item 1, used for detecting methylated genes in a sample to be tested, comprising one or more of the following reagents:

[0029] A reagent for detecting the HOXA7 gene, comprising primers shown in sequences numbered 1-1 and 1-2 and a probe shown in sequences numbered 1-3;

[0030] A reagent for detecting the HOXA9 gene, comprising primers shown in sequences No. 2-1 and 2-2 and a probe shown in sequence No. 2-3;

[0031] A reagent for detecting the SCT gene, comprising the primers shown in the sequences numbered 3-1 and 3-2 and the probe shown in the sequence numbered 3-3; comprising the primers shown in the sequences numbered 3-4 and 3-5 and the probe shown in the sequence numbered 3-6;

[0032] The reagent for detecting the SHOX2 gene comprises the primers shown in the sequences of No. 4-1 and 4-2 and the probe shown in the sequence of No. 4-3.

[0033] 3. The detection kit according to item 2 is characterized in that it also includes ACTB primers and probes for internal reference gene detection.

[0034] 4. According to the detection kit described in item 3, the sample to be tested comprises one or more of human blood, alveolar lavage fluid, alveolar washing fluid, sputum and lung tissue samples, characterized in that the sample to be tested also comprises a bronchial brushing sample.

[0035] 5. The detection kit according to item 3 or 4 is characterized in that the primer sets corresponding to the HOXA7, HOXA9, SCT and SHOX2 genes are respectively composed of primers and probes contained in their respective reagents, and the concentrations of the components in the PCR reaction solution are: 0.2μM primer set corresponding to the gene, 0.6μM ACTB primer and probe, 3.5mM MgCl2, 0.25mM dNTP; in addition, it also contains 100U of DNA polymerase, DNA extracted after counting of the non-small cell HCC827 cell line for positive control, and sterile water for negative control.

[0036] 6. The kit according to any one of items 2, 3 and 4, characterized in that any two of the reagents are combined, or any three of the reagents are combined, or any four of the reagents are combined to form a combination kit.

[0037] 7. The combination kit according to item 6 is characterized in that the primer sets corresponding to the HOXA7, HOXA9, SCT and SHOX2 genes are respectively composed of primers and probes contained in their respective detection reagents, and the concentrations of the components in the PCR reaction solution are as follows: the primer sets corresponding to the genes in the combination are all set to 0.2μM, 0.6μMACTB primers and probes, 3.5mM MgCl2, 0.25mM dNTP; in addition, it also contains 100U of DNA polymerase, DNA extracted after counting of the non-small cell HCC827 cell line for positive control, and sterile water for negative control.

[0038] 8. A method for obtaining the gene as described in item 1, comprising:

[0039] Whole genome methylation array analysis was performed on the samples to be tested, and 159 candidate genes related to the differentiation of benign and malignant pulmonary nodules or lung cancer were screened out;

[0040] Target genes HOXA7, HOXA9, SCT, and SHOX2 are selected from the candidate genes, and corresponding primers and probes are designed for the methylated DNA-specific fragments of the target genes, respectively. The primers and probes are respectively equivalent to, complementary to, or hybridize to at least 15 consecutive nucleotides in sequences 1-4 of the sequence table or their complementary sequences, and the performance indicators of the target genes that meet the detection requirements are obtained and verified.

[0041] 9. The method according to item 8 is characterized in that the performance indicators of the target gene include: sensitivity, specificity and area under the receiver operating characteristic curve (AUC) value.

[0042] 10. The method according to item 8 or 9 is characterized in that the sample to be tested comprises one or more of human blood, alveolar lavage fluid, alveolar washing fluid, sputum, lung tissue and bronchial brushing samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The ROC curve for detecting the methylation gene HOXA7 provided by the present invention is shown;

[0044] Figure 2 The ROC curve for detecting the methylation gene HOXA9 provided by the present invention is shown;

[0045] Figure 3 The ROC curve for detecting the methylation gene SCT provided by the present invention is shown;

[0046] Figure 4 The ROC curve for detecting the methylation gene SHOX2 provided by the present invention is shown. DETAILED DESCRIPTION

[0047] The technical solution of the present invention is described in detail below in conjunction with preferred embodiments. It should be noted that the following embodiments are only used to illustrate and explain the present invention, and do not constitute any limitation to the present invention.

