Anti-cancer viruses co-expressing CD55 and CD59

Abstract

The present invention relates to anti-cancer viruses that co-express complement regulatory proteins CD55 and CD59. Since the anti-cancer virus of the present invention can maintain its curative effect even when intravenously injected, the anti-cancer virus can also be applied to the treatment of various solid cancers and metastatic cancers in addition to superficial solid cancers. Furthermore, the anti-cancer virus of the present invention obtains resistance to attacks of an in-vivo complement system by expressing complement regulatory protein on the surface of the virus, thereby being stable in blood and maintaining stable anti-cancer activity during intravenous injection, thereby reducing the application amount of the virus to reduce the side effects of anti-cancer drugs as much as possible. Therefore, the anti-cancer virus of the present invention can be used for preventing or treating cancer.

Description

[Technical field]

[0001] The present invention relates to an anticancer virus co-expressing complement regulatory proteins CD55 and CD59.

[0002]

Background Skills

[0003] Cancer is a leading cause of death worldwide, and because it imposes a huge burden on individuals and society, the importance of developing innovative anticancer therapeutics is increasing, and various approaches are being attempted based on developments in molecular biology.

[0004] As an anticancer therapeutic agent that has attracted much attention in recent years, oncolytic virus is a virus that can replicate and is contagious. It is a virus used for cancer treatment by inserting specific genes into wild-type or attenuated viruses. Such genetically engineered anticancer viruses spread through tissues as cells lyse after viral replication, and the spread of the virus selectively occurs in cancer cells and their surrounding blood vessels. A representative anticancer virus is Amgen's lmlygic (talimogene laherparepvec), which was approved by the U.S. Food and Drug Administration (FDA) in October 2015 for the treatment of melanoma.

[0005] On the other hand, intravenous injection of drugs is a simple method of quickly delivering drugs that cannot be administered orally to the whole body, and it is one of the most preferred forms of administration due to its ease of administration. However, since anticancer viral drugs are quickly eliminated by the human immune system when injected intravenously, there is a limitation that their efficacy is reduced when administered intravenously. Therefore, in order to increase the probability of the virus reaching the tumor, anticancer viral drugs are usually injected directly into the target tumor rather than intravenously.

[0006] Intratumoral injection can be effectively applied to easily accessible superficial cancers such as melanoma, breast cancer and head and neck cancer, but in cancers such as deep solid cancers, there are disadvantages that the effective administration amount depends on the surgeon's technical ability, and because intratumoral injection is very invasive, it is not as easy to use as a repeated treatment method as intravenous injection.

[0007] Despite the advantages of intravenous injection, the reason why anticancer viruses are difficult to administer in the form of intravenous injection is that foreign substances (i.e., viruses) injected into the blood are gradually eliminated by the body's defense mechanism, thereby reducing the activity of the anticancer virus. In other words, when the virus moves into the body through blood vessels, the human body recognizes it as a foreign body and activates innate immunity to neutralize and eliminate it.

[0008] When the body is exposed to bacteria or viruses invading from the outside, the complement system (i.e., the first defense mechanism of the innate immune system) comes into play first. Complement is a protein present in the blood that surrounds the surface of foreign microorganisms and promotes phagocytosis by macrophages or neutrophils. Specifically, when a virus penetrates into the blood, the proteins on the surface of the virus first bind to the complement and aggregate with each other, and the complement is activated. The activated complement surrounds the surface of the virus, making it easier for phagocytosis by phagocytes (opsonization), and perforates the surface of the virus to lyse the virus. The lysed virus remnants are completely eliminated by the phagocytosis of macrophages.

[0009] In order to prevent excessive activation of the complement system from causing damage to surrounding normal cells, the human body expresses complement regulatory proteins such as CD55, CD46 and CD59 on the cell surface to regulate the excessive effects of complement.

[0010] Some anticancer viruses (about 5-20%) that proliferate inside host cells have the characteristic of presenting the morphology of "extracellular enveloped viruses" (EEVs) produced in a manner surrounded by the cell membrane of infected cells. Such EEVs are known to avoid complement activation and have a longer survival period in the blood, and the mechanism is found to be due to complement regulatory proteins such as CD55, CD46 and CD59 expressed on the cell membrane of the host cells surrounding the virus. For example, most of the anticancer vaccinia viruses produced are in the form of "intracellular mature viruses" (IMVs), which do not express complement regulatory proteins on their surface, so their activity is greatly reduced by complement. Therefore, research and development are needed to improve the anticancer activity of anticancer viruses when injected intravenously.

[0011] [Detailed description of the invention]

[0012] Technical Challenges

[0013] The purpose of the present invention is to provide a novel anticancer virus, specifically, to provide an anticancer virus that co-expresses CD55 and CD59.

[0014] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, which comprises the anti-cancer virus as an active ingredient.

[0015] Another object of the present invention is to provide a gene construct for inserting an anticancer virus, which gene construct comprises all or part of the genes encoding CD55 and CD59 and is operably linked to a promoter for expression.

[0016] Another object of the present invention is to provide an anticancer adjuvant comprising the anticancer virus as an active ingredient.

[0017] Another object of the present invention is to provide a method for preventing or treating cancer, which comprises administering a composition comprising the anti-cancer virus as an active ingredient to an individual.

[0018] Another object of the present invention is to provide use of the anti-cancer virus or a composition comprising the anti-cancer virus in preventing or treating cancer.

[0019] Another object of the present invention is to provide use of the anti-cancer virus or a composition comprising the anti-cancer virus in the manufacture of a medicament for preventing or treating cancer.

[0020] The technical tasks to be accomplished according to the technical ideas of the present invention disclosed herein are not limited to the tasks of solving the above-mentioned problems, and other unmentioned tasks can be clearly understood by ordinary technicians from the following description.

