Composition and kit for detecting bladder cancer and application of composition and kit

Abstract

The invention relates to the field of molecular biological detection, in particular to the field of bladder cancer detection. The invention provides a composition for detecting bladder cancer. The composition comprises a detection reagent for detecting the methylation level of the following regions: a region as shown in SEQ ID NO: 1 in an ONECUT2 gene; the region in the Septin9 gene is as shown in SEQ ID NO: 2; and a region shown as SEQ ID NO: 3 in the ZNF671 gene. Meanwhile, the invention further provides a kit comprising the composition and application of the composition. The composition of the present invention enables the clinical detection of bladder cancer with high sensitivity and good specificity.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological detection, specifically, to the field of bladder cancer detection, and more specifically, to the detection of the methylation level of bladder cancer gene markers. Background Art

[0002] Bladder cancer is one of the most common malignant tumors of the urinary system. The 2022 Global Cancer Data Report shows that there are 610,000 cases of bladder cancer, accounting for 3.1% of the total number of new cancers, ranking up to 9th place; newly released data show that in 2022, there were 92,900 new cases of bladder cancer in China, including 73,200 cases in men, and its incidence rate ranked 8th among all malignant tumors in men; 41,400 deaths, including 32,500 cases in men. The occurrence and development of bladder cancer is a complex, multi-factorial, multi-step pathological process. Studies have shown that both intrinsic genetic factors and external environmental factors play an important role in the occurrence and development of tumors. Bladder cancer mainly includes urothelial (transitional cell) carcinoma, squamous cell carcinoma and adenocarcinoma. Among them, bladder urothelial carcinoma accounts for more than 90% of bladder cancer, bladder squamous cell carcinoma accounts for about 3% to 7%; the proportion of bladder adenocarcinoma is <2%. Depending on whether the tumor infiltrates the bladder muscle layer, it is divided into non-muscle invasive bladder cancer (NMIBC) and muscle invasive bladder cancer (MIBC). Muscle invasion and distant metastasis are the main factors for death or poor prognosis in bladder cancer patients. The 5-year overall survival rate of patients with muscle invasive bladder cancer is about 50%, and the 5-year overall survival rate of patients with metastatic bladder cancer is even lower at 5%, while the 5-year survival rate of patients with non-muscle invasive bladder cancer is as high as 90%. Studies have shown that most patients with muscle invasive bladder cancer are discovered at the time of diagnosis, rather than after the progression of non-muscle invasive bladder cancer patients, suggesting that early diagnosis can effectively reduce the incidence of muscle invasive and metastatic bladder cancer. Studies have shown that early diagnosis and treatment of bladder cancer can significantly increase the detection rate of early lesions and improve patient prognosis and quality of life.

[0003] At present, the diagnosis and postoperative monitoring methods of bladder cancer include: imaging examination, endoscopy, urine cytology, tumor marker detection, etc. Imaging examinations (ultrasound, CT, MRI) have limited diagnostic capabilities for bladder carcinoma in situ and smaller tumors (<5mm), and are generally not used for early screening of bladder cancer and postoperative recurrence monitoring. Cystoscopy is the gold standard for bladder cancer diagnosis and is also one of the main means of postoperative recurrence monitoring. Cystoscopy is an invasive examination, which has the characteristics of causing pain to patients and high medical costs. It is subject to certain restrictions in clinical work and is not suitable for early screening of bladder cancer. Urine cytology is the most cost-effective urine method for diagnosing high-grade bladder cancer. The sensitivity of this analysis is poor, but the specificity is high, especially for high-grade urothelial carcinoma. Urine cytology diagnoses high-grade urothelial carcinoma with a cancer risk of >90%, but the sensitivity of diagnosing low-grade tumors is low. Therefore, urine cytology cannot detect the occurrence of early bladder cancer. Tumor marker tests include nuclear matrix protein 22 (NMT22), bladder tumor antigen-related (BTAstat and BTAtrak), and urine fluorescence in situ hybridization (FISH). The sensitivity for low-grade and Ta-stage tumors is only 39% to 51%, and the specificity is 53% to 95%. It can be seen that the diagnostic performance of these methods is not ideal, so they have not been widely used in clinical practice. Therefore, it is urgent to develop effective early screening detection technology to achieve painless, non-invasive, economical, convenient, accurate and efficient bladder cancer screening.