[0048] The present invention performs methylation array analysis on samples to be tested from patients with lung cancer and benign lung diseases, screens out 159 candidate genes related to the identification of benign and malignant lung nodules or lung cancer, and selects four target genes related to the identification of benign and malignant lung nodules or lung cancer from the candidate genes, including HOXA7, HOXA9, SCT, and SHOX2, among which:

[0049] The HOXA7 gene (homeobox A7 gene) is a member of the HOX gene family, located on chromosome 7P15-P14, containing 2961 base pairs, encoding 230 amino acids. The HOXA7 gene can be over- or under-expressed in tumors through gene fusion, gene silencing, etc., regulating the occurrence and development of tumor cells; participating in the occurrence of tumors, especially in the early and late stages of tumor development, and participating in the regulation of biological differentiation and proliferation through mutual fusion with signal molecules (such as MEIS, protein kinase-C, etc.); interacting with targeted genes (such as CAVE-OLIN-1, etc.) to induce gene silencing and inactivation.

[0050] The HOXA9 gene (homeobox A9 gene) is a member of the HOX gene family. It is located on chromosome 7, 7P15-P14, contains three exons, and encodes two different proteins. As a transcriptional regulator, the HOXA9 gene can act on downstream target genes to activate or inhibit transcription, and can also interact with a series of upstream regulatory proteins to regulate the biological behavior of tumors. Studies have shown that HOXA9 is abnormally expressed in a variety of tumors and can be used as a marker for the diagnosis of a variety of tumors. It is closely related to the occurrence, invasion, metastasis, and prognosis of tumors.

[0051] The SCT gene (secretin gene), located on chromosome 11p15.5, encodes an endocrine hormone of 27 amino acids. The expression product of the SCT gene can prevent cells from re-entering the cell cycle, inhibit cell infiltration and metastasis, and promote cell apoptosis. The SCT gene is highly methylated in lung cancer tissue and can be used as a potential biomarker for lung cancer and other types of solid tumors.

[0052] The SHOX2 gene (short stature homeobox gene) is a member of the homeobox gene family, and its gene expression regulation is closely related to organ development. Studies have found that the SHOX2 gene is expressed in the mesoderm and ectoderm during the embryonic period, and plays an important role in the development of bones, heart and nervous system. In addition, SHOX2 gene methylation is related to tumors such as lung cancer. As a common transcriptional regulatory factor, its methylation level affects the progression of tumorigenesis.

[0053] The present invention detects the gene methylation level, including: extracting DNA from a sample to be tested (including one or more of human blood, alveolar lavage fluid, alveolar washing fluid, sputum, lung tissue and bronchial brushing sample), treating it with bisulfite, and then using methylation-specific primers and probes to perform fluorescent quantitative PCR reaction; wherein the bisulfite treatment causes the unmethylated cytosine residue C of the DNA double-stranded molecule to deaminize and become uracil; while the methylated cytosine residue C remains unchanged; thus, in the PCR reaction, the methylated cytosine residue C site on the template acts as a cytosine residue C to pair with a guanine residue G in the primer, while the unmethylated cytosine residue site C acts as a uracil residue U to pair with an adenine residue A in the primer.

[0054] In the process of selecting the sample types commonly used in clinical detection as the detection samples for distinguishing benign and malignant pulmonary nodules and diagnosing lung cancer, the present invention unexpectedly found that the sensitivity and specificity of lung cancer diagnosis reached 77% to 95% when methylation gene detection was performed on bronchial brushing samples. Compared with the current clinical use of only bronchial brushing samples for cytological smear detection, the sensitivity and specificity of lung cancer diagnosis is less than 35%, which is significantly improved. In view of this, in addition to using the sample types commonly used in clinical detection as the detection samples, the present invention particularly adds bronchial brushing samples as the detection sample types for distinguishing benign and malignant pulmonary nodules and diagnosing lung cancer.

[0055] The present invention designs specific primer pairs for each of the above-mentioned four genes to detect the methylation level of the target region in each gene, wherein the target region is selected from a continuous fragment of at least 15 bases in length in the DNA shown in sequences 1-4; the primer pairs provided by the present invention utilize the methylation difference to detect the methylation level of the target region in the biomarker gene.

[0056] In the method of the present invention, a fluorescent probe is used to monitor the PCR reaction in real time. The reporter fluorescent group at the 5' end of the probe used is one or more of Cy5, FAM, TET, Rox, Texas Red, HEX, Cy3 and JOE.

[0057] The detection of the methylation level of the gene in the method of the present invention includes detecting whether methylation exists in the biomarker gene, and performing qualitative and quantitative detection of the methylation.