[0021]

Technical solution

[0022] The specific description is as follows: On the one hand, each description and embodiment disclosed in this application can be mutually applicable to other descriptions and embodiments. In other words, all combinations of various elements disclosed in this application belong to the scope of this application. In addition, it cannot be said that the scope of this application is limited by the specific description described below.

[0023] As a means to achieve the object of the present invention, the present invention provides an anticancer virus that co-expresses CD55 and CD59.

[0024] In particular, in the present invention, for example, the transcellular membrane domain of the membrane protein of the anticancer virus itself is linked to the CD55 gene, and the membrane protein of the anticancer virus itself is linked to the CD59 gene, so that the CD55 and CD59 proteins are expressed on the surface of the "intracellular mature virus" (IMV), thereby having resistance to the human complement system, maintaining stable anticancer activity when administered intravenously, and minimizing the side effects of treatment by reducing the amount of anticancer virus administered.

[0025] The term "anti-cancer virus (oncolytic vaccinia virus)" may be referred to as "oncolytic virus", which includes "recombinant virus" modified by deleting all or part of endogenous genes and introducing exogenous genes. Such anti-cancer viruses may be: vaccinia virus, adenovirus, herpes simplex virus, retrovirus, reovirus, Newcastle disease virus, coxsackie virus, enterovirus or herpes virus, etc.

[0026] In the present invention, the anticancer virus may have the expression of thymidine kinase gene suppressed.

[0027] The term "thymidine kinase (TK)" in the present invention is an enzyme involved in nucleotide biosynthesis. Thymidine kinase encoded by the TK gene can bind the phosphate at the γ position of ATP to thymidine to form nucleotides that constitute viral DNA. TK may be a sequence such as GenBank: AAR17937.1 or AY313847.1, but is not limited thereto. Specifically, TK or its gene may be composed of the amino acid sequence of GenBank: AAR17937.1 or the nucleotide sequence of GenBank: AY313847.1, but is not limited thereto. In addition, TK or its gene may have an identity of about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more than 99% with the amino acid sequence of GenBank: AAR17937.1 or the nucleotide sequence of GenBank: AY313847.1.

[0028] The term "complement regulatory protein" in the present invention refers to a protein that cleverly regulates the complement activation pathway in vivo. It is divided into a serum type (water-soluble) regulatory protein group and a membrane-bound regulatory protein group. The serum type includes: C4b binding protein, H factor, SGP120, alanine (P), etc., while the membrane-bound type includes: CRI (CD35), CR2 (CD21), CR3 (CD11b / CD18), CR4 (CD11c / CD18), DAF (CD55), membrane cofactor protein (MCP, CD46) and CD59. Among them, only P acts in the direction of enhancing complement activity, while the others act in the direction of reducing complement activity. The complement regulatory protein contained in the recombinant vaccinia virus of the present invention may be: CD35, CD21, CD18, CD55, CD46 or CD59, in particular CD55 and / or CD59, but is not limited thereto.

[0029] Specifically, the gene of CD55 may consist of the nucleotide sequence of Genbank: NM_000574.3, or may be a part of the sequence, and the gene of CD55 may have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity with the nucleotide sequence of NCBI reference sequence: NM_000574.3. More specifically, CD55 may consist of the amino acid sequence of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 2.

[0030] Specifically, the gene of CD59 may consist of or be a part of the nucleotide sequence of Genbank: NM_203331.3, and the gene of CD59 may have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity with the nucleotide sequence of NCBI reference sequence: NM_203331.3. More specifically, CD59 may consist of the amino acid sequence of SEQ ID NO: 3 or the nucleotide sequence of SEQ ID NO: 4.

[0031] The term "transmembrane domain (transmembrane domain)" (also referred to as transmembrane region) in the present invention refers to a region that penetrates and passes through the lipid bilayer of a membrane protein.

[0032] The anti-cancer virus according to the present invention may further comprise a gene encoding a membrane protein of the anti-cancer virus or a cell membrane-spanning domain thereof.

[0033] In the present invention, for example, CD55 and / or CD59 can be expressed independently of the gene encoding the transmembrane domain, or can be engineered to be expressed in a linked fusion form.

[0034] In the present invention, for example, the gene encoding the membrane protein of the anticancer virus can be connected to the gene encoding CD59 through a linker, more specifically, the linker can be (G4S)3 composed of the amino acid sequence of SEQ ID NO: 7 or the nucleotide sequence of SEQ ID NO: 8, but is not limited thereto.

[0035] In the present invention, the membrane protein of vaccinia virus may be: H3L, A27L, D8L, A16L, F9L, G9R, L1R, A9L, A13L, A21L, A28L, E10R, G3L, H2R, I2L, J5L, L5R or O3L, and may include all or part of the membrane protein sequence, as shown in Table 1 below.

[0036]

Table 1

[0037]

[0038]

[0039]

[0040] At this time, CD55 and / or CD59 and anticancer virus protein or its transcellular membrane domain can be designed to contain all or part of the gene by gene manipulation. Specifically, in the anticancer virus, the transcellular membrane domain of the membrane protein of vaccinia virus can be composed of the amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 or the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 or SEQ ID NO: 22, but not limited thereto.