[0004] In recent years, based on molecular diagnostic technologies such as PCR and NGS, liquid biopsy has continued to develop and break through, and has become a powerful weapon for accurate early screening of cancer. From the perspective of the signal abundance and signal intensity of the marker, ctDNA methylation is a relatively ideal detection marker. Studies have shown that the phenomenon of increased methylation levels of tumor suppressor genes usually occurs in the early stages of cancer and is a hallmark change in the early development of tumors; in the CpG islands of the human genome, 60-80% of cytosine residues are methylated, and DNA methylation has become a common and abundant source of signals in early cancer screening; in addition, different types of cancer have their own unique DNA methylation patterns, which are highly organ-specific and can achieve tissue traceability. Therefore, ctDNA methylation is the mainstream detection indicator adopted by early screening companies at home and abroad.

[0005] There is an urgent need in this field for a more effective bladder cancer diagnostic product that can make the early diagnosis of bladder cancer highly sensitive, highly specific, non-invasive, and rapid. Summary of the invention

[0006] In view of this, the present invention provides a composition for detecting bladder cancer, the composition comprising a detection reagent for detecting the methylation level of at least two of the following regions:

[0007] The region of the ONECUT2 gene as shown in SEQ ID NO: 1;

[0008] The region of the Septin9 gene as shown in SEQ ID NO: 2; and

[0009] The region of the ZNF671 gene as shown in SEQ ID NO:3.

[0010] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level of the following regions:

[0011] The region of the ONECUT2 gene as shown in SEQ ID NO: 1; and

[0012] The region of the Septin9 gene as shown in SEQ ID NO:2.

[0013] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level of the following regions:

[0014] The region of the Septin9 gene as shown in SEQ ID NO: 2; and

[0015] The region of the ZNF671 gene as shown in SEQ ID NO:3.

[0016] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level of the following regions:

[0017] The region of the ONECUT2 gene as shown in SEQ ID NO: 1; and

[0018] The region of the ZNF671 gene as shown in SEQ ID NO:3.

[0019] In some specific embodiments, the composition includes a detection reagent for detecting the methylation level of the following regions:

[0020] The region of the ONECUT2 gene as shown in SEQ ID NO: 1;

[0021] The region of the Septin9 gene as shown in SEQ ID NO: 2; and

[0022] The region of the ZNF671 gene as shown in SEQ ID NO:3.

[0023] The region shown in SEQ ID NO: 1 in the ONECUT2 gene, the region shown in SEQ ID NO: 2 in the Septin9 gene, and the region shown in SEQ ID NO: 3 in the ZNF671 gene are a sequence of the CpG island in the promoter region of each gene.

[0024] Specifically, the SEQ ID NO:1 region of the ONECUT2 (Genbank accession number: OZ110816.1) gene is as follows:

[0025] TGTCACTTTCTCAAACAAATGTGTATATGGAGGGAGATCGATGCTGATAAT

[0026] GTTTAGAAGATTAAAAGAGCATTAATGCTGGCAACAATAACGTAAACGTG

[0027] TGGACCCAGATTTCATTGATCTGGAACTTGATCCGGCGCGTTTCCAGTAAG

[0028] CCCGACGGCGCGCTCTTCCCAGCAGAGCGCTCACCAGCGCCACGGCCCC

[0029] GCGGTTTTCCAGCGGTGCCGCTTCGCCAGCTCTGCGCGGGTTCTCCCGTC

[0030] TGACCGCAGCTCCTCCCCCGCGAGGCCCCAGCCCGCCTTACTTCCCCGAGGTTTTCTCCTCCTCTCGCGGGGCTCTCTGCC;