[0058] The present invention provides a kit for detecting gene methylation associated with lung cancer, comprising a primer pair and a probe for performing a methylation-specific PCR reaction on one or more of the HOXA7, HOXA9, SCT and SHOX2 genes.

[0059] The technical solution provided by the present invention is further described in detail below with reference to specific embodiments.

[0060] Example 1. Selection of methylated genes associated with lung cancer

[0061] The present invention screened out 159 candidate genes related to the identification of benign and malignant pulmonary nodules or lung cancer by performing whole genome 850K Illumina methylation array analysis on bronchoalveolar lavage fluid samples from patients with lung cancer and benign lung disease, specifically including:

[0062] <h2 style=";text-align:left;direction:ltr">NFAM1,BZRAP1,MIR142,C16ORF68,MIR365-1,SPNS1,LAT,SIX1,MAB21L1,M IR548,NBEA,BIN2,ALX1,CUX2,C11ORF21,TSPAN32,WDFY4,TRIM39,LOC728 264, MIR145, HOXA9, STAB1, ARHGAP25, PRDM16, SCT, NDUFS2, FCER1G, SHOX2, ETV5, DPP10, PADI6, BAIAP2L1, MEIS1, DLGAP2, WDR66, JAM3, RBM24, RBM38 HOXD8,GBX2,DPP6,KCNIP4,SHANK2,CBLN1,SRGAP3,PCDHGA4,PCDHGC3,PCDHGA12,PCDHGA11,PCDHGA9,PCDHGA1,PCDHGB1,PCDHGC5,PCDHGB6,PCDHGB3 ,PCDHGB7,PCDHGA6,PCDHGA8,PCDHGA10,PCDHGA5,PCDHGB4,PCDHGC4,PCDHGA3,PCDHGA2,PCDHGA7,PCDHGB2,PCDHGC5,PCDHGB5,PCDHGC3,PCDHGB19P,M YCBPAP,HOXA7,FRR3,SPATA16,DRD5,PTCH1,SCN10A,C2CD4D,LOC10013211 1,YBX2,ELAVL4,GPR146,ZNF135,TFAP2E,HCN1,CMTM2,SLC12A7,TRIM58,L HX1,KCNC2,FRAT1,ESPN,RPH3AL,EN1,FAM135B,SCARF2,SLC32A1,PTCH1,L HX8,TBX1,FAT1,ARHGEF4,ZNF781,GPSM1,DUOX1,DLG4,ALX3,SYK,SLC32A1, SLC43A2,ASAM,EXOC3,SIX2,CDH4,CKB,IRX4,ZNF135,SNCB,HOXD10,RPH3A L,ISL2,HOXD3,CACNG8,ZNF529,LINC00554,GPR88,C2CD2,ZNF667,CRB2,WD R8,PRDM14,TAC1,NLFN1,MRI1,HOXD9,SRCIN1,GPR177,SLC38A1,DLX5,GPR 88,CDH13,AKR7L,C4ORF39,TRIM61,PACRG,GPR6,FLJ45983,ZNF582,HLA-A,LAMA4, RGS12, HSF2BP, ZNF544, SDK1, ZNF382, MTUS1, CD52, UBXN11, LOC101929563. ,

[0063] In order to select the best target gene from the above candidate genes, the present invention consulted a large number of literatures, screened out the target genes that have been proven by existing data to be effective in distinguishing benign and malignant pulmonary nodules and lung cancer, and then further performed small sample fluorescence quantitative PCR reaction tests on the target genes screened out through the literature. According to the performance differences of different target genes in detecting clinical samples, the HOXA7, HOXA9, SCT, and SHOX2 methylation genes were finally selected, such as the four in bold font among the above candidate genes.

[0064] After repeated experiments, the present invention designs primer sets for detecting methylated DNA specific fragments of HOXA7, HOXA9, SCT, and SHOX2 genes, respectively, including: HOXA7 primer set, HOXA9 primer set, SCT primer set 1 and SCT primer set 2, SHOX2 primer set; wherein each primer set includes respective upstream primers, downstream primers, and probes:

