Dengue virus typing detection kit based on multiple fluorescent quantitative PCR (Polymerase Chain Reaction) and detection method of dengue virus typing detection kit

Abstract

The invention provides a dengue virus typing detection kit based on multiple fluorescent quantitative PCR and a detection method thereof, and belongs to the technical field of molecular diagnostic biology. The dengue virus typing detection kit based on multiple fluorescent quantitative PCR comprises multiple PCR reaction liquid, a dengue virus positive quality control and a dengue virus negative control, the multiplex PCR reaction liquid comprises four specific probes and four pairs of specific primers which are respectively used for detecting the dengue virus type I, the dengue virus type II, the dengue virus type III and the dengue virus type IV. Based on the kit, accurate and quantitative detection of the dengue virus typing and the copy number thereof can be simply, conveniently and efficiently realized through the steps of treating a sample, preparing a reaction system, performing PCR amplification, reading a fluorescence signal, performing quantitative analysis and the like. In addition, by optimizing the design and the detection process of the fluorescent probe, the sensitivity and the accuracy of detection are remarkably improved.

Description

Technical Field

[0001] The invention relates to the technical field of molecular diagnostic biology, and in particular to a dengue virus typing detection kit based on multiplex fluorescence quantitative PCR and a detection method thereof. Background Art

[0002] Dengue virus (DENV) belongs to the genus Flavivirus of the family Flaviviridae. DENV was first isolated from human blood samples in Japan in 1943, and since then, DENV has been divided into four serotypes (DENV1-4) based on phylogenetic analysis and antigenic epitope analysis. In China, all four serotypes of DENV have caused outbreaks of dengue fever. DENV is carried and transmitted by mosquitoes of the genus Aedes, and Aedes aegypti is the main vector of DENV virus. Dengue fever outbreaks in China are mainly transmitted by Aedes aegypti and Aedes albopictus. Under suitable climatic conditions, imported DENV may infect the vector population. Symptoms of DENV infection usually include high fever, headache, vomiting, muscle and joint pain, and rash. In a small number of cases, the disease develops into severe dengue hemorrhagic fever or dengue shock syndrome, resulting in a high mortality rate among patients. However, there is currently no vaccine or antiviral treatment specifically for dengue virus.

[0003] At present, the separation and cultivation of DENV virus is an important indicator of virus identification, but this method has a long incubation period and is not suitable for the rapid separation of viruses. In addition, virus separation and cultivation can only identify live viruses, and samples need to be kept at low temperatures during transportation. At the same time, virus separation and cultivation are very time-consuming, the sample virus content is small, and the cell pathological changes are often not obvious. It is necessary to blindly pass for many generations, and the virus species is also difficult to judge. The ELISA method established in the prior art can be used to diagnose dengue fever in advance. This method has high sensitivity and strong specificity. It is recommended by the World Health Organization as the gold standard for detecting mosquito-borne viruses, but this technology must use live hosts and live viruses, and the experimental safety requirements are high, which limits its development in ordinary laboratories.

[0004] Polymerase chain reaction (PCR) is a molecular method widely used to detect and identify pathogenic viruses. It is an in vitro enzymatic process that can exponentially amplify a single or a few copies of DNA to thousands to millions of copies. Because it is fast, cheap and simple, it has become one of the most widely used techniques in molecular biology. However, the existing fluorescent quantitative detection method has the problem of insufficient sensitivity in detecting dengue virus.

[0005] In view of this, a new method is urgently needed to improve the sensitivity and accuracy of dengue virus detection. Summary of the invention

[0006] In view of the technical problems existing in the background technology, the present application provides a dengue virus typing detection kit and a detection method thereof based on multiplex fluorescence quantitative PCR, which significantly improves the sensitivity and accuracy of detection by optimizing the design of fluorescent probes and the detection process.

[0007] In the first aspect, an embodiment of the present application provides a dengue virus typing detection kit based on multiplex fluorescence quantitative PCR, comprising a multiplex PCR reaction solution, a dengue virus positive quality control and a negative control; the multiplex PCR reaction solution comprises four specific probes and four pairs of specific primers for detecting dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV, respectively.