[0041] The gene expression inhibition or gene inactivation mentioned in the present invention means that the gene is not expressed due to the deletion of part or all of the gene or the insertion of a foreign gene into the gene, or only part of the gene is expressed, so that the activity of the protein encoded by the gene does not appear. The method of deleting a gene or inserting a foreign gene can be carried out by a method well known in the conventional technical field. For example, it can be carried out by the method of inserting a foreign gene disclosed in Methods described in Molecular Cloning, A Laboratory Manual, Second Edition, by J. Sambrook, EF Fritsch and T. Maniatis (2003), Cold Spring Harbor Laboratory Press, Virology Methods Manual, edited by Brian WJ Mahy and Hiliar O Kangro (1996) Academic Press and Expression of genes by Vaccinia virus vectors. Current Protocols in Molecular Biology, published by John Wiley and Son (1998), Chapter 16. Specifically, the expression of the thymidine kinase gene can be inhibited by inserting a foreign gene into part or all of the thymidine kinase J2R region. More specifically, in one embodiment of the present invention, using T-Blunt TMThe exogenous gene can be inserted using a PCR cloning kit (Solgent, Korea, catalog number SOT01-K020). The CD55 and / or CD59 contained in the anticancer virus of the present invention can be expressed under the control of the following promoters: late-early VACV p7.5 promoter, vaccinia synthetic early-late promoter (pSEL), vaccinia synthetic late promoter (pSL), vaccinia modified H5 (mH5) promoter, vaccinia short synthetic early-late pS promoter, pLEO160 promoter, pLEO38 promoter, pLate promoter, pC11R promoter, pF11L promoter, psFJ1-10 synthetic early promoter, pHyb synthetic early promoter, any natural vaccinia early promoter or late-early optimized (LEO) promoter, but not limited thereto. For example, complement regulatory proteins CD55 or CD59 can be expressed under the control of pLEO160 or pLEO38 promoter. More specifically, CD55 can be expressed under the control of the pLEO160 promoter of SEQ ID NO:5, and CD59 can be expressed under the control of the pLEO38 promoter of SEQ ID NO:6.

[0042] The anticancer virus of the present invention may further include genes that can increase the therapeutic efficacy of cancer. There is no limitation on such genes, but they may include, for example, anticancer therapeutic genes, various immunomodulatory factors, and structural decomposition factors such as intratumoral fibers, and may also include, for example, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-17, IL-18, IL-21, IL-23, IL-24, interferon-α, interferon-β, interferon-γ, CCL3, CCL5, CXCR4, CXCL9, CXCL10, CXCL11, interleukin superagonists (interleukin superagonist; IL-2 superagonist, IL-15 superagonist), TGF-β blocker, TLR-2 agonist, TLR-3 agonist, TLR-7 agonist, STAT-3 inhibitor, PTENα, p53, p63, p73, adenosine deaminase-2, cancer-specific antigen, cancer-associated antigen, hyaluronidase, collagenase, protease, etc., but not limited to these.

[0043] In the present invention, the anti-cancer virus may include but is not limited to: vaccinia virus, adenovirus, herpes simplex virus, retrovirus, reovirus, Newcastle disease virus, Coxsackie virus, enterovirus, herpes virus, etc., and may be, for example, Western Reserve vaccinia virus (WR), New York vaccinia virus (NYVAC), Wyeth, LC16m8, Lister, Copenhagen, Tian Tan, USSR, TashKent, Evans, International Department of Health J (IHD-J) or International Department of Health White (IHD-W) strains.

[0044] As another way to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating cancer, which comprises the anti-cancer virus as an active ingredient.

[0045] The term "active ingredient" in the present invention refers to an ingredient that can exhibit the intended activity alone or together with an inactive carrier.

[0046] The term "cancer (or tumor)" in the present invention does not distinguish between primary cancer and metastatic cancer, but includes all cancers. In the present invention, cancer may be solid cancer or blood cancer. Solid cancer may be any one selected from the following: lung cancer, colorectal cancer, prostate cancer, thyroid cancer, breast cancer, brain cancer, head and neck cancer, esophageal cancer, skin cancer, thymus cancer, stomach cancer, colon cancer, liver cancer, ovarian cancer, uterine cancer, bladder cancer, rectal cancer, gallbladder cancer, bile duct cancer, pancreatic cancer, kidney cancer, osteosarcoma, sarcoma, chondrosarcoma and a combination thereof, but not limited thereto. Blood cancer may be any one selected from the following: lymphoma, leukemia, multiple myeloma and a combination thereof, but not limited thereto.

[0047] The term "metastatic cancer" in the present invention refers to cancer caused by cancer cells leaving the primary organ and metastasizing to another organ and proliferating. Metastatic cancer may include but is not limited to the growth of cancerous tissue in the primary cancer and directly invading surrounding organs, as well as long-distance metastasis along blood vessels or lymphatic vessels to other distant organs.

[0048] The term "prevention" in the present invention refers to any action of inhibiting or delaying the occurrence of cancer by administering the pharmaceutical composition of the present invention, and the term "treatment" in the present invention refers to any action of improving, alleviating or beneficially changing cancer by administering the pharmaceutical composition of the present invention.

[0049] The specific dosage of the pharmaceutical composition containing the anticancer virus of the present invention can be selected by those skilled in the art according to factors such as the preparation method, the patient's condition and weight, the patient's gender, age, disease extent, drug form, administration route and duration, excretion rate, reaction sensitivity, etc., and the dosage and frequency of administration do not limit the scope of the present invention in any way. Specifically, the pharmaceutical composition of the present invention may contain 10 5~ About 10 13 pfu (plaque forming unit) of anticancer virus, but not limited to this.

[0050] The term "pharmaceutical composition" in the present invention refers to a product manufactured for the prevention or treatment of a disease, and each product can be prepared and used in various forms according to the usual methods. For example, depending on the route of administration, it can be prepared into oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, etc., or it can be prepared and used in the form of external preparations and sterile injections. Specifically, the route of administration can be any suitable route including the following: topical route, oral route, intravenous route, intramuscular route and direct absorption through mucosal tissue, and two or more routes can also be used in combination. An example of a combination of two or more routes is the situation of combining two or more pharmaceutical preparations according to the route of administration, for example, a certain drug is administered by intravenous route for the first time, and another drug is administered by topical route for the second time.

