A molecular marker associated with resistance to sheep mycoplasma pneumonia and its application

By discovering the significant association site chr14:13215150 of the FOXF1 gene on the sheep genome, a KASPar primer pair was designed to detect the A/G polymorphism and screen out sheep with the AA genotype, thus solving the problem of evaluating the resistance of sheep to Mycoplasma pneumonia lesions and improving breeding efficiency and economic benefits.

CN119433047BActive Publication Date: 2025-09-19LANZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411780261.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-05
Publication Date
2025-09-19
Estimated Expiration
2044-12-05

AI Technical Summary

Technical Problem

The existing technology lacks effective molecular markers for evaluating sheep's resistance to ovine Mycoplasma pneumonia lesions, which makes it difficult to select sheep individuals with high resistance during breeding, affecting the economic benefits of the sheep farming industry.

Method used

Through genome-wide association study (GWAS), a significant association site of FOXF1 gene at chr14:13215150 was found in the sheep genome. KASPar primer pair was designed to detect A/G polymorphism, and sheep individuals with AA genotype were screened as individuals with excellent resistance for breeding.

Benefits of technology

It has achieved effective evaluation of sheep's resistance to mycoplasma pneumonia lesions, improved the accuracy and efficiency of breeding, saved costs, bred highly resistant sheep, and improved the economic benefits of the sheep farming industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005172598270000081
    Figure BDA0005172598270000081
  • Figure HDA0005172598280000011
    Figure HDA0005172598280000011
  • Figure HDA0005172598280000012
    Figure HDA0005172598280000012
Patent Text Reader

Abstract

The present invention provides a molecular marker associated with resistance to Mycoplasma pneumonia lesions in sheep and its application. The molecular marker was screened from the FOXF1 gene in a GWAS of lung tissue pathology scores. DNA was extracted from sheep blood, and the polymorphic sites of 203 Hu sheep were detected using KASPar primers. A least squares model was established, and the genotypes of the polymorphic sites in the 203 Hu sheep were associated with the pneumonia lesion phenotypic data. Ultimately, it was determined that the FOXF1 gene and its related SNPs screened by the present invention can be used as molecular markers associated with resistance to Mycoplasma pneumonia lesions in sheep. The molecular markers associated with resistance to Mycoplasma pneumonia lesions provided by the present invention can be used to screen high-quality meat sheep with high resistance to Mycoplasma pneumonia, providing a genetic engineering method for rapid screening of disease-resistant sheep breeding, and having significant practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology, and particularly relates to a FOXF1 gene as a molecular marker associated with resistance to sheep mycoplasma pneumonia lesions and an application thereof. Background Art

[0002] Pneumonia, a respiratory disease, is a common disease prevalent in large sheep herds across all major sheep-producing countries. Studies have reported a prevalence of severe pneumonia lesions at slaughter ranging from 21% to 93%. Mycoplasma ovipneumoniae (MO) is a significant pathogen causing pneumonia, with evidence of MO colonization detected in approximately 90% of pneumonia-related clinical procedures. MO was first isolated and described from Australian sheep herds, where lamb pneumonia is prevalent. Symptoms of MO infection primarily include coughing, wheezing, progressive weight loss, and proliferative inflammation of the interstitial lungs. Furthermore, MO is characterized by an unusually broad host range, a highly contagious phenotype, strong infectivity, and high morbidity, and it readily triggers secondary or coinfection with other bacteria. Further complicating matters, MO can be detected in the lungs of lambs in the absence of overt clinical signs or severe endemic pneumonia. Disease resistance and susceptibility are the most commonly targeted disease response traits in farm animal breeding programs because they represent natural and unique mechanisms of host response to infectious pathogens. There is well-documented evidence that there are inter-animal differences in the ability of livestock to resist a variety of economically important diseases, including respiratory diseases. Previous studies in sheep and cattle have suggested that there is a potential genetic component in the differences in pneumonia susceptibility observed between animals. More importantly, tools such as genome-wide association studies (GWAS) can identify and locate tens of thousands of high-density single nucleotide polymorphism (SNP) sites in a population and screen for SNPs that affect phenotypic traits. GWAS can identify genomic regions associated with potential causal mutations that affect susceptibility to infectious diseases. The discovery of these regions and sites may also lead to the establishment of new disease diagnostic tools and alternative therapies. Therefore, the use of molecular biology and molecular genetics techniques to locate molecular markers associated with phenotypic associations, identify disease-resistant genes for disease-resistant breeding, and improve the genetic disease resistance of livestock and poultry themselves has become an effective supplement to traditional livestock and poultry disease prevention and control methods.