[0008] In the technical solution of the embodiment of the present application, four non-interfering specific probes and four pairs of specific primers are designed for the dengue virus type I-IV genes, which can accurately and absolutely quantitatively type dengue virus types I-IV and improve detection efficiency.

[0009] In some embodiments, the four specific probes include:

[0010] Dengue virus type I probe as shown in SEQ ID NO: 1:

[0011] SEQ ID NO: 1: CAGTTGATTGGGTCCCAACCAGC;

[0012] Dengue virus type II probe as shown in SEQ ID NO: 2:

[0013] SEQ ID NO:2: TGGTGYTGCCGATCYTGCACATT;

[0014] Dengue virus type III probe as shown in SEQ ID NO: 3:

[0015] SEQ ID NO:3: TGCGGAACCAGAAACACCCAACA;

[0016] Dengue virus type IV probe as shown in SEQ ID NO:4:

[0017] SEQ ID NO:4:ACCACCTTTTCAATATGCTGAAACGCG.

[0018] In this embodiment, the dengue virus type I-IV genes were sequenced, the conserved regions were screened, and the temperature, length, GC value, etc. were set, and then four specific probes for type I-IV genes were designed, which effectively improved the specificity compared to conventional probes and had higher sensitivity.

[0019] In some embodiments, the 5' end fluorescent reporter group of the dengue virus type I probe is VIC, and the 3' end fluorescent quencher group is MGB, which is specifically represented as follows:

[0020] 5'-VIC-CAGTTGATTGGGTCCCAACCAGC-MGB-3';

[0021] The 5' end fluorescent reporter group of the dengue virus type II probe is Cy5, and the 3' end fluorescent quencher group is MGB, which is specifically expressed as follows:

[0022] 5'-Cy5-TGGTGYTGCCGATCYTGCACATT-MGB-3';

[0023] The 5' end fluorescent reporter group of the dengue virus type III probe is FAM, and the 3' end fluorescent quencher group is MGB, which is specifically expressed as follows:

[0024] 5'-FAM-TGCGGAACCAGAAACACCCAACA-MGB-3';

[0025] The 5' end fluorescent reporter group of the dengue virus type IV probe is ROX, and the 3' end fluorescent quencher group is MGB, which is specifically expressed as follows:

[0026] 5'-ROX-ACCACCTTTTCAATATGCTGAAACGCG-MGB-3'.

[0027] In this embodiment, the detection efficiency and sensitivity can be further improved by specifically designing the 5'-end fluorescent reporter group and the 3'-end fluorescent quencher group of each probe.

[0028] In some embodiments, the four pairs of specific primers include:

[0029] The dengue virus type Ⅰ upstream primer as shown in SEQ ID NO:5 and the dengue virus type Ⅰ downstream primer as shown in SEQ ID NO:6:

[0030] SEQ ID NO:5: CTGTTCAGCCGTTCCAGTTG;

[0031] SEQ ID NO:6: TCCTCTATCCAAACCCTATTCCA;

[0032] The dengue virus type Ⅱ upstream primer as shown in SEQ ID NO:7 and the dengue virus type Ⅱ downstream primer as shown in SEQ ID NO:8:

[0033] SEQ ID NO:7:TTCTGCGAAGGAACCACAGT;

[0034] SEQ ID NO:8:GTACCAGCATCCGTCCTCAC;

[0035] The dengue virus type III upstream primer as shown in SEQ ID NO:9 and the dengue virus type III downstream primer as shown in SEQ ID NO:10:

[0036] SEQ ID NO:9: GACACACAGAAGACCCACCA;

[0037] SEQ ID NO:10: ATCCATGGTAAGCCCACGTTT;

[0038] The dengue virus type IV upstream primer as shown in SEQ ID NO: 11 and the dengue virus type IV downstream primer as shown in SEQ ID NO: 12:

[0039] SEQ ID NO: 11: CCGACAAGGACAGTTCTAAA;

[0040] SEQ ID NO:12: GGTTGATACGCGGTTTTCCT;

[0041] The above sequences are all labeled 5'-3'.

[0042] In this embodiment, based on the cooperation of the above four pairs of specific primers and four specific probes, dengue virus types I-IV can be specifically identified, and accurate quantitative typing of dengue virus types I-IV can be achieved, thereby improving detection efficiency and detection sensitivity.