[0051] The pharmaceutical composition of the present invention can be used for intratumoral, intravascular, intramuscular or intraperitoneal administration, for example, can be used for intravenous or arterial administration.

[0052] The pharmaceutical composition of the present invention can also be prepared in the form of a pharmaceutical composition for treating or preventing cancer that includes a conventional suitable carrier, excipient or diluent for preparing the pharmaceutical composition, wherein the carrier may include a non-naturally occurring carrier. Specifically, the pharmaceutical composition can be prepared and used in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories and sterile injections according to a common method. In the present invention, as the carrier, excipient and diluent that can be included in the pharmaceutical composition, can be enumerated: lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talcum powder, magnesium stearate and mineral oil. In the case of preparation, commonly used fillers, extenders, adhesives, humectants, disintegrants, surfactants and other diluents or excipients can be used for preparation. Oral solid preparations include: tablets, pills, powders, granules, capsules, etc., and such solid preparations are prepared by mixing at least one excipient (e.g., starch, calcium carbonate, sucrose or lactose, gelatin). In addition to simple excipients, lubricants such as magnesium phenylpropionate and talcum powder are also used. As oral liquid preparations, in addition to water and liquid paraffin, which are commonly used simple diluents in suspensions, internal liquid preparations, emulsions, syrups, etc., a variety of excipients such as humectants, sweeteners, aromatics, preservatives, etc. can also be included. Preparations for parenteral administration include: sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil) and injectable esters (e.g., ethyl oleate) can be used. As the base of the suppository, Witepsol, polyethylene glycol, Tween 61, cocoa butter, laurel butter, glycerin gelatin and the like can be used.

[0053] Specific formulations of pharmaceutical compositions are known in the art, and reference may be made, for example, to Remington's Pharmaceutical Sciences (19th ed., 1995), which references are to be considered part of this specification.

[0054] The pharmaceutical composition of the present invention can be administered to mammals, such as mice, dogs, cats, cattle, horses, pigs, humans, etc., preferably humans, by various routes. Any administration method is contemplated, such as oral, intravenous, arterial, intramuscular or subcutaneous injection, but is not limited thereto.

[0055] For example, the anticancer virus of the present invention is resistant to the human complement system and not only maintains stable anticancer activity when administered intravenously, but also maximizes the therapeutic effect by reducing the amount of anticancer virus administered, so that intravenous administration is sufficient to achieve the therapeutic effect.

[0056] As another way to achieve this object, the present invention provides a gene construct for inserting an anticancer virus, which comprises all or part of the genes encoding CD55 and CD59 and is operably linked to a promoter for expression, and a vector containing the gene construct.

[0057] In the present invention, the gene construct (or gene construct) can be used for insertion of the inactivated thymidine kinase gene region of the anti-cancer virus.

[0058] In the present invention, the inactivated thymidine kinase gene region includes a total or partial deletion of the thymidine kinase gene.

[0059] In the present invention, the gene construct includes the region between the J1R region and the J3R region in the anticancer virus.

[0060] In the present invention, gene constructs may include but are not limited to Figure 1 The gene constructs shown may also include various promoters and regulatory sequences for regulating gene expression in an operably linked form.

[0061] The terms "transcellular membrane domain", "CD55" and "CD59" in the present invention are as described above.

[0062] In the present invention, the gene construct is used to be inserted into all or part of the thymidine kinase of vaccinia virus, specifically, is used to be inserted into all or part of the thymidine kinase J2R region.

[0063] As another embodiment to achieve the object, the present invention provides an anticancer adjuvant comprising a recombinant vaccinia virus as an active ingredient.

[0064] The above-mentioned anticancer adjuvant refers to any form intended to increase the anticancer effect of anticancer drugs or to inhibit or improve the side effects of anticancer drugs. The anticancer adjuvant of the present invention can be administered in combination with various types of anticancer drugs or anticancer adjuvants, and when administered in combination, even if the anticancer drug is administered at a level lower than the usual administration amount of the anticancer drug, the same level of anticancer therapeutic effect can be exhibited, so safer anticancer treatment can be performed.

[0065] The administration route of the anticancer adjuvant can be administered by any general route that can reach the target tissue. The anticancer adjuvant of the present invention can be administered by intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intrapulmonary administration and intrarectal administration according to the desired purpose, but is not limited thereto. In addition, the anticancer adjuvant can be administered by any device by which the active substance can move to the target cell.

[0066] In order to administer the anticancer adjuvant of the present invention, in addition to the active ingredient, it can also be preferably formulated as an anticancer adjuvant by including more than one pharmaceutically acceptable carrier. The carrier, excipient or diluent that can be included in the anticancer treatment adjuvant of the present invention can include but is not limited to: lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0067] The anticancer adjuvant of the present invention may be a preparation for parenteral administration, and the description of the preparation of the pharmaceutical composition is substituted for the description of the preparation.

[0068] In addition, the anticancer adjuvants disclosed in the technical field can be applied to the present invention without obvious limitations.

[0069] In one embodiment of the present invention, the anticancer drug may be one or more selected from the following: chemotherapeutic agents, biological therapeutic agents, radiotherapy, immunotherapy, hormone therapy, anti-vascular therapy, cryotherapy and toxin therapy.

[0070] As another embodiment to achieve the object, the present invention provides a method for preventing or treating cancer, which comprises the step of administering a composition comprising the recombinant vaccinia virus as an active ingredient to an individual.

