Application of notoginsenoside Ft1 in preparation of diabetic nephropathy renal tubular epithelial cell ferroptosis inhibitor

Abstract

The invention discloses application of notoginsenoside Ft1 in preparation of a diabetic nephropathy renal tubular epithelial cell ferroptosis inhibitor, and relates to the technical field of biological medicines. The invention also discloses an application of notoginsenoside Ft1 in preparation of drugs for improving diabetic nephropathy caused by renal tubular epithelial cell ferroptosis. The invention provides a new ferroptosis inhibitor for renal tubular epithelial cells of diabetic nephropathy, and provides a thought for developing a new therapeutic drug for diabetic nephropathy.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to application of notoginseng saponin Ft1 in the preparation of an inhibitor of ferroptosis of renal tubular epithelial cells in diabetic nephropathy. Background Art

[0002] The prevalence of diabetes is increasing worldwide, of which more than 90% are type 2 diabetes mellitus (T2DM). According to statistics from the International Diabetes Federation (IDF), by 2021, there will be 537 million adult diabetics in the world. It is expected that by 2045, this number will climb to 783 million, which means that about one in eight adults will be troubled by diabetes. Diabetic Kidney Disease (DKD) is one of the most serious microvascular complications of diabetes. About 30-40% of diabetic patients will develop DKD, which has become the main cause of end-stage renal disease (ESRD). In my country, among patients with chronic kidney disease (CKD), DKD accounts for as high as 26.96%, causing a heavy social and economic burden.

[0003] Disorders of glucose and lipid metabolism play a vital role in the progression of DKD. Hyperglycemia can lead to impaired function of vascular endothelial cells. Under the condition of persistent endothelial damage, the glomeruli are in a state of high perfusion, high pressure, high filtration and micro-inflammation. These pathophysiological changes lead to increased glomerular volume, loss of podocytes and formation of KW nodules in renal tissue, and eventually glomerular sclerosis. At the same time, increasing evidence shows that dyslipidemia can also have a direct toxic effect on renal cells, thereby accelerating the progression of kidney disease. Its mechanism involves multiple aspects such as inflammatory response, oxidative stress, endoplasmic reticulum stress and endothelial dysfunction. Therefore, improving disorders of glucose and lipid metabolism is of great significance for delaying the progression of DKD.

[0004] Various cell death modes, including apoptosis, autophagy, necrosis, and pyroptosis, play an important role in the damage process of renal tubular epithelial cells and are involved in the progression of DKD. Ferroptosis is a new type of iron-dependent programmed cell death. Its occurrence involves iron-mediated oxidative damage, increased iron load, free radical production, and accumulation of fatty acid supply and lipid peroxides. In diabetes, disorders of glucose and lipid metabolism have been shown to lead to cell ferroptosis, which is related to factors such as excessive iron deposition in tissues, aggravation of oxidative stress damage, and persistence of chronic inflammatory states. Previous studies have found that patients with DKD have abnormal iron metabolism. It is worth noting that iron homeostasis is essential for the renal tubules to maintain their normal physiological functions. Excessive accumulation of iron may produce a large number of oxygen free radicals through the Fenton reaction, especially when mitochondrial dysfunction is caused by diabetes, this effect is more significant, and these changes can lead to renal tubular epithelial cell damage. In addition, recent studies have further revealed that due to excessive glucose stimulation, renal tubular epithelial cell ferroptosis increases, thereby accelerating the occurrence and progression of DKD. Continuous exposure of renal tubular epithelial cells to a high glucose environment increases their sensitivity to oxidative stress and lipid peroxidation, which can also significantly affect the progression of DKD. Among the many cell death modes, ferroptosis regulation is the most likely way to control cell death for targeted disease treatment. Therefore, it is very important to explore the regulatory mechanism of ferroptosis in diabetic renal tubular epithelial cells. Inhibiting ferroptosis in diabetic renal tubular epithelial cells may become an important means of treating DKD.

[0005] The traditional Chinese medicine Panax notoginseng has been used in traditional Chinese medicine for the treatment of diseases for more than 2000 years. It has been proven to have a renal protective effect, and no side effects have been found so far. As a monomer in the total saponins of Panax notoginseng, Panax notoginseng saponin Ft1 (Ft1) has been shown in recent studies to activate TGR5, increase lipolysis, and thus control obesity. However, TGR5 plays an important role in the regulation of glucose and lipid metabolism. Therefore, it is extremely important to further study whether Ft1 can inhibit ferroptosis in diabetes by activating TGR5, thereby exerting a renal protective effect, which may provide new drug options for the treatment of DKD. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides the use of notoginseng saponin Ft1 in the preparation of a ferroptosis inhibitor for renal tubular epithelial cells in diabetic nephropathy. The present invention provides a new ferroptosis inhibitor for renal tubular epithelial cells in diabetic nephropathy, and provides ideas for developing new therapeutic drugs for diabetic nephropathy.