[0043] In some embodiments, the dengue virus positive quality control includes positive control I, positive control II, positive control III, and positive control IV; the positive control I is a plasmid liquid carrying a dengue virus type I gene fragment; the positive control II is a plasmid liquid carrying a dengue virus type II gene fragment; the positive control III is a plasmid liquid carrying a dengue virus type III gene fragment; the positive control IV is a plasmid liquid carrying a dengue virus type IV gene fragment.

[0044] In some embodiments, the negative control is nuclease-free water.

[0045] In some embodiments, the multiplex PCR reaction solution further comprises 2×PerfeCT qPCR ToughMix UNG.

[0046] In a second aspect, the present application provides a method for quantitative detection of dengue virus typing based on multiplex fluorescence quantitative PCR, comprising the following steps:

[0047] S1. Extract the RNA template of the sample to be tested, and convert it into a DNA template as the sample to be tested;

[0048] S2. Add the multiple PCR reaction solution in the above-mentioned kit to the sample to be tested to prepare a PCR mixed solution of the drug to be tested;

[0049] S3. Performing PCR amplification on the PCR mixture of the drug to be tested;

[0050] S4. After the PCR amplification is completed, the fluorescent signal is read to calculate the copy numbers of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.

[0051] In the technical solution of the embodiment of the present application, through the above method, combined with external standards and standard curves, the four serotypes of dengue virus can be typed and quantitatively detected, and the detection efficiency is high, it can be stably implemented, the operation is simple and fast, and the detection time is only 4 hours, which is suitable for rapid detection of a large number of samples.

[0052] In some embodiments, in the PCR mixture of the drug to be tested, the volume concentration of the sample to be tested is 20%; the concentration of the dengue virus type I probe is 0.2 μM, and the concentrations of the dengue virus type I upstream primer and the downstream primer are both 0.2 μM; the concentration of the dengue virus type II probe is 0.4 μM, and the concentrations of the dengue virus type II upstream primer and the downstream primer are both 0.1 μM; the concentration of the dengue virus type III probe is 0.3 μM, and the concentrations of the dengue virus type III upstream primer and the downstream primer are both 0.1 μM; the concentration of the dengue virus type IV probe is 0.2 μM, and the concentrations of the dengue virus type IV upstream primer and the downstream primer are both 0.1 μM.

[0053] In some embodiments, when performing the PCR amplification, the annealing temperature is set at 60-63°C.

[0054] In the above embodiments, the sensitivity of the detection result can be improved by regulating the primer concentration, probe concentration and annealing temperature in the detection process.

[0055] The above description is only an overview of the technical solution of the present application. In order to more clearly understand the technical means of the present application, it can be implemented in accordance with the contents of the specification. In order to make the above and other purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are listed below. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the technical solution of the present application, the following is a brief introduction to the drawings used in the present application. Obviously, the drawings described below are only some embodiments of the present application, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0057] Figure 1 The primer concentration optimization results for dengue virus types I-IV;

[0058] Figure 2 Probe concentration optimization results for dengue virus types I-IV;

[0059] Figure 3 The results of annealing temperature optimization for dengue virus types I-IV;

[0060] Figure 4 It is the standard curve of fluorescent quantitative PCR of dengue virus type I-IV;

[0061] Figure 5 The fluorescence quantitative PCR amplification curve and PCR gel image results of dengue virus type I-IV;

[0062] Figure 6 A bar graph showing specific results for dengue virus types I-IV. DETAILED DESCRIPTION

[0063] The following embodiments of the technical solution of the present application are described in detail in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present application, and are therefore only used as examples, and cannot be used to limit the scope of protection of the present application.

[0064] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by technicians in the technical field to which this application belongs; the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit this application; the terms "including" and "having" in the specification and claims of this application and the above-mentioned figure descriptions and any variations thereof are intended to cover non-exclusive inclusions.