[0065] HOXA7 Primer Set

[0066] Upstream primer (F): CGACGTTTACGGTAATTTGTTTTGC - sequence 1-1

[0067] Downstream primer (R): TCAACCGCGCCATACAACG - sequence 1-2

[0068] Probe (P): TCGTTAAAGGCGTTTGCGATAAGACGGAC - sequence 1-3

[0069] HOXA9 Primer Set

[0070] Upstream primer (F): CGGGCGTTTTTCGTTTTAGGC - sequence 2-1

[0071] Downstream primer (R): AAATCCGTCCCAAACGAAACCG - sequence 2-2

[0072] Probe (P): TAAATCCCCACAACTACC - sequence 2-3

[0073] SCT Primer Set 1

[0074] Upstream primer (F1): AGGGTTCGGCGATATTTAGAC - sequence 3-1

[0075] Downstream primer (R1): AACAACCGCTAAAACCGC - sequence 3-2

[0076] Probe (P1): CCCTCCCGCAAACGACTAAACTCGCTAA - sequence 3-3

[0077] SCT Primer Set 2

[0078] Upstream primer (F2): TCGTTATAAAGGGGTTTTGC - sequence 3-4

[0079] Downstream primer (R2): CCTAACGAACGACTCACCT - sequence 3-5

[0080] Probe (P2): TTCGGGGTCGTGGTCGTAGCGTTTAGT - sequence 3-6

[0081] SHOX2 Primer Set

[0082] Upstream primer (F): GTTTTTTGGATAGTTAGGTAAT - sequence 4-1

[0083] Downstream primer (R): TAACCCGACTTAAACGACGA - sequence 4-2

[0084] Probe (P): CTCGTACGACCCCGATCG - sequence 4-3

[0085] The primer sequences and probe sequence numbers in the above-mentioned methylation gene primer sets are listed in Table 1-0.

[0086] In this embodiment, bronchoalveolar washing fluid collected from 122 patients undergoing bronchoscopy was used as the test sample, including 53 patients with lung cancer and 69 patients with benign lung disease. DNA was extracted from these samples and treated with bisulfite. The corresponding primer sets were used to detect the methylation level of the target region in each biomarker gene of HOXA7, HOXA9, SCT, and SHOX2 by fluorescent PCR, wherein the target region was selected from a continuous fragment of at least 15 bases in the DNA shown in sequence 1-4; thereby determining whether these target genes can distinguish lung cancer from benign lung disease and the good performance of the distinction. The present invention uses fluorescent probes to monitor the PCR reaction in real time. The 5'-end reporter fluorescent group of the probe used is one or more of Cy5, FAM, TET, Rox, Texas Red, HEX, Cy3, and JOE.

[0087] Table 1-0

[0088] name sequence serial number effect HOXA7F CGACGTTTACGGTAATTTGTTTTGC 1-1 HOXA7 upstream primer HOXA7R TCAACCGCGCCATACAACG 1-2 HOXA7 downstream primers HOXA7P TCGTTAAAGGCGTTTGCGATAAGACGGAC 1-3 HOXA7 probe HOXA9F CGGGCGTTTTTCGTTTTAGGC 2-1 HOXA9 upstream primer HOXA9R AAATCCGTCCCAAACGAAACCG 2-2 HOXA9 downstream primers HOXA9P TAAATCCCCACAACTACC 2-3 HOXA9 probe SCTF1 AGGGTTCGGCGATATTTAGAC 3-1 SCT upstream primer SCTR1 AACAACCGCTAAAACCGC 3-2 SCT downstream primer SCTP1 CCCTCCCGCAAACGACTAAACTCGCTAA 3-3 SCT probe SCTF2 TCGTTATAAAGGGGTTTTGC 3-4 SCT upstream primer SCTR2 CCTAACGAACGACTCACCT 3-5 SCT downstream primer SCTP2 TTCGGGGTCGTGGTCGTAGCGTTTAGT 3-6 SCT probe SHOX2F GTTTTTTGGATAGTTAGGTAAT 4-1 SHOX2 upstream primer SHOX2R TAACCCGACTTAAACGACGA 4-2 SHOX2 downstream primers SHOX2P CTCGTACGACCCCGATCG 4-3 SHOX2 probe

[0089] The present invention uses IBM SPSS Statistics24 analysis software to analyze the test results, and compares the test results of each gene methylation in samples of lung cancer patients and benign lung disease patients through the receiver operating characteristic (ROC) curve. The ROC curves of the four methylated genes HOXA7, HOXA9, SCT, and SHOX2 are shown in the table below. Figures 1 to 4 .