[0007] To achieve the above-mentioned purpose, the technical solution adopted by the present invention to solve the technical problem is: application of notoginseng saponin Ft1 in the preparation of an inhibitor of ferroptosis of renal tubular epithelial cells in diabetic nephropathy.

[0008] Furthermore, the diabetes is type 2 diabetes.

[0009] Furthermore, notoginseng saponin Ft1 is used in the preparation of a drug for improving diabetic nephropathy caused by ferroptosis of renal tubular epithelial cells.

[0010] A drug for improving ferroptosis of renal tubular epithelial cells in diabetic nephropathy, comprising notoginseng saponin Ft1 and a medically acceptable carrier.

[0011] In summary, the present invention has the following beneficial effects:

[0012] 1. Provides a new ferroptosis inhibitor to inhibit the occurrence of renal tubular epithelial ferroptosis in diabetic nephropathy.

[0013] 2. It provides ideas for developing new therapeutic drugs for diabetic nephropathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a comparison of the weight of mice in each group;

[0015] Figure 2 The figure is the trend of weight change of mice in each group over time;

[0016] Figure 3 This is a comparison chart of random blood glucose of mice in each group;

[0017] Figure 4 The random blood glucose change trend diagram of each group of mice over time;

[0018] Figure 5 This is a comparison of the GSP levels of mice in each group;

[0019] Figure 6 This is a comparison of the UACR levels of mice in each group;

[0020] Figure 7 It is the trend diagram of UACR change over time in each group of mice;

[0021] Figure 8 This is a comparison of the BUN and Crea levels of mice in each group;

[0022] Fig. 9 The figure is a comparison result of TG, TC, LDL-c and HDL-c levels of mice in each group;

[0023] Fig.10 This is a comparison of the levels of AST and ALT in each group of mice;

[0024] Fig.11 HE staining of mouse kidney tissue;

[0025] Fig.12 This is the MASSON staining image of mouse kidney tissue;

[0026] Fig.13 This is the analysis result of the ratio of the glomerular mesangial matrix area to the glomerular area of ​​each group of mice;

[0027] Fig.14 This is a PAS staining image of mouse kidney tissue;

[0028] Fig.15 This is the analysis result of the ratio of the glomerular mesangial matrix area to the glomerular area of ​​each group of mice;

[0029] Fig.16 This is a transmission electron micrograph of a mouse glomerulus;

[0030] Fig.17 This is a transmission electron micrograph of the mouse renal tubule;

[0031] Fig.18 This is the NGAL staining image of mouse kidney tissue;

[0032] Fig.19 The results of the analysis of NGAL expression levels in the renal tubules of mice in each group are shown in the figure;

[0033] Fig. 20 This is the immunohistochemical staining of mouse TGF-β;

[0034] Fig.21 This is the immunohistochemical staining of mouse α-SMA;

[0035] Fig. 22 This is the analysis result diagram of TGF-β expression level in each group of mice;

[0036] Fig.23 This is the analysis result diagram of α-SMA expression level of each group of mice;

[0037] Fig.24 This is the TUNEL staining image of mouse kidney tissue;

[0038] Fig.25 The results of the analysis of the proportion of TUNEL(+) cells in the renal tissue of each group of mice in the visual field;

[0039] Fig.26 This is a DHE staining image of mouse kidney tissue;

[0040] Fig. 27 This is a graph showing the analysis results of the level of ROS generated in the kidney tissues of each group of mice;

[0041] Fig.28 This is the 4-HNE immunohistochemical staining picture;

[0042] Fig.29 The figure is the analysis result of 4-HNE content in each group of mice;

[0043] Fig.30 The figure is the analysis result of MDA content in each group of mice;

[0044] Fig.31 This is a transmission electron micrograph of mitochondria in renal tubular epithelial cells;

[0045] Fig.32 This is a transmission electron micrograph of mitochondria in renal tubular epithelial cells;

[0046] Fig.33 This is the immunohistochemical staining of Ferritin;