[0031] The SEQ ID NO:2 region of the Septin9 (Genbank accession number: NG_011683.2) gene is as follows:

[0032] TTCCTCGCCGCTGCCCTCCGCGCGACCCGCTGCCCACCAGCCATCATGTC

[0033] GGACCCCGCGGTCAACGCGCAGCTGGATGGGATCATTTCGGACTTCGAAG

[0034] GTGGGTGCTGGGCTGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCC

[0035] TGCGGGTGGGCCTGGCGCGGGACGGGGGTGCGCTGAGGGGAGACGGGA

[0036] GTGCGCTGAGGGGAGACGGGACCCCTAATCCAGGCGCCCTCCCGCTGAG

[0037] AGCGCCGCGCCCCCGGCCCCGTGCCCGCGCCGCCTACGTGGGGGACC

[0038] CTGTTAGGGGCACCCGCGTAGACCCTGCGCGCCCTCACAGGACCCTGTGC

[0039] TCGTTCTGCGCACTGCCGCCTGGGTTTCCTTCCTTTATTGTTGTTTGTGTTTGCCAAG;

[0040] The SEQ ID NO:3 region of the ZNF671 (Genbank accession number: AC003006.1) gene is as follows:

[0041] CCCGGAGGACGCAGCACCCACCCGCGCGGAGTCCGTTAGCTCCGCCATA

[0042] GGACCGTGGGCGCGGACAGCTGCCGGGAGCGGCAGGCGTCTCGATCGG

[0043] GACGCAGGCACTTCCGTCCCTGCAGAGCATCAGACGCGTCTCGGGACAC

[0044] TGGGGACAACATCTCCTCCGCGCTTTCCCAACACCTCCACCTGCGGCCCACACAAGCGTTACAGAACCCCGGCCAGGGACAGCCTGACAGAAAC.

[0045] The composition of the present invention can be used to detect bladder cancer samples with a sensitivity of 100% in tissues and with a sensitivity of 87.3% and a specificity of 95% in free DNA in urine; the composition of the present invention can detect bladder cancer with high sensitivity and specificity in clinical practice with fewer markers, saving both cost and time; clinically, bladder cancer can be detected sensitively and specifically in the early stages of malignant transformation.

[0046] In the present invention, "CpG island" is the abbreviation of cytosine (C)-phosphate (p)-guanine (G), which refers to some regions rich in CpG dinucleotides on the genome, with a length of 300 to 3000 bp.

[0047] In some embodiments, the detection reagent of the present invention can be used to detect the methylation level of a CpG island on a corresponding gene or a sequence on a CpG island present in a sample.

[0048] In the present invention, a "sample" is a biological sample selected from an individual, specifically, for example, selected from a cell line, a histological section, a tissue biopsy / paraffin-embedded tissue, urine, whole urine, urine supernatant, urine sediment or a combination thereof.

[0049] Preferably, the "sample" of the present invention is urine, ie, free DNA in urine.

[0050] Free DNA in urine can be used to detect tumors, with the characteristics of little harm to patients and good specificity. However, due to its extremely low content in urine, it has the problem of low sensitivity. Using the detection reagent of the present invention, free DNA in urine can be used as a sample, and can be detected clinically with a sensitivity of 87.3% and a specificity of 95%.

[0051] In the present invention, "detection reagent" refers to a reagent for detecting the methylation level of a gene in a sample, wherein the methylation level is measured by methylation sequencing, methylation chip, or methylation fluorescence quantitative PCR.

[0052] In some specific embodiments, the methylation level detection reagent can also be a detection reagent for detecting the average methylation level of a gene fragment.

[0053] In some specific embodiments, the methylation level detection reagent can also be a detection reagent for detecting one or more methylation sites within a gene segment.