[0090] To explain Figure 1-Figure 4 , we must first explain the meaning of ROC curve, Youden index and AUC value. ROC curve is a comprehensive indicator that reflects the continuous variables of sensitivity and specificity. Its ordinate "sensitivity" is used to characterize the true positive rate, and the abscissa "1-specificity" is used to characterize the false positive rate. Youden index, which is equal to the sum of sensitivity and specificity minus 1, is used to indicate the total ability of the diagnostic test to detect true patients (true positives) and non-patients (false positives). Its value range is 0 to 1. The larger the value, the stronger the authenticity of the diagnosis. AUC value refers to the size of the area under the curve (AUC, Area Under Curve). AUC = 0.5 refers to the area under the 45-degree straight line on the ROC curve. For a methylation gene marker, AUC>0.5 indicates that it has detection value.

[0091] Back to Figure 1-4 The present invention selects the abscissa and ordinate corresponding to the point with the largest Youden index on the ROC curve to calculate the sensitivity and specificity of the corresponding methylation gene for the identification of benign and malignant pulmonary nodules or the diagnosis of lung cancer, such as Figure 1-4 The star points (*) marked on the curve; at the same time, the AUC value, 95% confidence interval and P value (P < 0.001, indicating that the statistical difference of the marker detection is significant, which can effectively distinguish benign and malignant nodules and whether the patient is a cancer patient). These data are listed in Table 1-1 as performance indicators for detecting the above four methylation genes in human alveolar lavage fluid.

[0092] Table 1-1

[0093]

[0094] Combination Figure 1-4Let's look at the results in Table 1. First, it can be seen intuitively from each figure that the ROC curve of each gene is far to the upper left of AUC=0.5, indicating that the overall AUC value of each gene is very high. Looking at Table 1 again, relative to benign lung diseases, the AUC values ​​of the methylation levels of the four biomarker genes in lung cancer samples are all greater than 0.5, between 0.69 and 0.85, and all have P<0.001, which is sufficient to show that the detection of the methylation levels of the four genes HOXA7, HOXA9, SCT, and SHOX2 provided by the present invention has a reliable reference value for distinguishing lung cancer and benign and malignant lung nodules.

[0095] Example 2. Verification of designed primer sets

[0096] This embodiment uses real-time fluorescence PCR as an example to detect the methylation level of biomarker genes. The detection targets are HOXA7, HOXA9, SCT, and SHOX2 genes. This embodiment uses DNA treated with bisulfite as a template for real-time fluorescence PCR amplification for detection.

[0097] It should be said that designing a high-quality primer set is a key factor in the success of methylation gene detection. The present invention is different from ordinary gene detection in terms of design principle. It requires that the primer sequence contains at least one CpG site, preferably multiple CpG sites, so as to ensure the specificity of the primer and improve the detection rate of methylation gene bases.

[0098] For HOXA7, HOXA9, SCT, and SHOX2 genes, multiple sets of primer and probe combinations can be designed. The performance of each probe-primer combination may be different, so experiments are needed to select and verify the advantages and disadvantages.

[0099] In this embodiment, the primers and probes designed and selected by the present invention are verified with methylated gene templates and unmethylated gene templates. The present invention designs a variety of primers and probes for HOXA7, HOXA9, SCT, and SHOX2 genes, which are respectively equivalent to, complementary to, or hybridize to at least 15 consecutive nucleotides or their complementary sequences in sequence 1-4 of the sequence table, and are designed to meet the range of PCR amplification product size of 80-350 bp base pairs.

[0100] The sequences of the methylated genes and the non-methylated genes were used as templates for the designed primer sets (such as the five sets listed in Example 1) to perform gene amplification by real-time fluorescence PCR, and three sets of experiments were performed. The amplification results were expressed as Ct values, as shown in Table 2. In the table, the Ct values ​​with numerical values ​​indicate that the methylation test is positive, and the Ct values ​​with no numerical values ​​indicate that the methylation test is negative.

[0101] Table 2

[0102]

[0103] According to the results in Table 2, in the three groups of experiments, each primer set has a numerical value for the amplification Ct value of the methylated gene template, and the detection is positive, while the Ct value for the amplification of the non-methylated gene template has no numerical value, and the detection is negative. This shows that the primer sets designed and selected for the four methylated genes of the present invention are highly specific to the methylated gene template.

[0104] Example 3. Testing the sensitivity and specificity of methylation gene detection using bronchial brushing samples

[0105] In this embodiment, bronchial brushing samples from 167 patients undergoing bronchoscopy were selected as test samples, including 95 patients with lung cancer and 72 patients with benign lung disease. DNA was extracted from these samples, and after bisulfite treatment, the aforementioned HOXA7 primer set, HOXA9 primer set, SCT primer set 2 and SHOX2 primer set were selected, and the methylation levels (Ct values) of the four genes were detected by fluorescent PCR, respectively, and the methylation detection results of each gene in the respective samples of lung cancer patients and benign lung disease patients were compared by ROC curve, and the sensitivity and specificity of the differentiation of benign and malignant pulmonary nodules or the diagnosis of lung cancer were calculated at the point with the largest Youden index on the curve, and the area under the curve (AUC value) was calculated. The test results are shown in Table 3.