[0071] The terms "cancer", "prevention" and "treatment" in the present invention are as described above.

[0072] The individual may be a mammal, specifically, a human, a cow, a sheep, a goat, a horse, a pig, a dog, a cat, a rabbit, a rat, a mouse, a fish, a bird, etc., but is not limited thereto.

[0073] The composition comprising the recombinant vaccinia virus as an active ingredient can be appropriately administered by a common technician according to the patient's age, sex, weight, disease severity and administration route. The above administration can be once a day or several times a day, and can be repeated in appropriate cycles.

[0074] The dosage of the composition comprising the recombinant vaccinia virus as an active ingredient depends on the individual's condition and weight, the severity of the disease, the form of the drug, the route of administration and the duration, and can be appropriately selected by a skilled person. Specifically, 10 5 ~ About 10 13 pfu (plaque forming units), and may include various values ​​or ranges between the stated ranges.

[0075] In the method for treating cancer of the present invention, the administration route of the composition can be administered by any general route as long as the target tissue can be reached. Although not particularly limited, the composition of the present invention can be administered by routes such as oral administration and rectal administration, and in some cases, it can also be administered by other routes according to the purpose.

[0076] In the present invention, the cancer treatment method includes a treatment method by combining with known anticancer drugs and anticancer therapies.

[0077] Another embodiment to achieve the purpose of the present invention provides use of the anti-cancer virus or a composition comprising the anti-cancer virus in preventing or treating cancer.

[0078] Another embodiment to achieve the purpose of the present invention provides use of the anti-cancer virus or a composition comprising the anti-cancer virus in the manufacture of a medicament for preventing or treating cancer.

[0079] [Effects of the invention]

[0080] Since the anticancer virus of the present invention can maintain its therapeutic effect even when injected intravenously, it can be applied to the treatment of various solid cancers, blood cancers and metastatic cancers in addition to superficial solid cancers. In addition, the anticancer virus of the present invention is resistant to the complement system in the body by expressing complement regulatory proteins, and maintains stable anticancer activity, especially when injected intravenously, so the administration amount of the virus can be reduced to minimize the side effects of anticancer drugs. Therefore, the anticancer virus of the present invention can be effectively used to prevent or treat cancer.

[0081]

Drawing Description

[0082] Figure 1 This is a schematic diagram of a recombinant vaccinia virus which is the anticancer virus of the present invention in which the TK gene is deleted and the complement regulatory proteins CD55 and CD59 are introduced.

[0083] Figure 2 These are the results of Western blotting to confirm whether the recombinant vaccinia virus (SJ-640) of the present invention expresses CD55 and CD59.

[0084] Figure 3 These are the results of confirming by immunofluorescence staining whether CD55 is expressed in osteosarcoma cells infected with the recombinant vaccinia virus (SJ-640) of the present invention.

[0085] Figure 4 These are the results of confirming by immunofluorescence staining whether CD59 is expressed in osteosarcoma cells infected with the recombinant vaccinia virus (SJ-640) of the present invention.

[0086] Figure 5These are the results of confirming the expression of CD55 and CD59 in the recombinant vaccinia virus (SJ-640) of the present invention using a transmission electron microscope.

[0087] Figure 6 These are the results of confirming the serum stability of the recombinant vaccinia virus (SJ-640) of the present invention in 20% active human serum.

[0088] Figure 7 The results are the results of confirming the anti-tumor efficacy of SJ-640 by changes in tumor volume in the MDA-MB-231 breast cancer xenograft model.

[0089] Figure 8 The results are the results of confirming the changes in body weight over time after administration of SJ-610 and SJ-640 in the MDA-MB-231 breast cancer xenograft model.

[0090] [Best Mode for Carrying Out the Invention]

[0091] The composition and effects of the present invention will be explained in more detail below by way of examples. These examples are only used to illustrate the present invention and are not intended to limit its scope.

[0092] The present inventors produced a vector into which human CD55 and human CD59 genes were inserted, and confirmed its property as an anticancer substance by preparing a recombinant vaccinia virus in which expression of the genes was induced by homologous recombination between the vector and vaccinia virus.

[0093] [Preparation Example: Production of recombinant vaccinia virus SJ-640 with TK deletion and expression of CD55 and CD59]

[0094] like Figure 1 As shown, the J2R region in the thymidine kinase region of the Wyeth strain of vaccinia virus was completely deleted, and CD55 and CD59 were inserted at this position. In addition, in order to express the CD55 on the envelope of the virus, the gene lacking the GPI anchor region of hCD55 was fused with the transcellular membrane domain of the membrane protein of the vaccinia virus, and pLEO160 was used as a promoter for expression. In addition, in order to express the CD59 on the envelope of the virus, the gene lacking the GPI anchor region of hCD59 was connected to the membrane protein of the vaccinia virus using a linker, and pLEO38 was used as a promoter for expression. The specific process is as follows.

[0095] [1. Preparation of plasmid vectors for inducing expression of hCD55 and hCD59 genes]

[0096] To delete the vaccinia virus J2R region, HiFi DNA Assembly Cloning Kit (NEWENGLAND BioLabs, Cat. No. E2621) was used in T-blunt TM The J1R and J3R genes as the left and right flanking regions of the J2R region were cloned in a vector (Solgent). J1R and J3R DNA were used for PCR amplification of the corresponding positions of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec). J1R is identical to the J1R (protein id = AAR17936.1) of the vaccinia virus Acambis 2000 strain in the region of amino acids 1 to 154, but the double amino acid 118 is substituted from alanine to serine. J3R (protein id = AAR17938.1) is the region of amino acids 1 to 145. The complement regulatory protein hCD55 gene (GenBank: NM_000574.3) expressed by the pLEO160 promoter, the transcellular membrane domain region of the vaccinia virus membrane protein H3L, the complement regulatory protein hCD59 gene (Genbank: NM_203331.3) expressed by the pLE038 promoter, the (G4S)3 linker (SEQ ID NO: 8) connecting hCD59 and the membrane protein of the vaccinia virus, and the gene encoding the membrane protein A27L of the vaccinia virus were further cloned into the vector to complete the shuttle vector. The amino acid sequence and nucleotide sequence of hCD55 used are shown in SEQ ID NOs: 1 and 2, respectively, and the amino acid sequence and nucleotide sequence of hCD59 are shown in SEQ ID NOs: 3 and 4, respectively.