[0065] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present application. The appearance of the phrase in various locations in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0066] In order to solve the problem of low sensitivity and accuracy of existing dengue virus typing detection methods, the present application is directed to dengue virus type I-IV genes, and four non-interfering specific probes and four pairs of specific primers are designed for accurate absolute quantitative typing of dengue virus type I-IV, and to improve detection efficiency, sensitivity and accuracy of detection. The following is described in conjunction with specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present application, and cannot be construed as limitations on the present application. If specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product instructions are followed. The reagents or instruments used that do not indicate the manufacturer are all conventional products that can be purchased commercially.

[0067] Example 1

[0068] This embodiment provides a dengue virus typing detection kit based on multiplex fluorescence quantitative PCR, including multiplex PCR reaction solution, dengue virus positive quality control and negative control. Wherein, the multiplex PCR reaction solution includes 2×PerfeCT qPCR ToughMix UNG, upstream and downstream primers of dengue virus type I, upstream and downstream primers of dengue virus type II, upstream and downstream primers of dengue virus type III, upstream and downstream primers of dengue virus type IV, dengue virus type I probe, dengue virus type II probe, dengue virus type III probe, dengue virus type IV probe, as shown below:

[0069] Dengue virus type I upstream primer: 5′-CTGTTCAGCCGTTCCAGTTG-3′;

[0070] Dengue virus type I downstream primer: 5′-TCCTCTATCCAAACCCTATTCCA-3′;

[0071] Dengue virus type II upstream primer: 5′-TTCTGCGAAGGAACCACAGT-3′;

[0072] Dengue virus type II downstream primer: 5′-GTACCAGCATCCGTCCTCAC-3′;

[0073] Dengue virus type III upstream primer: 5′-GACACACAGAAGACCCACCA-3′;

[0074] Dengue virus type III downstream primer: 5′-ATCCATGGTAAGCCCACGTTT-3′;

[0075] Dengue virus type IV upstream primer: 5′-CCGACAAGGACAGTTCTAAA-3′;

[0076] Dengue virus type IV downstream primer: 5′-GGTTGATACGCGGTTTCTCT-3′;

[0077] Dengue virus type I probe: 5′-VIC-CAGTTGATTGGGTCCCAACCAGC-MGB-3′;

[0078] Dengue virus type II probe: 5′-Cy5-TGGTGYTGCCGATCYTGCACATT-MGB-3′;

[0079] Dengue virus type III probe:

[0080] 5'-FAM-TGCGGAACCAGAAACACCCAACA-MGB-3';

[0081] Dengue virus type IV probe:

[0082] 5'-ROX-ACCACCTTTTCAATATGCTGAAACGCG-MGB-3'.

[0083] The dengue virus positive quality control includes positive control I, positive control II, positive control III, and positive control IV; the positive control I is a plasmid liquid carrying a dengue virus type I gene fragment; the positive control II is a plasmid liquid carrying a dengue virus type II gene fragment; the positive control III is a plasmid liquid carrying a dengue virus type III gene fragment; the positive control IV is a plasmid liquid carrying a dengue virus type IV gene fragment. The negative control is nuclease-free water.

[0084] Example 2

[0085] This embodiment provides an operating procedure and a method for optimizing detection conditions for the dengue virus typing detection process based on multiplex fluorescence quantitative PCR, which are used to obtain optimal detection conditions so as to further improve the accuracy and sensitivity of the detection results.

[0086] First, this example constructs and verifies a standard plasmid. Viruses are cultured and RNA is extracted, and the target gene is amplified after a reverse transcription test. The amplified product is then detected, purified, and recovered to obtain a PCR product. The PCR product is then connected to the PMD-19T vector system, and the plasmid is extracted after transformation to obtain a plasmid standard.

[0087] Then, prepare the sample: determine the product concentration of the plasmid standard and calculate its copy number; after calculating the copy number, take 2μL as the sample to be tested, and set up a negative control for each test. The calculation formula for the copy number is:

[0088] Product RNA copies (copies / μL) = (6.02×10 23 )×(purified product concentration ng / μL×10 -9 ) / (RNALength×340 Daltons / base)

[0089] Product DNA copy number (copies / μL) = (6.02×10 23 )×(plasmid concentration ng / μL×10 -9 ) / (DNALength×660 Daltons / base)

[0090] Among them, 6.02×10 23 is Avogadro's constant, DNA Length is the number of bases remaining in the target fragment after enzyme digestion, and 660 Daltons / base is the average molecular weight of each base of DNA.