[0106] Table 3

[0107]

[0108] The test results in Table 3 show that the performance indicators of bronchial brushing samples for distinguishing benign and malignant pulmonary nodules or diagnosing lung cancer are very excellent. The AUC values ​​for detecting the methylation levels of the four biomarker genes are all greater than 0.88, which are much higher than the optimal line of 0.5, indicating that the four methylation genes provided by the present invention have a high detection value and can provide very useful information for distinguishing benign and malignant pulmonary nodules and diagnosing lung cancer.

[0109] Example 4. Testing the sensitivity and specificity of methylation gene combination detection

[0110] In this example, bronchoalveolar lavage fluid from 122 patients undergoing bronchoscopy was selected as test samples, including 53 patients with lung cancer and 69 patients with benign lung disease. DNA was extracted from these samples and treated with bisulfite; HOXA7, HOXA9, SHOX2, and SCT genes were combined to test the performance of methylation gene combination detection, including:

[0111] (I) Select two genes from HOXA7, HOXA9, SHOX2, and SCT for combination, and detect the methylation level of each gene combination by fluorescent PCR, including:

[0112] Combination 1: HOXA7 and HOXA9 gene combination;

[0113] Combination 2: HOXA7 and SHOX2 gene combination;

[0114] Combination 3: HOXA7 and SCT gene combination, where SCT gene used SCT primer set 1;

[0115] Combination 4: HOXA9 and SHOX2 gene combination;

[0116] Combination 5: HOXA9 and SCT gene combination, where SCT gene used SCT primer set 2;

[0117] Combination six: SCT and SHOX2 gene combination, in which the SCT gene uses SCT primer set 1.

[0118] The ROC curve was used to compare the test results of methylation detection of each gene combination in samples of lung cancer patients and benign lung disease patients, and the point with the largest Youden index on the ROC curve was selected to calculate the sensitivity and specificity of distinguishing benign and malignant lung nodules or diagnosing lung cancer, and the area under the curve (AUC value) was calculated. The test results are shown in Table 4.

[0119] Table 4

[0120] Combination 1 Combination 2 Combination Three Combination Four Combination Five Combination Six Sensitivity (%) 77.78 74.07 74.07 61.11 77.78 61.11 Specificity (%) 75.36 84.06 78.26 91.30 75.36 91.30 AUC value 0.809 0.828 0.807 0.785 0.809 0.791

[0121] According to the results in Table 4, using alveolar lavage fluid as a sample, combining two of the four methylation genes to assist in the identification of benign and malignant pulmonary nodules or the diagnosis of lung cancer also has excellent performance indicators. Compared with benign lung diseases, the methylation levels of the four biomarker genes in the alveolar lavage fluid samples of lung cancer patients are detected, and the AUC values ​​are between 0.785 and 0.828, which are all higher than the values ​​listed in Table 1, indicating that the four methylation genes provided by the present invention are combined in pairs to improve the accuracy of detection, and the detection results can provide accurate and valuable information for the identification of benign and malignant pulmonary nodules and the diagnosis of lung cancer.

[0122] (ii) Select three genes from HOXA7, HOXA9, SHOX2, and SCT to combine and detect the methylation level of the combined genes by fluorescent PCR, including:

[0123] Combination 7: HOXA7, HOXA9 and SCT gene combination, where SCT gene used SCT primer set 1;

[0124] Combination 8: HOXA7, HOXA9 and SHOX2 gene combination;

[0125] Combination nine: HOXA9, SCT and SHOX2 gene combination, where the SCT gene used SCT primer set 2;

[0126] Combination ten: HOXA7, SCT and SHOX2 gene combination, in which the SCT gene uses SCT primer set 2.

[0127] The ROC curve was used to compare the test results of methylation detection of each gene combination in samples of lung cancer patients and benign lung disease patients, and the point with the largest Youden index on the ROC curve was selected to calculate the sensitivity and specificity of distinguishing benign and malignant lung nodules or diagnosing lung cancer, and the area under the curve (AUC value) was calculated. The test results are shown in Table 5.