[0054] In some specific embodiments, the detection reagents include but are not limited to nucleic acid primers and sequencing Tag sequences, which are used to measure the methylation level by methylation sequencing.

[0055] In some specific embodiments, the detection reagent includes but is not limited to a chip, and the chip is a methylation chip, and the methylation chip has a probe that specifically binds to the methylation region. The chip can be, for example, but is not limited to, Agilent's Human CpG Island Microarrays and Human DNA Methylation Microarrays, Illumina's Infinium HumanMethylation27 BeadChip, Infinium HumanMethylation450BeadChip and GoldenGate Methylation Assay, and Roche NimbleGen's Human DNAMethylation 2.1M Deluxe Promoter Array, Human DNA Methylation Array, etc., for measuring methylation levels by chip.

[0056] In some specific embodiments, the detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes for measuring methylation levels by methylation fluorescence quantitative PCR.

[0057] Furthermore, the detection reagent also includes an internal standard primer and an internal standard probe.

[0058] In a specific embodiment, the target of the internal standard primer and probe is the β-Actin gene.

[0059] When the detection reagent includes nucleic acid primers and nucleic acid probes, the detection reagent detects the methylation level of nucleic acid in the sample by methylation fluorescent quantitative PCR.

[0060] In the present invention, "methylation fluorescent quantitative PCR" refers to converting the region to be detected by sulfite or digesting it with a methylation-sensitive restriction endonuclease, and then performing fluorescent quantitative PCR detection using primers and probes specifically designed for the detection target, thereby obtaining the methylation level of the region to be detected.

[0061] The above composition may also include other reagents, specifically, for example, various reagents required for pre-treatment or pre-processing of the sample, such as sample extraction reagents for extracting sample nucleic acid, purification reagents for purifying sample nucleic acid, bisulfite or bisulfite used for conversion, etc.

[0062] In some specific embodiments, the detection reagents are shown in Table 1. In the following detection reagents, the upstream primer / downstream primer / probe for detecting one target corresponds to a group, and the upstream primer / downstream primer / probe for detecting the targets to be detected is used. Therefore, the detection reagents of the present invention can include any one or more groups of the following primers and probes.

[0063] Table 1

[0064]

[0065]

[0066] In some specific embodiments, the four fluorescence channels adopted by the present invention are FAM, HEX, ROX and CY5 channels, but the actual application is not limited to this, and it can be a combination of any other fluorescence channels; at the same time, different targets can also correspond to different fluorescence channels, such as any fluorescence channel can be used as an internal standard detection channel.

[0067] Using this preferred embodiment, the sensitivity and specificity of detection are improved compared to primer and probe combinations for detecting other target regions. Therefore, using this preferred combination can clinically detect bladder cancer with higher sensitivity and better specificity, thereby further improving the accuracy of early bladder cancer detection.

[0068] In a second aspect, the present invention provides use of the above composition in preparing a kit for detecting bladder cancer.

[0069] Furthermore, the present invention provides use of the above composition in preparing a kit for detecting bladder cancer using urine free DNA.

[0070] In a third aspect, the present invention provides a kit for detecting bladder cancer, the kit comprising the composition as described above.

[0071] Furthermore, the kit also includes, but is not limited to, at least one of a reagent for extracting nucleic acid and a reagent for purifying nucleic acid.

[0072] Furthermore, the kit also includes a negative sample.

[0073] Specifically, the negative sample is human genomic DNA that has been sequenced to verify that there is no methylation of the target gene.

[0074] Furthermore, the kit also includes dNTPs, Mg 2+ , at least one of a methylation-sensitive restriction endonuclease, a PCR buffer, and a hot-start enzyme.

[0075] Furthermore, the methylation-sensitive restriction endonuclease includes at least one of HpaII and HinP1I.