[0091] After that, the annealing temperature, primer working concentration and probe working concentration were preliminarily determined. According to the reaction array method, the primer and probe working concentrations of the single-plex fluorescence quantification were optimized, and single-plex primers and probes were selected and diluted with nuclease-free water to an initial concentration of 20 μM. The amount used is shown in Table 1, and sterile water was used as a negative control.

[0092] Table 1 The amount of each reagent in the reaction system

[0093]

[0094] In order to explore the effects of different annealing temperatures and primer and probe concentrations on PCR reactions, these two conditions were optimized to obtain the best reaction conditions and provide guidance for each reaction condition of multiplex PCR. The specific optimization items are as follows:

[0095] (1) Adjust the annealing temperature and optimize it in 8 gradients (53.6℃~63.6℃).

[0096] (2) Adjust the primer concentration and optimize it by adding (0.05 μL to 0.2 μL) into the 10 μL system in four gradients.

[0097] (3) Adjust the probe concentration and optimize it by adding (0.05 μL to 0.2 μL) into the 10 μL system in four gradients.

[0098] The experimental results are shown in Tables 2-1 to 2-5. Through the reaction array, it was determined that the optimal temperature of dengue virus type I was 55.6°C, the primer concentration was 0.1μM, and the probe concentration was 0.4μM; the optimal temperature of dengue virus type II was 61.9°C, the primer concentration was 0.2μM, and the probe concentration was 0.3μM; the optimal temperature of dengue virus type III was 60.0°C, the primer concentration was 0.2μM, and the probe concentration was 0.4μM; the optimal temperature of dengue virus type IV was 63.6°C, the primer concentration was 0.1μM, and the probe concentration was 0.2μM, which were quite different from the adjacent values, so the next step of optimization was carried out.

[0099] Table 2-1 Optimization of DENVⅠ-Ⅳ type annealing temperature

[0100]

[0101] Table 2-2 Optimization of primer and probe concentrations for DENV type I

[0102]

[0103] Table 2-3 Optimization of primer and probe concentrations for DENV type II

[0104]

[0105] Table 2-4 Optimization of DENVⅢ primer concentration and probe concentration

[0106]

[0107] Table 2-5 Optimization of DENVⅣ primer concentration and probe concentration

[0108]

[0109] According to the results of Tables 2-1 to 2-5, four primer concentration ranges (0.1-0.3μM) and probe concentration ranges (0.2-0.4μM) with low CT values ​​for virus typing were selected for single factor analysis, 81 concentration combinations were established, and the optimal concentration ratio was selected. Six gradients with annealing temperatures of 55.6℃ to 63.6℃ were selected for optimization. The primer concentration optimization results, probe concentration optimization results, and annealing temperature optimization results were obtained as follows: Figures 1 to 3 shown.

[0110] according to Figures 1 to 3 According to the results, the dengue virus type I primer concentration was 0.2μM, the probe concentration was 0.2μM; the dengue virus type II primer concentration was 0.1μM, the probe concentration was 0.4μM; the dengue virus type III primer concentration was 0.1μM, the probe concentration was 0.3μM; the dengue virus type IV primer concentration was 0.1μM, the probe concentration was 0.2μM, and the annealing temperature was 61.9℃.

[0111] According to the above optimization conditions, the concentration was selected as 1×10 0 ~1×10 10 The standard plasmid with copies / μL was used as a template to establish a standard curve for fluorescence quantitative PCR. The results are as follows: Figure 4 As shown in the figure, the X-axis is the logarithm of the copy number of the plasmid standard, and the Y-axis is the CT value detected by the plasmid standard.

[0112] Figure 4 In the DENVⅠ standard curve, Y=-3.0631X+34.662, R 2 =0.9935; DENVⅡ standard curve Y = -2.9208X + 33.47, R 2 =0.9906; DENVⅢ standard curve Y = -3.1838X + 36.887, R 2 =0.9903; DENVⅣ standard curve Y = -2.8961X + 33.622, R 2 =0.9923.