[0128] Table 5

[0129] Combination Seven Combination Eight Combination Nine Combination Ten Sensitivity (%) 70.37 64.81 61.11 68.52 Specificity (%) 88.41 91.30 95.65 91.30 AUC value 0.839 0.838 0.805 0.839

[0130] According to the results in Table 5, the performance indicators of combining three of the four methylation genes for the identification of benign and malignant pulmonary nodules or the diagnosis of lung cancer using alveolar lavage fluid as a sample are also very good. Compared with benign lung diseases, the methylation levels of the four biomarker genes in the alveolar lavage fluid samples of lung cancer patients are detected, and the AUC values ​​are between 0.805-0.839, which are much higher than the optimal line of 0.5 and much higher than the values ​​listed in Table 1, indicating that the accuracy of the detection is further improved after three of the four methylation genes provided by the present invention are combined, and the detection results can provide accurate and reliable information for the identification of benign and malignant pulmonary nodules and the diagnosis of lung cancer.

[0131] (III) The four genes HOXA7, HOXA9, SHOX2, and SCT were selected for combination, and the methylation levels of the combined genes were detected by fluorescent PCR, wherein the SCT gene was detected using SCT primer set 1.

[0132] The ROC curve was used to obtain the test results of the methylation detection of the four gene combinations in the samples of lung cancer patients and benign lung disease patients, and the point with the largest Youden index on the ROC curve was selected to calculate the sensitivity and specificity of the differentiation of benign and malignant lung nodules or lung cancer diagnosis, and the area under the curve (AUC value) was calculated. The test results are shown in Table 6.

[0133] Table 6

[0134] HOXA7, HOXA9, SCT, SHOX2 Sensitivity (%) 74.07 Specificity (%) 88.41 AUC value 0.851

[0135] The results in Table 6 show that the performance indicators of the combination of four methylation genes to assist in the differentiation of benign and malignant pulmonary nodules or the diagnosis of lung cancer using alveolar lavage fluid as a sample are also very good. Compared with benign lung diseases, the methylation levels of the four biomarker genes in the alveolar lavage fluid samples of lung cancer patients were detected, and the AUC value was 0.851, which was much higher than the optimal line of 0.5, indicating that the combination of the four methylation genes provided by the present invention improves the accuracy of the detection, and the detection results can provide accurate and reliable information for the differentiation of benign and malignant pulmonary nodules and the diagnosis of lung cancer.

[0136] Example 5. Methylated genes associated with lung cancer and kits for detecting corresponding genes

[0137] A methylation gene associated with lung cancer includes one or more of HOXA7, HOXA9, SCT and SHOX2 genes, and its nucleotide sequences are shown in sequence 1, sequence 2, sequence 3 and sequence 4 in the sequence table; wherein the methylated cytosine sites of genes HOXA7, HOXA9, SCT and SHOX2 are marked in sequence 1, sequence 2, sequence 3 and sequence 4 in sequence.

[0138] A detection kit for the aforementioned gene, used for detecting methylated genes in a sample to be tested, comprises one or more of the following reagents:

[0139] A reagent for detecting HOXA7 methylation gene, comprising primers shown in sequences numbered 1-1 and 1-2 and a probe shown in sequences numbered 1-3;

[0140] A reagent for detecting HOXA9 methylation gene, comprising primers shown in sequences No. 2-1 and 2-2 and a probe shown in sequence No. 2-3;

[0141] A reagent for detecting SCT methylation gene, comprising primers shown in sequences No. 3-1 and 3-2 and a probe shown in sequence No. 3-3; comprising primers shown in sequences No. 3-4 and 3-5 and a probe shown in sequence No. 3-6;

[0142] The reagent for detecting SHOX2 methylation gene comprises primers shown in sequences No. 4-1 and 4-2 and a probe shown in sequence No. 4-3.

[0143] The above detection kit also includes ACTB primers and probes for internal reference gene detection.

[0144] In the above detection kit, the primer sets of HOXA7, HOXA9, SCT and SHOX2 genes are respectively composed of primers and probes contained in their respective reagents. In this embodiment, the concentrations of the components in the PCR reaction solution are: 0.2μM HOXA7 primer set, 0.6μM ACTB primer and probe, 3.5mM MgCl2, 0.25mM dNTP; in addition, it also contains 100U of DNA polymerase, DNA extracted after counting of non-small cell HCC827 cell line for positive control; and sterile water for negative control.