[0047] Fig.34 This is the immunohistochemical staining of GPX4;

[0048] Fig.35 The figure shows the analysis results of Ferritin expression levels in each group of mice;

[0049] Fig.36 The results of the GPX4 expression level analysis of each group of mice are shown in Figure 2;

[0050] Fig.37 The results of the analysis of PTGS2 expression levels in kidney tissues of mice in each group are shown in the figure;

[0051] Fig.38 The WB detection results of TGR5, GPX4, SLC7A11 and Ferritin proteins are shown;

[0052] Fig.39 This is the analysis result of TGR5, GPX4, SLC7A11 and Ferritin protein expression;

[0053] Fig.40 This is a WB detection result of JNK signaling pathway related proteins in mouse kidney tissue;

[0054] Fig.41 The results of the analysis of the expression levels of TGR5, JNK and p-JNK in different mice are shown in the figure;

[0055] Fig.42 The figure shows the analysis results of the p-JNK / JNK ratio of different mice. DETAILED DESCRIPTION

[0056] The present invention is further described below in conjunction with the embodiments and drawings, but the present invention is not limited thereto.

[0057] Example 1 Construction of mouse model

[0058] 1. Selection of Experimental Animals

[0059] C57BL / 6KsJ mice and db / db mice, both male, were used at 6-8 weeks of age. The db / db mice are inbred mice on the C57BL / 6KsJ background, and their gene mutation is a homozygous point mutation of the leptin receptor gene. The mice begin to show symptoms such as increased appetite, increased drinking, increased urination, and weight gain at 3-4 weeks of age, and gradually develop characteristics of type 2 diabetes, such as hyperglycemia, hyperlipidemia, and insulin resistance, as they age.

[0060] 2. Model building

[0061] 6-8 weeks old, Specific pathogen Free (SPF) grade male db / db mice (db / db gene mutation in C57BL / KsJ inbred mouse background) were selected as diabetic mice and C57BL / KsJ mice were used as wild-type control mice. The mouse model of TGR5 overexpression was constructed by tail vein injection of TGR5 overexpression adeno-associated virus type 9 (AAV9), and 0.2 mL (6×10E11 vg) of adeno-associated virus was injected into the tail vein once. This adeno-associated virus can cause mice to overexpress TGR5 systemically, and because the serotype is AVV9, the overexpression in the kidney is greater.

[0062] Breeding location: Animal Experiment Center, Frontier Medical Center, West China Hospital.

[0063] Feeding conditions: In the SPF animal room, the feeding environment was maintained at a temperature of 22±2°C, a relative humidity of 40-60%, and followed a 12h / 12h day and night cycle (light on from 07:00 to 19:00 every day). Throughout the experiment, mice (4 per cage) were able to eat and drink freely. After one week of adaptive feeding, the mice were randomly grouped using a random number table. Drinking water, feed, and bedding were sterilized with high temperature and high pressure. This experiment has been approved by the Experimental Animal Ethics Committee of West China Hospital, Sichuan University, and an ethical review consent for experimental animals has been obtained. The ethics registration number is 20221128008.

[0064] 3. Experimental Grouping

[0065] All mice were divided into 7 groups, with 6-8 mice in each group. The 7 groups of mice were:

[0066] (1) Wild-type mouse group (WT);

[0067] (2) diabetic group (db / db);

[0068] (3) empty adeno-associated virus intervention db / db control group (db / db+AAV9-NC, 6x 10E11 vg injected once through the tail vein);

[0069] (4) TGR5 overexpression adeno-associated virus db / db group (db / db+AAV9-TGR5, 6x 10E11 vg injected once via tail vein);

[0070] (5) vehicle intervention db / db group (db / db+Vehicle, 0.2 mL normal saline gavage, once a day);

[0071] (6) Ft1 intervention db / db group (db / db + Ft1, 120 mg / g gavage, once a day);

[0072] (7) Empagliflozin (EMP) intervention db / db group (db / db + EMP, 10 mg / g gavage once daily);

[0073] The intervention doses of Ft1 and EMP were 120 mg / g and 10 mg / g respectively, once a day. The solvents of Ft1 and EMP were 0.9% saline, and ultrasonic heating was used to assist dissolution.

[0074] Example 2 Effect of Ft1 intervention on body weight of diabetic mice

[0075] At 0, 2, 4, 6, and 8 weeks after administration, the body weight of mice in each group was measured using a body weight scale. Figure 1 The changes in the body weight of mice in each group over time are shown in Figure 2 As shown. ****P<0.0001.