[0113] Example 3

[0114] This example is based on the kit provided in Example 1, and performs typing and quantitative detection on DENV type I-IV virus samples, including the following steps:

[0115] 1. Materials and Methods

[0116] 1. Sample preparation and viral DNA acquisition

[0117] Sample preparation: The dengue virus type I-IV plasmid standards were constructed by our laboratory, and the plasmids were successfully sequenced bidirectionally by Qingke Biotechnology Co., Ltd. The virus sample preparation method is: virus-susceptible cells are cultured at 25cm 2 The cells were placed in a culture flask until they formed a dense monolayer, and then the virus was inoculated. The cells were cultured until the virus proliferation phase, and then the cell samples were collected.

[0118] Obtaining viral DNA: Extract RNA template using Trizol method: Lyse cells with 1ml Trizol reagent to extract RNA from each 6-well plate. Determine the concentration of the extracted RNA, add 2μL of ABScript II Enzyme Mix (10X), 10μL of ABScript II Reaction Mix (2X), 1μL of 10mM dNTPs, 2μL of Primer, 1μg of RNA template to the PCR tube in sequence, and finally add water to 20μL. Incubate at 25℃ for 5min and 42℃ for 1h. Collect cDNA and store at 20℃ for later use. Take 2μL as the template DNA of the sample to be tested, and positive and negative controls should be set up for each test.

[0119] 2. Prepare PCR reaction system: Prepare PCR reaction system according to the dosage shown in Table 3. The total volume of the reaction system is 10 μL.

[0120] Table 3 PCR reaction system

[0121]

[0122]

[0123] The PCR reaction mixture prepared with the above ratio was added into a 384-well plate and centrifuged instantaneously.

[0124] 3. Fluorescence quantitative PCR amplification

[0125] Place the sealed PCR reaction plate in QuantStudio TM PCR amplification was performed in the Real-Time PCR Software amplification system. The quantitative PCR amplification reaction conditions were: incubation at 50°C for 2 min, denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 61.9°C for 1 min, for a total of 40 cycles.

[0126] 4. Read the fluorescence signal

[0127] After PCR amplification, in QuantStudio TM In the Real-Time PCR Software reading and analysis system, dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV were detected in the VIC, Cy5, FAM, and ROX channels respectively. TM Real-Time PCR Software was used for quantitative analysis to calculate the copy numbers of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.

[0128] 2. Determination of results

[0129] 1. Quality control standards

[0130] Negative control: The negative control was judged as negative if there was no signal or CT value ≥ 35 through VIC channel, FAM channel, Cy5 channel and ROX channel.

[0131] Positive control: positive control I was detected in the VIC channel, that is, dengue virus type I was detected in the VIC channel; positive control II was detected in the Cy5 channel, that is, dengue virus type II was detected in the Cy5 channel; positive control III was detected in the FAM channel, that is, dengue virus type III was detected in the FAM channel; positive control IV was detected in the ROX channel, that is, dengue virus type IV was detected in the ROX channel. According to the fluorescence quantitative CT value <35, the instrument was equipped with QuantStudio TM Real-Time PCR Software was used to construct a standard curve and calculate the copy numbers of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.

[0132] If one of the positive control or negative control does not meet the standard, the test will be invalid.

[0133] 2. Judgment results

[0134] Standard curve:

[0135] A standard curve was drawn with the measured CT value of the standard as the ordinate and the logarithm of the copy number of the standard as the abscissa, and a linear regression was performed to obtain a regression equation.

[0136] Calculation of virus copy number in sample:

[0137] The CT value of the sample was measured and substituted into the regression equation of the standard curve to calculate the number of viral copies in the sample. The results are shown in Table 4.

[0138] Table 4 DENV I-IV virus typing detection

[0139]

[0140] Example 4

[0141] This example tests the sensitivity, specificity and repeatability of the kit provided in Example 1, and the specific method is as follows:

[0142] 1. Sensitivity test of the kit

[0143] According to the previously optimized conditions, the concentration was selected as 1×10 0 ~1×10 10 The standard plasmid with 100 copies / μL was used as a template to detect the sensitivity of each virus fluorescence quantitative PCR. Fluorescence quantitative PCR and ordinary PCR tests were performed at the same time. The copy number results are shown in Table 5, and the amplification curve and PCR gel image results are shown in Figure 5 shown.