[0003] When faced with chronic or acute sheep pneumonia, it is necessary to consider mortality and subclinical effects, as chronic pneumonia may gradually recover from the disease, while acute pneumonia symptoms are severe and may even lead to death. Detection of chronic non-progressive pneumonia usually requires autopsy or post-slaughter lung examination. The main pathological changes caused by MO infection include pulmonary consolidation, inflammatory cell infiltration and vascular lesions. Based on the individual's tolerance to pathogens, bacterial load does not fully represent the severity of the lesion, and uneven bacterial colonization also makes it difficult to obtain accurate load data. It is generally believed that intuitive judgment of lesion severity can better understand the response and resistance of sheep to MO infection. Inflammatory lung damage is usually evaluated and quantified by histopathological scoring, which has also been reported in some existing studies. Higher scores indicate more severe lesions and lower individual resistance to pneumonia.

[0004] FOXF1 is a member of the forkhead box (FOX) family of transcription factors. FOXF1 stimulates lung repair and regeneration by regulating key genes involved in extracellular matrix remodeling, inflammation, and endothelial barrier function. FOXF1 has been identified as an anti-fibrotic factor, modulating key functions of myofibroblasts by preventing CDH2-CDH11 cadherin conversion and reducing lung inflammation during pulmonary fibrosis. Furthermore, FOXF1 expression is enriched in lung endothelial cells compared to endothelial cells in other organs, such as the liver, pancreas, brain, heart, and kidney. One study reported that activation of lung epithelial progenitor cells (EPCs) through FOXF1-mediated BMP9 / ACVRL1 signaling promotes angiogenesis and alveolarization in neonatal lungs. Numerous studies have highlighted the critical role of FOXF1 in lung-related functions, but most have focused on humans or mice, and no studies have examined its relevance to sheep lung disease. Whether the FOXF1 gene contributes to the phenotypic pathology of pneumonia remains unclear, as do the presence of significant association loci and the presence and absence of association lines. There are no reports on molecular markers related to resistance to Mycoplasma pneumoniae lesions in sheep and their applications. Summary of the Invention

[0005] The present invention aims to provide a molecular marker associated with resistance to Mycoplasma pneumonia in sheep and its application. Through GWAS of the pneumonia phenotype, the present invention identified significant associated sites on the sheep genome and their annotated gene, FOXF1. Further research revealed the correlation between the significant associated site (chr14:13215150) located 192,315 bp from the FOXF1 gene and its different genotypes and Mycoplasma pneumonia in sheep. This provides a reference for sheep disease-resistant breeding and offers genetic engineering tools for the development of Mycoplasma pneumonia-resistant sheep breeds, thereby accelerating the disease-resistant breeding process.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A molecular marker associated with resistance to Mycoplasma pneumonia in sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1. The R at the 188th bp position represents either A or G, and this mutation results in an A / G polymorphism in the molecular marker. The molecular marker is located 192,315 bp downstream of the FOXF1 gene. This site, chr. 14:13215150, contains an A / G mutation, resulting in the A / G polymorphism at this associated site in sheep.

[0008] As described above, the molecular marker related to the resistance to mycoplasma pneumonia lesions in sheep is used in sheep assisted breeding. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 188th bp represents A or G, and the mutation results in the A / G polymorphism of the molecular marker; among which individuals carrying the AA genotype have significantly higher resistance to mycoplasma pneumonia lesions than individuals carrying the AG genotype, and higher than individuals carrying the GG genotype.

[0009] The KASPar primer pair for detecting the molecular marker associated with resistance to ovine Mycoplasma pneumonia lesions as described above is characterized in that it includes nucleotide sequences as shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0010] The detection kit for detecting the molecular marker related to the resistance to ovine mycoplasma pneumonia lesions as described above is characterized in that the detection kit comprises a primer pair with nucleotide sequences as shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0011] The method for detecting the molecular marker associated with resistance to Mycoplasma pneumonia lesions in sheep as described above is characterized in that it includes amplifying DNA provided from the blood of the sheep to be tested, and identifying the specific site where R is A or G at the 188th bp of the nucleotide sequence of the amplified product as shown in SEQ ID NO.1, wherein individuals carrying the AA genotype have significantly higher resistance to Mycoplasma pneumonia lesions than individuals carrying the AG genotype, and higher than individuals carrying the GG genotype.