[0097] hCD55 was PCR amplified in a vector cloned into pCMV3 plasmid (Sinobio, catalog number HG10101-UT). hCD55 (GenBank: NM_000574.3) was expressed using pLEO160 (ttttattttt tttttttgga atataaatatccggtaaaat tgaaaaaata tacactaatt agcgtctcgtttcagacgct agccggtacc ccgggttcgaaatcgataag cttggatccg gagagctcccaacctcgagg aattcggtac cccgggttcg aaatcgataagcttggatcc ggagagctcccaacctcgag ctagctcgag, SEQ ID NO: 5, synthesized by Macrogen). The 3' end of the hCD55 gene was linked to the transcellular membrane domain of vaccinia virus H3L so that CD55 was expressed on the viral envelope. The information and sequence of the transcellular membrane domain of H3L used are shown in Tables 2 and 3.

[0098]

Table 2

[0099]

[0100]

Table 3

[0101]

[0102]

[0103] hCD59 was amplified by PCR from cDNA of human cervical cancer cell HeLa. hCD59 (GenBank: NM_203331.3) used the amino acid 1-101 region in which the GPI anchor region was deleted from the total amino acid sequence, and pLEO38 (ttttattttt tttttttgga atataaatat ccggtaaaat tgaaaaaata tacactaattagcgtctcgt ttcagacgct agctcgag, SEQ ID NO: 6, synthesized by Macrogen) was used as the promoter for expression. The 3' end of the hCD59 gene was connected to the gene encoding vaccinia virus A27L via a (G4S)3 linker to express CD59 on the viral envelope. The sequences of A27L and the linker used are shown in Table 4.

[0104]

Table 4

[0105]

[0106] [2. Production of SJ-640 recombinant vaccinia virus by homologous recombination]

[0107] SJ-640 recombinant vaccinia virus was prepared by homologous recombination of wild-type vaccinia virus Wyeth strain and a previously prepared plasmid vector in which expression of hCD55 and hCD59 genes was induced.

[0108] The wild-type Wyeth strain was prepared by inserting the J2R region gene of the Western Reserve (WR) strain of vaccinia virus (ATCC, catalog number VR-1354) into the inactivated J2R region (TK region) of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec). The J2R region gene of the Western Reserve strain (protein id = YP_232976.1) is the region of amino acids 1 to 178. The J2R region gene of the Western Reserve strain was amplified by PCR, and the PCR product was homologously recombined with JX-594 to complete the wild-type Wyeth strain.

[0109] To recombinant SJ-640, 143B osteosarcoma cells (Creative Bioarray) were infected with the wild-type Wyeth strain and transfected with a plasmid vector expressing hCD55 and hCD59. To screen for recombinant virus SJ-640 plaques with TK region deletion, 143B osteosarcoma cells infected with vaccinia virus and transfected with plasmid vectors were treated with the TK deletion screening reagent 5-bromo-2'-deoxyuridine (BrdU) and cultured. The selected recombinant virus plaques were subcultured twice in 143B cells to obtain purified monoclonal SJ-640. The nucleotide sequence of the SJ-640 recombination site was finally confirmed by sequencing.

[0110] [Example 1: Confirmation of CD55 and CD59 expression in SJ-640]

[0111] The recombinant vaccinia virus SJ-640 prepared in the preparation example was lysed and protein expression was confirmed by Western blotting. A virus (JX-594) that does not express CD55 and CD59 was used as a control.

[0112] Specifically, HeLa cells were infected with recombinant vaccinia virus SJ-640 for about 26 hours to allow proliferation, the infected cells were centrifuged to remove the culture medium, and then cell lysis buffer was added to lyse the cells. The cell lysate was treated with Benzonase to remove cell-derived DNA and filtered with a cellulose acetate filter to remove cell byproducts. The filtrate was concentrated by centrifugation using a 36% sucrose buffer.

[0113] In order to separate the proteins present in the purified virus, the centrifuged virus sediment was dissolved with RIPA lysis buffer (Thermo Scientific, Catalog No. 89900) and the amount of protein was quantified using the BCA protein assay (Thermo Scientific, Catalog No. 23227). The protein obtained from each virus was diluted in a loading buffer (Biosesang, Catalog No. S2002) to prepare 2.5 μg or 5 μg for each lane and electrophoresed in an SDS-PAGE gel (BIO-RAD, Catalog No. 4561083). The electrophoresis gel was transferred back to a nitrocellulose membrane (BIO-RAD, Catalog No. 1704270). To detect the target protein, the membrane was blocked with 5% skim milk (Difco, Catalog No. 232100) for 1 hour and then treated overnight at 4°C with anti-hCD55 antibody (SantaCruz, Catalog No. sc-51733) and anti-hCD59 antibody (SantaCruz, Catalog No. sc-133171). The next day, the membrane was washed 3-4 times with 1× TBST, treated with secondary antibody conjugated with HRP, treated with hydrogen peroxide and luminol substrate, and confirmed by chemiluminescence detector.