[0144] Table 5 Fluorescence quantitative PCR and PCR sensitivity of dengue virus type I-IV

[0145]

[0146] As can be seen from Table 5, using the standard plasmid as template, the minimum detection limit of DENVⅠ fluorescence quantitative PCR was 1×10 0 The minimum detectable number of copies / μL in conventional PCR is 1×10 1 copies / μL; the minimum detection limit of DENVⅡ fluorescence quantitative PCR is 1×10 0 The minimum detectable number of copies / μL in conventional PCR is 1×10 2 copies / μL; the minimum detection limit of DENVⅢ fluorescence quantitative PCR is 1×10 0 The lowest detectable number of copies / μL in conventional PCR is 1×10 0 copies / μL; the minimum detection limit of DENVⅣ fluorescence quantitative PCR was 1×10 0 The minimum detectable number of copies / μL in conventional PCR is 1×10 5 This indicates that the minimum detection limit of the detection method provided by the present application is significantly lower than that of ordinary PCR, and has higher sensitivity.

[0147] 2. Specificity test of the kit

[0148] Plasmid standards of dengue virus types Ⅰ-Ⅳ, West Nile virus, yellow fever virus, Japanese encephalitis virus, Zika virus, vesicular stomatitis virus, Rift Valley fever virus, Chikungunya virus, Banna virus, and Geta virus were diluted to appropriate concentrations, and DNA templates of dengue virus types Ⅰ-Ⅳ, Zika virus, Japanese encephalitis virus, and vesicular stomatitis virus were obtained to detect the specificity of fluorescent quantitative PCR for plasmid standards and viruses. The measured average Ct values ​​and copy numbers are shown in Table 6, and the specificity result bar graph is shown in Table 6. Figure 6 shown.

[0149] Table 6 Dengue virus type I-IV specific test results

[0150]

[0151]

[0152] From Table 6 and Figure 6 It can be seen that except for the target gene with a low CT value, the CT values ​​of other templates are high or not detected, indicating that the probe has good specificity.

[0153] 3. Repeatability test of the kit

[0154] The concentration is 1×10 8 copies / μL, 1×10 6copies / μL, 1×10 4 The standard sample with 100 copies / μL was used as a template for repeatability test, and the coefficients of variation within and between plates were calculated. The results are shown in Table 7.

[0155] Table 7 Multiplex fluorescence quantitative PCR repeatability test

[0156]

[0157] It can be seen from Table 7 that the intra-group coefficient of variation is between 0.22% and 1.55%, and the inter-group coefficient of variation is between 0.34% and 2.31%, both of which are less than 3%, indicating that the detection method provided in the present application has good repeatability.

[0158] In summary, the present application provides a dengue virus typing detection kit based on multiplex fluorescence quantitative PCR and its detection method, which belongs to the field of molecular diagnostic biology technology. Among them, the dengue virus typing detection kit of multiplex fluorescence quantitative PCR includes multiplex PCR reaction solution, dengue virus positive quality control and negative control; the multiplex PCR reaction solution includes four specific probes and four pairs of specific primers for detecting dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV, respectively. Based on this kit, by processing the sample, preparing the reaction system, performing PCR amplification, reading the fluorescence signal and performing quantitative analysis, it is possible to simply and efficiently achieve accurate quantitative detection of dengue virus typing and its copy number. In addition, the present application significantly improves the sensitivity and accuracy of detection by optimizing the design and detection process of fluorescent probes.

[0159] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the main purpose of the present application, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. A dengue virus typing detection kit based on multiplex fluorescence quantitative PCR, characterized in that: It comprises a multiplex PCR reaction solution, a dengue virus positive quality control and a negative control; the multiplex PCR reaction solution comprises four specific probes and four pairs of specific primers respectively used for detecting dengue virus type I, dengue virus type II, dengue virus type III and dengue virus type IV.