[0076] Depend on Figure 1 and Figure 2 It can be seen that at each time point after the intervention, the body weight of the db / db group mice was higher than that of the WT group (P<0.05). This indicates that the db / db mice have undergone metabolic changes such as obesity. At each time point after the intervention, the body weight changes of the db / db+AAV9-TGR5 ​​group mice were not significant compared with the db / db+AAV9-NC group (P>0.05). At each time point after the intervention, the body weight changes of the db / db+Ft1 group mice were not significant compared with the db / db+Vehicle group.

[0077] Example 3 Effect of Ft1 intervention on random blood glucose in diabetic mice

[0078] At 0, 2, 4, 6, and 8 weeks after administration, the random blood glucose of each group of mice was measured using a blood glucose meter. The results are shown in Figure 3 The trend of random blood glucose changes over time in each group of mice is shown in Figure 4 As shown. ****P<0.0001.

[0079] Depend on Figure 3 and Figure 4 It can be seen that at each time point after the intervention, the random blood glucose of the db / db group mice was higher than that of the WT group (P<0.05). This indicates that the db / db mice have abnormal glucose metabolism characteristic of diabetes. At each time point after the intervention, there was no significant difference in the random blood glucose of the db / db+AAV9-TGR5 ​​group mice compared with the db / db+AAV9-NC group (P>0.05). At each time point after the intervention, there was no significant difference in the random blood glucose of the db / db+Ft1 and db / db+EMP groups mice compared with the db / db+Vehicle group (P>0.05). Detection of urine indicators of mice: At 0, 2, 4, 6, and 8 weeks after administration, the urinary albumin to creatinine ratio (UACR) in the urine was detected by Elisa method.

[0080] Example 4 Effect of Ft1 intervention on glycosylated serum protein (GSP) in diabetic mice

[0081] At 8 weeks after the corresponding intervention, serum GSP was measured to evaluate the effects of TGR5 overexpression or Ft1 intervention on long-term blood glucose control in db / db mice. Figure 5 **P<0.01, ****P<0.0001.

[0082] Depend on Figure 5 It can be seen that compared with the WT group, the GSP of mice in the db / db group was higher (P<0.05). Compared with the db / db+AAV9-NC group, the GSP of mice in the db / db+AAV9-TGR5 ​​group was lower (P<0.05). This suggests that TGR5 overexpression can significantly improve the long-term blood sugar control of db / db mice. Compared with the db / db+Vehicle group, the GSP of mice in the db / db+Ft1 and db / db+EMP groups were lower (P<0.05). This shows that both Ft1 and EMP can significantly improve the long-term blood sugar control of db / db mice. There was no significant difference in the GSP of mice in the db / db+Ft1 and db / db+EMP groups (P>0.05). This shows that Ft1 and EMP have similar effects on reducing the GSP of db / db mice.

[0083] Example 5 Effect of Ft1 intervention on proteinuria in diabetic mice

[0084] At 0, 2, 4, 6, and 8 weeks after the corresponding intervention, UACR was measured to evaluate the urine protein level of the mice. Figure 6 The trends of UACR changes over time in each group of mice are shown in Figure 7 As shown. ****P<0.0001.

[0085] Depend on Figure 6 and Figure 7 It can be seen that at the 2nd, 4th, 6th, and 8th weeks after the corresponding intervention, the UACR level of mice in the db / db group was higher than that in the WT group (P<0.05), indicating that db / db mice had early diabetic kidney damage. At the 2nd, 4th, 6th, and 8th weeks after the corresponding intervention, the UACR of mice in the db / db+AAV9-TGR5 ​​group was lower than that in the db / db+AAV9-NC group (P<0.05), indicating that TGR5 overexpression can significantly reduce proteinuria in db / db mice. At the 2nd, 4th, 6th, and 8th weeks after the corresponding intervention, the UACR of mice in the db / db+Ft1 and db / db+EMP groups was lower than that in the db / db+Vehicle group (P<0.05), indicating that both Ft1 and EMP interventions can significantly reduce proteinuria in db / db mice. At the 2nd, 4th, 6th and 8th week of corresponding intervention, there was no significant difference in UACR between db / db+Ft1 and db / db+EMP groups (P>0.05), which indicates that Ft1 and EMP have similar effects in reducing proteinuria in db / db mice.