[0076] Furthermore, the range of the final concentration of each component in the reaction system is as follows: Mg 2+ 1~6mM, dNTPs1~80mM, methylation-sensitive restriction endonuclease 0.01~30U, hot start enzyme 1~30U, primer 0.1~40μM, probe 0.1~20μM.

[0077] The present invention uses a methylation-sensitive restriction endonuclease that can specifically recognize the restriction site and cut it. If a specific base in the recognition sequence is methylated, it remains intact and is detected by PCR, so it can distinguish methylated and non-methylated DNA. Compared with the traditional sulfite conversion method, the enzyme cutting method does not require conversion and purification and recovery, and is time-consuming; there is no nucleic acid loss, and the detection sensitivity is high.

[0078] Furthermore, the reagents for extracting nucleic acid are reagents for extracting tissue DNA and reagents for extracting urine free DNA.

[0079] Furthermore, the reagent for extracting nucleic acid is a reagent for extracting free DNA in urine. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Figure 1 The detection of 0.05 ng / reaction of methylated DNA by the composition of the present invention;

[0081] Figure 2 The composition of the present invention detects 20 ng / reaction of non-methylated DNA;

[0082] Figure 3 These are the test results of the composition of the present invention in detecting bladder cancer tissue and adjacent tissue. DETAILED DESCRIPTION

[0083] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0084] Example 1: Screening of methylation genes

[0085] The present invention collects tumor methylation detection data from the TCGA data set (https: / / tcga.xenahubs.net) of the UCSC Xena website and the GEO database of the National Center for Biotechnology Information (NCBI). The bladder cancer and control data are used for differential analysis, and the physical location and gene information of the differential sites are annotated. To ensure that the screened fragments have consistent methylation levels, the screening of methylated gene fragments needs to meet the following requirements at the same time: 1) The selected gene fragments are required to have no less than 2 sites and have relatively consistent methylation levels; 2) The bladder cancer and adjacent tissues or normal control tissues are used for differential analysis, and the methylated gene fragments with high consistency in the bladder cancer samples and high differences with adjacent tissues or normal tissues are selected; 3) The methylation detection data of bladder cancer and healthy urine samples are used for differential analysis, and the gene fragments with significant differences in methylation between the two are selected; 4) Finally, the methylation performance of each gene is analyzed from the segments that meet the above 3 points, so as to obtain candidate methylated genes.

[0086] Finally, based on the modeling analysis of tissue sample data and the use of high-throughput methylation sequencing on clinical samples, we further screened out the highly specific and sensitive methylation markers ONECUT2, Septin9, CDO1, ZNF671, and HOXA9, and tested them in clinical bladder cancer tissues and urine samples. Ultimately, we determined that the CpG islands in the promoter regions of the three genes ONECUT2, Septin9, and ZNF671 were the best combination of detection targets.

[0087] Example 2: Sample preparation and gene methylation level detection method

[0088] Positive samples: a mixture of target gene non-methylated human genomic DNA and standard methylated human genomic DNA: 1 ng / μL containing 10% standard methylated human genomic DNA; 1 ng / μL containing 1% standard methylated human genomic DNA; 1 ng / μL containing 0.5% standard methylated human genomic DNA;

[0089] Negative samples: human genomic DNA with no target gene methylation verified by sequencing, 2ng / μL;

[0090] Methylation-sensitive restriction endonucleases: including HpaII and HinP1I;

[0091] Testing process:

[0092] PCR system configuration: Prepare the PCR reaction solution according to the reagent formula in Table 2 below based on different detection targets.

[0093] Table 2

[0094]

[0095]

[0096] The sample was added to the PCR reaction tube at 10 μL / reaction, and then 40 μL of PCR reaction solution was added in sequence. The PCR tube was capped, vortexed to mix, and then centrifuged for 5 seconds.

[0097] Fluorescence PCR reaction and result analysis

[0098] 1) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order.