[0114] The results are as follows Figure 2 As shown, it was confirmed that CD55 (about 70-75 kDa) and CD59 (about 35 kDa) were expressed in SJ-640.

[0115] In addition, the recombinant vaccinia virus SJ-640 prepared in the above preparation example was used to infect osteosarcoma cells U-2OS, and the expression of CD55 and CD59 was confirmed by immunofluorescence staining 10 hours later. SJ-610, which lacks TK and does not express CD55 and CD59, was used as a negative control.

[0116] Specifically, U-2OS was infected with recombinant vaccinia virus SJ-640 or negative control SJ-610, and the virus-infected cells were fixed with 4% paraformaldehyde at 10 hours of infection. The fixed infected cells were treated again with 0.1% Triton X-100 to penetrate the cell membrane, and blocked with 3% bovine serum albumin. For immunofluorescence staining of target proteins, anti-hCD55 antibody (invitrogen, catalog number MA1-82066), anti-hCD59 antibody (invitrogen, catalog number MA1-19133), and anti-vaccinia virus A27 antibody (abcam, catalog number ab35219) were treated overnight at 4°C. On the next day, the primary antibody was washed with PBS, treated with a secondary antibody conjugated to AlexaFluor488 or AlexaFluor594 and 4'6-diamidino-2-phenylindole (DAPI) that binds to the primary antibody, and the vaccinia virus A27 protein, CD55, CD59 and expressed DAPI expressed in the infected cells were observed under a confocal microscope.

[0117] The results are as follows Figure 3 As shown, it was confirmed that CD55 was expressed in cells infected with SJ-640 virus, as Figure 4 As shown, it was confirmed that CD59 was expressed in cells infected with the SJ-640 virus. In SJ-610 used as a control, the expression of CD55 and CD59 was not observed.

[0118] In addition, after the recombinant vaccinia virus SJ-640 prepared in the preparation example was bound to a CD55 or CD59 specific antibody, the presence, expression location and distribution of CD55 and CD59 were observed by immunogold labeling.

[0119] To this end, HeLa cells were infected with recombinant vaccinia virus SJ-640 for about 28 to 30 hours to proliferate, and the infected cells were centrifuged to remove the culture medium, and then a cell lysis buffer was added to lyse the cells. The cell lysate was treated with Benzonase to remove cell-derived DNA, and filtered with a cellulose acetate filter to remove cell byproducts. The filtrate was concentrated by centrifugation using a 36% sucrose buffer. The concentrated virus was passed through an ion exchange chromatography membrane to adsorb only the virus and remove impurities, and then the virus was eluted and finally purified.

[0120] The purified virus was adsorbed on a nickel grid and blocked with 3% bovine serum albumin. After reacting with anti-hCD55 antibody (SantaCruz, Catalog No. sc-51733) or anti-hCD59 antibody (invitrogen, Catalog No. MA1-19133) bound to the target protein at room temperature for 2 hours, the antibody was washed with PBS and reacted with a secondary antibody bound to 12nm colloidal gold particles (Jacksonimmuno, Catalog No. 115-205-166) at room temperature for 2 hours. For observation with a transmission electron microscope, the prepared samples were negatively stained and the expression of gold-labeled CD55 and CD59 was evaluated.

[0121] As a result, the expression of CD55 and CD59 in SJ-640 was confirmed, and it was confirmed that they were distributed in large quantities in the outer membrane of mature virion particles (MV) ( Figure 5 ). Expression of CD55 and CD59 was not observed in JX-594 used as a control virus.

[0122] [Example 2: Confirmation of Virus Stability in SJ-640 Serum]

[0123] To determine whether the SJ-640 virus remained active in serum, its stability in serum was measured.

[0124] Specifically, U-2OS osteosarcoma cells were cultured at 2.5 × 10 5 The cells were seeded in 12-well tissue culture plates and cultured overnight. The next day, when the cells were almost 100% confluent, the recombinant vaccinia virus SJ-640 was diluted to about 80-100 PFU per well with serum-free DMEM medium. Normal human serum was added to the diluted virus again at 20% of the total administration amount and treated with U-2OS cells on the culture plate for 2 hours. The control group used serum-free DMEM medium instead of normal human serum. After 2 hours, the virus was removed from the 12-well plate and treated with 1.5% carboxymethylcellulose solution. The 12-well plate was incubated at 37°C for 72 hours, and the formed plaques were stained with 0.1% crystal violet solution and counted. When the number of plaques produced in the absence of serum was set as 100%, the number of plaques produced by the recombinant virus cultured with 20% normal human serum was calculated, and the stability of the recombinant virus SJ-640 in serum was compared with that of the negative control group JX-594.

[0125] Results, such as Figure 6 As shown, it was confirmed that in the case of the control group JX-549, the activity of the virus was reduced to 30%, while the activity of the SJ-640 virus of the present invention was maintained as high as 87%.

[0126] [Example 3: Evaluation of anti-tumor efficacy in breast cancer transplantation model]

[0127] MDA-MB-231 human breast cancer cells were transplanted into NSG immunodeficient mice to establish a xenograft mouse tumor model. 3 SJ-640 or control SJ-610 1×10 6 pfu, and compared the efficacy of tumor growth inhibition.

[0128] Tumor size was measured 2-3 times per week in all groups using calipers to measure the long and short axes. Tumor size was calculated as (short axis × short axis × long axis) ÷ 2. In addition, mice were weighed each time tumor size was measured to assess their body weight. When tumor size reached 1,500-2,000 mm 3 When the above, terminate the experiment.