[0086] Example 6 Effect of Ft1 intervention on renal function in diabetic mice

[0087] At 8 weeks after the corresponding intervention, serum BUN and Crea levels were measured to evaluate renal function damage. Figure 8 shown. Figure 8 In the figure, A is the detection result of BUN, and B is the detection result of Crea. *P<0.05.

[0088] Depend on Figure 8 It can be seen that compared with the WT group, the BUN of the db / db group of mice did not change significantly (P>0.05), while Crea was significantly reduced (P<0.05), indicating that the db / db mice were in a high filtration state at this time. Compared with the db / db+AAV9-NC group, the BUN and Crea of ​​the db / db+AAV9-TGR5 ​​group of mice did not change significantly (P>0.05), indicating that at this time point, TGR5 overexpression had no significant effect on the renal function of db / db mice. Compared with the db / db+Vehicle group of mice, the BUN and Crea of ​​the db / db+Ft1 and db / db+EMP groups of mice did not change significantly (P<0.05). This shows that at this time point, Ft1 and EMP intervention had no significant effect on the renal function of db / db mice.

[0089] Example 7 Effect of Ft1 intervention on blood lipids in diabetic mice

[0090] At 8 weeks after the corresponding intervention, serum TG, TC, LDL-c and HDL-c levels were measured to evaluate the lipid metabolism of mice. Fig. 9 shown. Fig. 9 In the figure, A is the test result of TG, B is the test result of TC, C is the test result of LDL-c, and D is the test result of HDL-c. *P<0.05, **P<0.01.

[0091] Depend on Fig. 9 It can be seen that compared with the WT group, the TC, LDL-c and HDL-c of the db / db group mice were higher (P<0.05), and there was no significant difference in TG (P>0.05), which indicated that the db / db mice had significant lipid metabolism disorders. Compared with the db / db+AAV9-NC group, the TC, TG, LDL-c and HDL-c of the db / db+AAV9-TGR5 ​​group mice were not significantly different (P>0.05), but showed a lower trend, which indicated that TGR5 overexpression may have the effect of regulating lipid metabolism in db / db mice. Compared with the db / db+Vehicle group, the TC, TG, LDL-c and HDL-c of the db / db+Ft1 and db / db+EMP groups were not significantly different (P>0.05), but showed a lower trend, which indicated that Ft1 and EMP intervention may have the effect of regulating lipid metabolism in db / db mice.

[0092] Example 8 Effect of Ft1 intervention on liver function in diabetic mice

[0093] At 8 weeks after the corresponding intervention, serum AST and ALT levels were measured to evaluate the liver function of mice. Fig.10 shown. Fig.10 In the figure, A is the test result of AST, and B is the test result of ALT. *P<0.05.

[0094] Depend on Fig.10It can be seen that compared with the WT group, the AST of the db / db group did not change significantly (P>0.05), while the ALT level increased significantly (P<0.05), which indicated that the db / db mice may have fatty liver lesions, thus affecting liver function. Compared with the db / db+AAV9-NC group, the changes of AST and ALT in the db / db+AAV9-TGR5 ​​group were not significant (all P>0.05), indicating that TGR5 overexpression had no significant effect on the liver function of db / db mice. Compared with the db / db+Vehicle group, the AST and ALT of the db / db+Ft1 and db / db+EMP groups did not change significantly (all P>0.05), indicating that Ft1 (120 mg / g gavage once a day) and EMP (10 mg / g gavage once a day) intervention had no significant effect on the liver function of db / db mice.

[0095] Example 9: Improvement of renal pathological damage in diabetic mice by intervention with Ft1

[0096] At 8 weeks after the corresponding intervention, the pathological damage of the mice was evaluated by HE, MASSON, PAS and transmission electron microscopy. Fig.11 As shown, Fig.11 From left to right and from top to bottom in the middle are the results of the wild-type mouse group, diabetes group, empty adeno-associated virus intervention db / db control group, TGR5 overexpression adeno-associated virus db / db group, solvent intervention db / db group, Ft1 intervention db / db group and EMP intervention db / db group, where 10×, scale bar = 100 μm; 40×, scale bar = 20 μm.

[0097] The results of MASSON staining are as follows Fig.12 As shown, Fig.12 In the figure, from left to right and from top to bottom are the results of the wild-type mouse group, the diabetes group, the empty adeno-associated virus intervention db / db control group, the TGR5 overexpression adeno-associated virus db / db group, the solvent intervention db / db group, the Ft1 intervention db / db group, and the EMP intervention db / db group, where 10×, scale bar = 100μm; 40×, scale bar = 20μm. Semi-quantitative analysis of the ratio of glomerular mesangial matrix area to glomerular area, 10 fields of view were randomly selected for measurement in each section, and the results are shown in the figure. Fig.13 shown. Fig.13 Mean±SD, n=6, ***P<0.001.