[0145] Of course, the PCR reaction solution exemplified in this embodiment may also contain other methylation gene primer sets, such as HOXA9 primer set, SCT primer set and SHOX2 primer set, depending on the detection object, and their concentrations in the PCR reaction solution may also be set to 0.2 μM accordingly.

[0146] In the above kit, in the PCR reaction solution containing four sets of primer sets, the concentration of each component is: 0.2μM HOXA7 primer set, 0.2μM HOXA9 primer set, 0.2μM SCT primer set 1, 0.2μM SHOX2 primer set, 0.5μM ACTB primer and probe, 3.0mM MgCl2, 0.3mM dNTP; in addition, it also contains 500U of DNA polymerase, DNA extracted after counting of non-small cell H1299 cell line for positive control; sterile water for negative control.

[0147] Similarly, the PCR reaction solution exemplified in this embodiment may also contain other forms of combined methylation gene primer sets according to different combinations of detection objects, and their concentrations in the PCR reaction solution may also be set to 0.2 μM accordingly, such as the combination exemplified in Example 4.

[0148] In the kit of the present invention, the sample to be tested comprises one or more of human blood, alveolar lavage fluid, alveolar washing fluid, sputum, lung tissue and bronchial brushing samples.

Claims

1. A detection kit for methylation genes associated with lung cancer, used for detecting methylation genes in a sample to be tested, the kit comprising one or more selected from the following reagents: (a) A reagent for detecting the HOXA7 gene, comprising the primers shown in the sequences No. 1-1 and 1-2 and the probe shown in the sequence No. 1-3; (b) A reagent for detecting the HOXA9 gene, comprising the primers shown in the sequences No. 2-1 and 2-2 and the probe shown in the sequence No. 2-3; (c) A reagent for detecting the SCT gene, comprising: (i) primers represented by sequences No. 3-1 and 3-2 and a probe represented by sequence No. 3-3; or (ii) primers represented by sequences No. 3-4 and 3-5 and a probe represented by sequence No. 3-6; (d) A reagent for detecting the SHOX2 gene, comprising the primers represented by the sequences No. 4-1 and 4-2 and the probe represented by the sequence No. 4-3.

2. The detection kit according to claim 1, characterized in that Also included are ACTB primers and probes for internal reference gene detection.

3. The detection kit according to claim 1 or 2, wherein the sample to be tested comprises one or more selected from human blood, alveolar lavage fluid, alveolar washing fluid, sputum, lung tissue samples and bronchial brushing samples.

4. The detection kit according to any one of claims 1 to 3, wherein the components included in the detection kit are used to prepare a PCR reaction solution, and the PCR reaction solution comprises: 0.2 μM of the corresponding primers and probes contained in the reagent for detecting HOXA7, HOXA9, SCT and / or SHOX2 genes; 3.5 mM MgCl2; 0.25 mM dNTPs; 100 U of DNA polymerase; Optional 0.6 μM ACTB primers and probes; Optional DNA extracted after counting of non-small cell HCC827 cell line for positive control, and Sterile water for negative control.

5. The detection kit according to any one of claims 1 to 4, wherein the detection kit comprises any two selected from (a) to (d).

6. The detection kit according to any one of claims 1 to 4, wherein the detection kit comprises any three selected from (a) to (d).

7. The kit according to claim 5 or 6, wherein the components included in the detection kit are used to prepare a PCR reaction solution, and the PCR reaction solution includes: 0.2 μM of the corresponding primers and probes; 3.5 mM MgCl2; 0.25 mM dNTPs; 100 U of DNA polymerase; Optional 0.6 μM ACTB primers and probes; DNA extracted after counting of non-small cell HCC827 cell line for positive control, and Sterile water for negative control.

8. A method for preparing the detection kit according to any one of claims 1 to 7, comprising: (1) Whole genome methylation array analysis was performed on the samples to screen out 159 candidate genes related to the differentiation of benign and malignant pulmonary nodules or lung cancer; (2) Select target genes HOXA7, HOXA9, SCT and / or SHOX2 from the candidate genes, and design corresponding primers and probes for the methylated DNA-specific fragments of the target genes, respectively. The primers and probes are shown in Table 1-0, respectively, and verify that the primers and probes meet the performance indicators of the target genes required for detection.

9. The method according to claim 8, wherein the performance indicator of the target gene is selected from the group consisting of sensitivity, specificity and AUC value.

10. The method according to claim 8 or 9, wherein the sample to be tested comprises one or more selected from human blood, alveolar lavage fluid, alveolar washing fluid, sputum, lung tissue sample and bronchial brushing sample.

Images