[0012] Furthermore, the amplification uses a primer pair whose nucleotide sequences are shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0013] Application of the KASPar primer pair, detection kit or method for detecting the molecular markers associated with the resistance to Mycoplasma ovis pneumoniae lesions as described above in screening for the detection of high resistance to Mycoplasma ovis pneumoniae lesions.

[0014] The use of the KASPar primer pair, detection kit or method for detecting the molecular marker related to the resistance to sheep mycoplasma pneumonia lesions as described above in sheep breeding, further, the breeding is to cultivate a sheep breed with high resistance to mycoplasma pneumonia lesions; when the R at the 188th bp of the nucleotide sequence of the molecular marker as shown in SEQ ID NO.1 is an A or G polymorphism, when the resistance to sheep mycoplasma pneumonia lesions carrying the AA genotype is significantly higher than that of individuals carrying the AG genotype, and higher than that of individuals carrying the GG genotype.

[0015] The beneficial effects of the present invention are:

[0016] The present invention provides a molecular marker associated with resistance to mycoplasma pneumonia lesions in sheep. The FOXF1 gene is obtained through screening as a gene for screening molecular markers associated with resistance to mycoplasma pneumonia lesions in sheep. The obtained molecular marker is an A / G polymorphic site located 192,315 bp downstream of the FOXF1 gene. Sheep individuals with an AA genotype at this site have relatively good resistance to mycoplasma pneumonia, that is, sheep individuals carrying the AA genotype have significantly higher resistance to mycoplasma pneumonia lesions than those carrying the AG genotype, and higher than those carrying the GG genotype.

[0017] The present invention also provides the use of a primer pair, a detection kit, or a detection method for detecting the molecular marker in detecting resistance to Mycoplasma ovipneumoniae. By determining the polymorphic genotype of the molecular marker, sheep with the dominant trait can be effectively identified, providing an effective detection method for the selection and breeding of sheep resistant to Mycoplasma pneumoniae. By detecting the polymorphic sites of the molecular marker, the present invention can be used to select sheep with the AA homozygous genotype as breeding sheep for breeding, thereby accelerating the screening of sheep with better resistance to Mycoplasma pneumoniae, effectively saving costs, breeding high-quality Mycoplasma pneumoniae-resistant meat sheep, and contributing to improving the economic benefits of the sheep farming industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure shows the Manhattan plot of the significant associated loci annotated for the sheep FOXF1 gene as a molecular marker; wherein the loci significantly associated with the pneumonia phenotype are located on chromosome 14.

[0019] Figure 2 This is the KASPar SNP typing result of the sheep chr.14:g.13215150A>G mutation site in the present invention; among them, the blue dot near the right side represents the AA genotype, the red dot near the middle represents the AG or GA genotype, and the green dot near the left side represents the GG genotype.

[0020] Figure 3 Schematic diagram of lung tissue pathology scoring.

[0021] Figure 4This is the result of the association analysis between different genotypes of individual sheep mutation sites and FOXF1 gene expression levels in the present invention. DETAILED DESCRIPTION

[0022] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all fall within the scope of the present invention.

[0023] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the examples are of analytical grade or above.

[0024] Example 1 Establishment of Genotyping Detection Method

[0025] (1) Primer sequence design

[0026] The present invention combines 266 lung pathology score phenotype data and GWAS results of 23480428 SNP data filtered from 912 sheep (such as Figure 1 ) and screened for genes influencing phenotypic traits. Comparison and analysis of extensive whole-genome resequencing data revealed a significant association site on the sheep genome (chr14:13215150), located 192,315 bp from the FOXF1 gene. The site is located at bp 188 of the nucleotide sequence shown in SEQ ID NO. 1, where R represents A or G.

[0027] The above SEQ ID NO.1:

[0028] GTTTCTCTCAGTGCTGACCTCCATGGCCTAGGATGTGGGTCAGCACACAGTAGGTGCCTAATAACTACCCAGAGAATGGATGGATTCCCCGTGGTCCCTCCCCTGCCTCTCTCACCCTCATCCTCTGCAAGCTCCAGGAG CCCAGAGGGCACCAGCTGGCGTGACGAGTAACAGCCTGGACAGGCRGACACCAGCCCCTCCCTCCGTAACGTCCTCCTCCTCATCTGTATGCGGTCTCCCTCGCTACGAGTAACCTGGCACCAACCCCGCCATACCTCCA