[0129] Results, such as Figure 7 As shown, compared with the untreated control group (PBS), the recombinant vaccinia virus SJ-640 of the present invention showed a tumor growth inhibition effect of 52.9%, and the tumor growth inhibition effect of SJ-610 was 23.6%, confirming that the recombinant vaccinia virus SJ-640 of the present invention has a significantly superior anti-tumor effect.

[0130] In addition, if Figure 8 As shown, there were no statistically significant differences in the changes in body weight of mice in all experimental groups, and no clinical toxicity was observed.

[0131] It can be understood from the above description that the technology to which the present invention belongs can be implemented in different specific forms without changing its technical ideas or basic features. In this regard, the above embodiments should be understood to be illustrative in all aspects, rather than restrictive. The scope of the present invention should be interpreted as including the meaning and scope of the patent claims described below and any changes or modifications derived from their equivalent concepts, rather than the above detailed description.

Claims

1. Anticancer virus that co-expresses CD55 and CD59.

2. The anticancer virus according to claim 1, wherein the expression of thymidine kinase gene is inhibited.

3. The anticancer virus according to claim 2, wherein the expression of the thymidine kinase gene is inhibited due to the deletion of part or all of the gene, or due to the insertion of a foreign gene into the gene. The anticancer virus according to claim 2 , wherein a part or all of the thymidine kinase J2R region is inserted with a foreign gene. The anticancer virus according to claim 1 , wherein the CD55 consists of the amino acid sequence of SEQ ID NO:

1. The anticancer virus according to claim 1 , wherein the CD59 consists of the amino acid sequence of SEQ ID NO:

3. 7 . The anti-cancer virus according to claim 1 , further comprising a gene encoding a membrane protein of the anti-cancer virus or a cell membrane-spanning domain thereof.

8. The anti-cancer virus according to claim 7, wherein the gene encoding the membrane protein of the anti-cancer virus is connected to the gene encoding the CD59 via a linker. 9 . The anticancer virus according to claim 8 , wherein the linker consists of the amino acid sequence of SEQ ID NO:

7. 10 . The anti-cancer virus according to claim 7 , wherein the gene encoding the transcellular membrane domain of the membrane protein of the anti-cancer virus is fused with the gene encoding the CD55.

11. The anti-cancer virus according to claim 7, wherein the membrane protein of the anti-cancer virus is: H3L, A27L, D8L, A16L, F9L, G9R, L1R, A9L, A13L, A21L, A28L, E10R, G3L, H2R, I2L, J5L, L5R or O3L.

12. The anti-cancer virus of claim 1, wherein the CD55 and CD59 are expressed under the control of the following promoters, respectively: late-early VACV p7.5 promoter, vaccinia synthetic early-late promoter (pSEL), vaccinia synthetic late promoter (pSL), vaccinia modified H5 (mH5) promoter, vaccinia short synthetic early-late pS promoter, pLEO160 promoter, pLEO38 promoter, pLate promoter, pC11R promoter, pF11L promoter, psFJ1-10 synthetic early promoter, pHyb synthetic early promoter, any natural vaccinia early promoter, or late-early optimized (LEO) promoter.

13. The anti-cancer virus according to claim 1, wherein the anti-cancer virus is: vaccinia virus, adenovirus, herpes simplex virus, retrovirus, reovirus, Newcastle disease virus, coxsackievirus, enterovirus or herpes virus.

14. The anti-cancer virus of claim 13, wherein the vaccinia virus is a strain of Western Reserve (WR), NYVAC (New York vaccinia virus), Wyeth, LC16m8, Lister, Copenhagen, Tian Tan, USSR, TashKent, Evans, IHD-J (International Department of Health-J) or IHD-W (International Department of Health-White) strain.

15. A pharmaceutical composition for preventing or treating cancer, comprising the anticancer virus according to any one of claims 1 to 14 as an active ingredient. The pharmaceutical composition according to claim 15 , wherein the cancer is a solid cancer or a blood cancer.

17. The pharmaceutical composition of claim 16, wherein the solid cancer is any one selected from the group consisting of lung cancer, colorectal cancer, prostate cancer, thyroid cancer, breast cancer, brain cancer, head and neck cancer, esophageal cancer, skin cancer, thymic cancer, gastric cancer, colon cancer, liver cancer, ovarian cancer, uterine cancer, bladder cancer, rectal cancer, gallbladder cancer, bile duct cancer, pancreatic cancer, kidney cancer, osteosarcoma, sarcoma, chondrosarcoma, and combinations thereof.

18. The pharmaceutical composition according to claim 16, wherein the blood cancer is any one selected from the group consisting of lymphoma, leukemia, multiple myeloma, and combinations thereof.

19. The pharmaceutical composition according to claim 15, wherein the composition is for intratumoral, intravascular, intramuscular or intraperitoneal administration.

20. The pharmaceutical composition according to claim 15, wherein the composition is for intravenous or arterial administration.

21. A gene construct for inserting an anticancer virus, comprising all or part of the genes encoding CD55 and CD59 and operably linked to a promoter for expression.

22. The gene construct according to claim 21, wherein the gene construct is used to insert an inactivated thymidine kinase gene region of an anti-cancer virus.

23. An anticancer adjuvant comprising the anticancer virus according to any one of claims 1 to 14 as an active ingredient.

24. A method for preventing or treating cancer, comprising the step of administering to an individual a composition comprising the anticancer virus according to any one of claims 1 to 14 as an active ingredient.

25. Use of the anticancer virus according to any one of claims 1 to 14 or a composition comprising the anticancer virus in preventing or treating cancer.

26. Use of the anticancer virus according to any one of claims 1 to 14 or a composition comprising the anticancer virus in the manufacture of a medicament for preventing or treating cancer.

Images