[0099] 2) Fluorescence detection channel selection: select FAM channel (Reportere: FAM, Quencher: None) to detect ONECUT2; select HEX channel (Reportere: HEX, Quencher: None) to detect Septin9; select ROX channel (Reportere: ROX, Quencher: None) to detect ZNF671; select CY5 channel (Reportere: CY5, Quencher: None) as internal standard to detect housekeeping gene β-Actin;

[0100] 3) Fluorescence quantitative PCR reaction conditions are as shown in Table 3:

[0101] Table 3

[0102]

[0103]

[0104] 4) Result analysis

[0105] After the reaction is finished, the instrument automatically saves the results and uses the instrument's own software for automatic analysis (you can also manually adjust the baseline start value, end value, and threshold line value for analysis). The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the cycle value experienced when the fluorescent signal in the PCR reaction tube reaches the set threshold). Figures 1-2 As shown, the reagent of the present invention can detect 0.05ng / reaction positive sample ( Figure 1 ), no non-specific amplification in 20 ng / reaction of non-methylated DNA ( Figure 2 ).

[0106] Example 3: Detection of bladder cancer tissue and adjacent tissue

[0107] Paraffin section samples of 20 bladder cancer tissues and 20 adjacent paracancerous tissues were collected.

[0108] The paraffin tissue samples were extracted using the Shengxiang Bio S1008 nucleic acid extraction kit; the nucleic acid sample enzyme digestion and PCR amplification detection were performed in the same reaction tube according to the process of Example 1. The clinical results were interpreted in the following manner: the Ct value of the internal standard gene β-Actin was used to determine whether the experimental results met the quality control requirements. If the Ct value was >27, it would not be included in the result statistics; according to the minimum detection limit of the detection reagent, the positive judgment Ct value of the three target genes ONECUT2, Septin9, and ZNF671 was set to 32. Table 4 shows the Ct values ​​of the fluorescence quantitative PCR test results of 40 samples, where "Un" means no gene amplification and no Ct value. The test results of 20 bladder cancer tissue samples (T001-T020) were all positive, and the test results of 20 adjacent tissue samples (P001-P020) were all negative, indicating that the gene expression levels of the three target genes ONECUT2, Septin9, and ZNF671 in bladder cancer tissues were higher than those in adjacent tissues ( Figure 3 ).

[0109] Table 4

[0110]

[0111]

[0112]

[0113] Example 4: Results of using the composition of the present invention to detect clinical samples by methylation fluorescence quantitative PCR

[0114] A total of 135 clinical urine samples were collected, including 55 urine samples from bladder cancer patients, 40 urine samples from healthy people, and 40 urine samples from patients with other cancers; paraffin sections of cancer tissues from 81 bladder cancer patients were also collected.

[0115] The urine free DNA was extracted using a free DNA extraction kit; according to Example 3, the paraffin tissue sample was extracted using the Shengxiang Bio S1008 nucleic acid extraction kit; according to the process of Example 2, the nucleic acid sample was subjected to enzyme digestion and PCR amplification detection in the same reaction tube. The interpretation was performed according to the interpretation method of Example 3. The detection sensitivity and specificity of this kit in urine samples were 89.1% and 95% respectively, and the detection sensitivity in tissue samples was 100%. The specific results are shown in Table 4.

[0116] Table 4

[0117]

[0118] Tissue sample detection sensitivity (%) = number of positive detections / total number of positive cases * 100% = 100%

[0119] Urine sample detection sensitivity (%) = number of positive detections / total number of positive cases * 100% = 89.1%

[0120] Urine sample test specificity (%) = total number of negative detections / total number of negative samples * 100% = 95%

[0121] Cancer type specificity (%) = number of negative detections in non-bladder cancer patients / total number of non-bladder cancer patients * 100% = 95%, wherein negative samples are the sum of all non-bladder cancer patient samples.