[0029] A conserved sequence was selected near the A / G polymorphic site at chr.14:13215150. The specific sequence is shown in SEQ ID NO.1, where R at the 188th bp represents A or G. A KASPar primer pair was designed for the polymorphic site where R at the 188th bp represents A or G, thereby specifically detecting the polymorphic site. The nucleotide sequence of the KASPar primer pair is as follows: Forward primer A1 for detecting AlleleA (SEQ ID NO.2):

[0030] 5′-GAAGGTGACCAAGTTCATGCTGAGTAACAGCCTGGACAGGCA-3′;

[0031] Forward primer A2 for detecting AlleleG (SEQ ID NO.3):

[0032] 5′-GAAGGTCGGAGTCAACGGATTAGTAACAGCCTGGACAGGCG-3′;

[0033] Universal reverse primer C (SEQ ID NO. 4): 5'-GAGGGAGACCGCATACAGATG-3'.

[0034] The above primers were synthesized by Beijing Sangon Biotechnology Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer A1:forward primer A2:universal reverse primer C.

[0035] (2) DNA quality control

[0036] Blood was collected from sheep and frozen at -20°C. DNA was extracted using a kit. The quality of the extracted genomic DNA was then tested by 1% agarose gel electrophoresis and Nanodrop 2100. Requirements for the DNA template were: single DNA bands with no significant smearing on agarose gel electrophoresis; an A260 / 280 ratio between 1.8 and 2.0 on Nanodrop 2100, indicating the absence of protein contamination; an A260 / 230 ratio between 1.8 and 2.0, indicating a low salt ion concentration; and the absence of significant absorbance at 270 nm, indicating the absence of phenol contamination. Based on the KASP assay technology and genome size from LGC (UK), the DNA dosage was calculated to be 10-20 ng / sample. The DNA template was diluted to a concentration of 10-20 ng / μL for later use.

[0037] (3) Genotyping

[0038] First, using a K-pette dispensing workstation, 1.5 μL of the diluted test DNA template (10–20 ng / μL) and a blank control (NTC) were added to a 384-well reaction plate. The plates were dried at 60°C for 30 min (in a drying oven, LGC) to obtain a dry powder for later use. Then, using a Meridian sample dispensing workstation under the Kraken operating system, 1× Master Mix (Part No. KBS-1016-011 for 1536 microplates) and a primer mix were added to each reaction well. After dispensing, the microplates were immediately sealed using a Kube heat sealer and then a Fusion laser sealer. High-throughput waterbath PCR amplification was performed using a Hydrocycler. The PCR reaction was performed in a high-throughput waterbath system using the following procedure:

[0039] Pre-denaturation at 94°C for 15 minutes;

[0040] 94°C, 20 seconds (denaturation) - 61°C-55°C, 1 minute (annealing & extension), 10 cycles of touch-down amplification, decreasing 0.6°C per cycle;

[0041] Amplification was continued for 26 cycles: 94°C, 20 seconds (denaturation) - 55°C, 60 seconds.

[0042] After amplification, the BMG PHERAstar instrument was used to detect the fluorescence signal and check the typing. The specific results can be seen as follows: Figure 2 As shown in the figure, each dot represents a sample to be tested, where the green dot close to the left indicates that the site is a homozygous genotype "GG"; the blue dot close to the right indicates that the site is a homozygous genotype "AA"; the red dot close to the middle indicates that the site is a heterozygous genotype "AG" or "GA"; the gray dot indicates typing failure.

[0043] (4) Application of the molecular markers of the present invention in association analysis of marker traits of sheep Mycoplasma pneumonia

[0044] The experiment will detect the polymorphism of the site in 203 Hu sheep, group them according to genotype, and establish the least squares model as described below to conduct association analysis between genotype and sheep Mycoplasma pneumonia phenotype.

[0045] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0046] Among them, Y ijklis the observed value of the trait, μ is the overall mean, and Genotype i is the genotype effect, P j is the batch effect, F k is the paternal effect, M l is the maternal effect, ε ijkl is a random error, assuming that ε ijlmk Independent of each other, obey N(0, σ 2 )distributed.