2. The dengue virus typing detection kit based on multiplex fluorescence quantitative PCR according to claim 1, characterized in that: The four specific probes include: The dengue virus type I probe as shown in SEQ ID NO: 1; The dengue virus type II probe as shown in SEQ ID NO: 2; The dengue virus type III probe as shown in SEQ ID NO: 3; The dengue virus type IV probe is shown in SEQ ID NO:

4.

3. The dengue virus typing detection kit based on multiplex fluorescence quantitative PCR according to claim 2, characterized in that: The 5' end fluorescent reporter group of the dengue virus type I probe is VIC, and the 3' end fluorescent quencher group is MGB; The 5' end fluorescent reporter group of the dengue virus type II probe is Cy5, and the 3' end fluorescent quencher group is MGB; The 5' end fluorescent reporter group of the dengue virus type III probe is FAM, and the 3' end fluorescent quencher group is MGB; The 5' end fluorescent reporter group of the dengue virus IV type probe is ROX, and the 3' end fluorescent quencher group is MGB.

4. The dengue virus typing detection kit based on multiplex fluorescence quantitative PCR according to claim 1, characterized in that: The four pairs of specific primers include: A dengue virus type Ⅰ upstream primer as shown in SEQ ID NO:5 and a dengue virus type Ⅰ downstream primer as shown in SEQ ID NO:6; The dengue virus type ⅠI upstream primer as shown in SEQ ID NO:7 and the dengue virus type ⅠI downstream primer as shown in SEQ ID NO:8; The dengue virus type III upstream primer as shown in SEQ ID NO:9 and the dengue virus type III downstream primer as shown in SEQ ID NO:10; The dengue virus type IV upstream primer is shown as SEQ ID NO:11 and the dengue virus type IV downstream primer is shown as SEQ ID NO:

12.

5. The dengue virus typing detection kit based on multiplex fluorescence quantitative PCR according to claim 1, characterized in that: The dengue virus positive quality control includes positive control I, positive control II, positive control III, and positive control IV; the positive control I is a plasmid liquid carrying a dengue virus type I gene fragment; the positive control II is a plasmid liquid carrying a dengue virus type II gene fragment; the positive control III is a plasmid liquid carrying a dengue virus type III gene fragment; the positive control IV is a plasmid liquid carrying a dengue virus type IV gene fragment.

6. The dengue virus typing detection kit based on multiplex fluorescence quantitative PCR according to claim 1, characterized in that: The negative control was nuclease-free water.

7. The dengue virus typing detection kit based on multiplex fluorescence quantitative PCR according to claim 1, characterized in that: The multiplex PCR reaction solution also includes 2×PerfeCT qPCR ToughMix UNG.

8. A method for quantitative detection of dengue virus typing based on multiplex fluorescence quantitative PCR, using the kit described in any one of claims 1 to 7 for detection, characterized in that: The steps include: S1. Extract the RNA template of the sample to be tested, and convert it into a DNA template as the sample to be tested; S2. Add the multiple PCR reaction solution in the above-mentioned kit to the sample to be tested to prepare a PCR mixed solution of the drug to be tested; S3. Performing PCR amplification on the PCR mixture of the drug to be tested; S4. After the PCR amplification is completed, the fluorescent signal is read to calculate the copy numbers of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.

9. The method for quantitative detection of dengue virus typing based on multiplex fluorescence quantitative PCR according to claim 8, characterized in that: In the PCR mixed solution of the drug to be tested, the volume concentration of the sample to be tested is 20%; the concentration of the dengue virus type I probe is 0.2 μM, and the concentrations of the dengue virus type I upstream primer and the downstream primer are both 0.2 μM; the concentration of the dengue virus type II probe is 0.4 μM, and the concentrations of the dengue virus type II upstream primer and the downstream primer are both 0.1 μM; the concentration of the dengue virus type III probe is 0.3 μM, and the concentrations of the dengue virus type III upstream primer and the downstream primer are both 0.1 μM; the concentration of the dengue virus type IV probe is 0.2 μM, and the concentrations of the dengue virus type IV upstream primer and the downstream primer are both 0.1 μM.

10. The method for quantitative detection of dengue virus typing based on multiplex fluorescence quantitative PCR according to claim 1, characterized in that: When performing the PCR amplification, the annealing temperature is set at 60-63°C.

Images