[0122] In summary, the sensitivity of using ONECUT2, Septin9, and ZNF671 three-target combination markers for detecting bladder cancer tissue samples is 100%, indicating that these three detection targets are bladder cancer tissue-specific methylation genes and are closely related to bladder cancer; using the target combination markers of the present invention to detect urine samples from non-bladder cancer patients, the specificity reached 95%, indicating that this detection system has good cancer specificity; using the target combination markers of the present invention to detect urine samples from bladder cancer patients, the sensitivity reached 89.1%, the specificity reached 95%, and the detection performance was better than urine cytology.

[0123] Example 5: Results of sequencing of clinical samples using the composition of the present invention

[0124] Sequencing verification: First, the samples were processed to obtain nucleic acids, and the nucleic acids that passed the quality control were treated with bisulfite. Then, the sequencing library was constructed, and the DNA clusters were amplified on the sequencing chip by bridge PCR. The DNA sequence was determined by detecting the fluorescence signal using the sequencing by synthesis technology, and the sequencing data were quality controlled, aligned, and analyzed to finally obtain the sample sequencing results. The specific results are shown in Table 5.

[0125] Table 5

[0126]

[0127] The sequencing method was used to perform methylation detection and verification on the three gene regions of ONECUT2, SEPT9, and ZNF671 as shown in SEQ ID NOs: 1 to 3 in clinical samples. The results also showed that the target combination of the present invention has high sensitivity and specificity for bladder cancer detection.

[0128] The results of clinical sample testing by different methods can also prove that the gene regions of the present invention can themselves be used as markers for detecting bladder cancer, and the effects of the markers will not be significantly affected by the different detection methods.

[0129] Comparative Example 1: Comparison of the performance of methylation detection samples in different segments of the gene region of the present invention

[0130] The methylation levels of different segments of the three gene regions were detected using the method of Example 4. The detection regions are shown below.

[0131] The ONECUT2 detection sequence is shown in SEQ ID NO: 16:

[0132] AGCGCTCCTGGAGCCATCTCTGGCCTTGGCGTTGGCGCAGGGACTTTCT

[0133] GACCGGGCTTGAGGGGGCTCGGGCCAGCTCCAATGTCACTACCTACAGCGA

[0134] GGGCAGGGTGTAAGGTTGAGAAGGTCACATTCACCGCTTTGGGAGGACG

[0135] TGGGAGAAGAGACTGAGGTGGAAAGCGCTTTGCCTTGCTCACCGGCCGT

[0136] CCTTGCCCCGGTCCCAGCGTTTGCTGGGATTTGCCAGGATTTGCCGGGGC

[0137] TCCGGGAGACCCTGAGCACTCGCAGGAAGAGGTGCTGAGAAATTAAAAATTCAGGTTAGTTAATGCATCCCTGCCGCCGGCTGCAGGCTCCGCCTTT;

[0138] The ZNF671 detection sequence is shown in SEQ ID NO: 17:

[0139] TTGAGACAGAGTCTCGCTCTGTCTCCCAGGCTGCAGTGCAGTGGCCGAT

[0140] CTCGGCTGACTGCAACCTCCGCCTCCCGGGTTCAAGCGATTCTCCTGCCT

[0141] CAGCCTCCCAAGTAATTGGGACTACAGGGGCCCGCCACCACGCCAGGCTA

[0142] ATTTTAGTACTTTTAGCAGAGTACGGGATTTCACCATGTTGGCCAGGCTGG

[0143] TCTCGAACTCCTGACTTTGTGATTTGCCTGCTTCGGCCTCCCAAAGTGCTG

[0144] GGATTACAGGAGTGAGCCATGGTGCCCGGCTGACTTCTGTCCTCTTAAAAGGCCTG;

[0145] The Septin9 detection sequence is shown in SEQ ID NO: 18:

[0146] GTGCGCTGCCGTTTAACCCTTGCAGGCGCAGAGCGCGCGGCGGCGGTGA

[0147] CAGAGAACTTTGTTTGGCTGCCCAAATACAGCCTCCTGCAGAAGGACCCT

[0148] GCGCCCGGGGAAGGGGAGGAATCTCTTCCCCTCTGGGCGCCCGCCCTCCT

[0149] CGCCATGGCCCGGCCTCCACATCCGCCCACATCTGGCCGCAGCGGGGCGC

[0150] CCGGGGGGAGGGGCTGAGGCCGCGTCTCTCGCCGTCCCCTGGGCGCGGG

[0151] CCAGGCGGGGAGGAGGGGGGCGCTCCGGTCGTGTGCCCAGGACTGTCCCCCAGCGG.

[0152] The specific primers and probes are shown in Table 6 below.

[0153] Table 6

[0154]

[0155] The urine free DNA was extracted using a free DNA extraction kit; according to Example 3, the paraffin tissue sample was extracted using the Shengxiang Bio S1008 nucleic acid extraction kit; according to the process of Example 2, the nucleic acid sample was subjected to enzyme digestion and PCR amplification detection in the same reaction tube. The interpretation was performed according to the interpretation method of Example 3. The detection sensitivity and specificity of this kit in urine samples were 74.55% and 72.5%, respectively, and the detection sensitivity in tissue samples was 82.72%. The specific results are shown in Table 7.

[0156] Table 7

[0157]

[0158]

[0159] Comparative Example 2: Comparison of methylation detection performance of different combinations in clinical urine samples

[0160] A three-target combined detection system was constructed for the five targets ONECUT2, ZNF671, CDO1, Septin9, and HOXA9, and these combinations were subjected to sensitivity tests in clinical urine samples of bladder cancer and specificity tests in urine samples of healthy subjects according to the methods of the above embodiments. The specific results are shown in Table 8. It can be seen from the table that not any combination of related genes can obtain a good detection effect. The combination of the present invention is specific, and its detection effect is better than that of other gene combinations.

[0161] Table 8

[0162]

Claims

1. A composition for detecting bladder cancer, characterized in that The composition includes a detection reagent for detecting the methylation level of at least two of the following regions: The region of the ONECUT2 gene as shown in SEQ ID NO: 1; The region of the Septin9 gene as shown in SEQ ID NO: 2; and The region of the ZNF671 gene as shown in SEQ ID NO:

3.

2. The composition according to claim 1, characterized in that The composition includes a detection reagent for detecting the methylation level of the following regions: The region of the ONECUT2 gene as shown in SEQ ID NO: 1; The region of the Septin9 gene as shown in SEQ ID NO: 2; and The region of the ZNF671 gene as shown in SEQ ID NO:

3.

3. The composition according to claim 1, characterized in that The detection reagent is a detection reagent used in methylation sequencing, methylation chip, or methylation fluorescence quantitative PCR to detect methylation levels.

4. The composition according to claim 3, characterized in that The detection reagents are nucleic acid primers and nucleic acid probes, and the nucleic acid primers and nucleic acid probes are: Any one or more sets of nucleic acid primers and probes shown in SEQ ID NOs: 4 to 12.

5. The composition according to claim 4, characterized in that The composition further comprises an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for monitoring.

6. Use of the composition according to any one of claims 1 to 5 in the preparation of a kit for detecting bladder cancer.

7. A kit for detecting bladder cancer, comprising the composition according to any one of claims 1 to 5.

8. The kit according to claim 7, characterized in that The kit also includes at least one of a reagent for extracting nucleic acid and a reagent for purifying nucleic acid; the reagent for extracting nucleic acid is a reagent for extracting free DNA in urine.

9. The kit according to claim 8, characterized in that The kit also includes dNTPs, Mg 2+ , at least one of a methylation-sensitive restriction endonuclease, a PCR buffer, and a hot-start enzyme.

10. The kit according to claim 9, characterized in that The methylation-sensitive restriction endonuclease is selected from at least one of HpaII and HinP1I.

Images