[0047] The genotype test results showed that among the 203 individuals, there were 116 individuals with AA genotype, 78 individuals with AG genotype, and 9 individuals with GG genotype; the phenotypic characteristics of Hu sheep Mycoplasma pneumonia were lung tissue pathology scores, specifically hematoxylin-eosin staining of lung tissue, and the scoring example was as follows: Figure 3 As shown, the lesion scores are as follows: +1, mild +2, mild +3, moderate +4, severe; +5, very severe. In the figure, the triangle indicates that some alveoli maintain their original structure; the five-pointed star indicates that some bronchial lumens contain a large number of neutrophils and lymphocytes (+1); the green arrow indicates hyperplasia of some peribronchial lymphoid follicles (+1); the blue arrow indicates compensatory expansion of some alveoli (+2); the orange arrow indicates inflammatory cell infiltration at the junction of the pulmonary interstitium and the lung parenchyma (+2); the yellow arrow indicates partial collapse of the lung tissue and substantial lesions, mainly filled with monocytes (+2). The higher the score, the more severe the lung damage caused by mycoplasma pneumonia and the lower the ability to resist mycoplasma pneumonia. The results of the genotype and trait association analysis are shown in Tables 1 and Figure 4 shown.

[0048] Table 1 Association analysis between sheep chr.14:13215150 polymorphism and mycoplasma pneumonia lesions

[0049]

[0050] Note: Data in the same row with different letters in the superscript indicate significant differences (p<0.05), while data with the same letters in the superscript indicate no significant differences (p>0.05).

[0051] The chr.14:g.13215150A>G mutation site was significantly associated with mycoplasma pneumonia lesions in Hu sheep (p<0.05). The pathological score of individuals with the AA genotype was 5.99±0.55, which was significantly lower than the pathological score of individuals with the AG genotype (8.23±0.81) (P<0.05) and the pathological score of individuals with the GG genotype (7.22±2). The results showed that sheep carrying the AA genotype had significantly higher resistance to mycoplasma pneumonia lesions than those carrying the AG genotype. The difference in mycoplasma pneumonia lesion resistance between sheep carrying the AG genotype and those carrying the GG genotype was not significant, indicating that the AA genotype has a higher resistance to mycoplasma pneumonia lesions.

[0052] In summary, when breeding, it is considered to select sheep with AA genotype for seed preservation, which have better resistance to mycoplasma pneumonia lesions. Artificial insemination with semen of rams with AA genotype during breeding can be used to breed high-quality meat sheep resistant to mycoplasma pneumonia, thereby improving production efficiency and being low-carbon and environmentally friendly.

Claims

1. A KASPar primer pair for detecting molecular markers associated with resistance to Mycoplasma pneumoniae lesions in sheep breeding, wherein the purpose is to cultivate sheep breeds with high resistance to Mycoplasma pneumoniae lesions, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 188th bp position is A or G, and this mutation results in the A / G polymorphism of the molecular marker; individuals carrying the AA genotype have significantly higher resistance to mycoplasma pneumonia lesions than individuals carrying the AG genotype, and higher than individuals carrying the GG genotype.

2. The use according to claim 1, characterized in that The nucleotide sequences of the KASPar primer pair are shown as SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO.

4.

3. A detection kit for detecting molecular markers associated with resistance to Mycoplasma pneumonia in sheep breeding, wherein the purpose is to cultivate sheep breeds with high resistance to Mycoplasma pneumonia, characterized in that: The detection kit includes a primer pair having nucleotide sequences as shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4; The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, wherein R at the 188th bp position is A or G, and this mutation results in the A / G polymorphism of the molecular marker; individuals carrying the AA genotype have significantly higher resistance to mycoplasma pneumonia lesions than individuals carrying the AG genotype, and higher than individuals carrying the GG genotype.

4. A method for detecting molecular markers associated with resistance to Mycoplasma pneumonia in sheep, for use in sheep breeding, wherein the method is to cultivate sheep breeds with high resistance to Mycoplasma pneumonia, characterized in that: The method comprises extracting DNA from the blood of a sheep to be tested, amplifying the DNA, and identifying the specific site where R is A or G at the 188th bp of the nucleotide sequence of the amplified product as shown in SEQ ID NO.1, wherein individuals carrying the AA genotype have significantly higher resistance to mycoplasma pneumonia lesions than individuals carrying the AG genotype, and higher resistance than individuals carrying the GG genotype.

5. The use according to claim 4, characterized in that The amplification used primer pairs whose nucleotide sequences are shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.

4.

6. The use according to claim 4, characterized in that After amplification, the typing results are determined by detecting the fluorescence signal.

Citation Information

Patent Citations

  • A method for screening genotypes of resistance to Mycoplasma pneumoniae in sheep.

    CN102277425A

  • Molecular marker related to immune traits of sheep as well as detection method and application of molecular marker

    CN115478111A