[0098] The results of PAS staining were Fig.14 As shown, Fig.14In the figure, from left to right and from top to bottom are the results of the wild-type mouse group, the diabetes group, the empty adeno-associated virus intervention db / db control group, the TGR5 overexpression adeno-associated virus db / db group, the solvent intervention db / db group, the Ft1 intervention db / db group, and the EMP intervention db / db group, where 10×, scale bar = 100μm; 20×, scale bar = 50μm; 40×, scale bar = 20μm. Semi-quantitative analysis of the ratio of glomerular mesangial matrix area to glomerular area, 10 fields of view were randomly selected for measurement in each section, and the results are shown in the figure. Fig.15 shown. Fig.15 Mean±SD, n=6, ***P<0.001.

[0099] Transmission electron microscopy results Fig.16 and Fig.17 shown. Fig.16 This is the transmission electron microscopy result of the glomerulus. Fig.17 Transmission electron microscopy results of renal tubules. Fig.16 and Fig.17 In the middle, from top to bottom, from left to right are the results of the wild-type mouse group, the diabetic group, the empty adeno-associated virus-intervention db / db control group, the TGR5 overexpression adeno-associated virus db / db group, the solvent-intervention db / db group, the Ft1-intervention db / db group, and the EMP-intervention db / db group, 12000×, scale bar = 1 μm.

[0100] Depend on Figure 11-Figure 17 It can be seen that compared with the WT group of mice, the db / db group of mice had significantly expanded glomerular mesangial matrix, thickened glomerular basement membrane, more severe foot process fusion, more significant tubular mitochondrial damage, more tubular vacuolar degeneration, and more bristle border shedding, indicating that db / db mice had characteristic pathological damage of DKD, including glomerular and tubular damage. Compared with the db / db+AAV9-NC group of mice, the db / db+AAV9-TGR5 ​​group of mice had less expansion of glomerular mesangial matrix, thickened glomerular basement membrane, less severe foot process fusion, and less tubular mitochondrial damage; tubular vacuolar degeneration and less bristle border shedding, indicating that TGR5 overexpression helps to alleviate renal pathological damage in db / db mice. Compared with the db / db+Vehicle group, the db / db+Ft1 and db / db+EMP groups had less expansion of glomerular mesangial matrix (P<0.05), thickening of glomerular basement membrane, less lesions of foot process fusion, and less tubular mitochondrial damage; less tubular vacuolar degeneration and less bristle border shedding, indicating that both Ft1 and EMP interventions helped to alleviate renal pathological damage in db / db mice.

[0101] NGAL (neutrophil gelatinase-associated lipocalin) is a marker for renal tubular damage, and its expression level increases when renal tubular damage occurs. At 8 weeks after the corresponding intervention, tubular damage in the renal tissue of mice was assessed by NGAL staining. Fig.18 20×, scale bar = 50 μm. Semi-quantitative analysis of NGAL expression in renal tubules was performed by randomly selecting 5 fields of view for each slice. The results are shown in Fig.19 Shown are Mean±SD, n=6, **P<0.01, ***P<0.001.

[0102] Depend on Fig.18 and Fig.19 It can be seen that compared with the WT group, the renal tubular NGAL expression of db / db mice was higher (P<0.05), indicating that db / db mice had significant diabetic tubular damage. Compared with the db / db+AAV9-NC group, the renal tubular NGAL expression of db / db+AAV9-TGR5 ​​group was lower (P<0.05), indicating that TGR5 overexpression can alleviate renal tubular damage in db / db mice. Compared with the db / db+Vehicle group, the renal tubular NGAL expression of db / db+Ft1 and db / db+EMP groups was lower (P<0.05), indicating that both Ft1 and EMP intervention can alleviate renal tubular damage in db / db mice.

[0103] Example 10: Ft1 intervention can reduce renal fibrosis in diabetic mice

[0104] TGF-β and α-SMA are indicators for evaluating the severity of renal fibrosis. When fibrosis occurs, the expression of TGF-β and α-SMA increases. At 8 weeks after the corresponding intervention, TGF-β and α-SMA were detected by immunohistochemical staining to evaluate the renal fibrosis of mice. Fig. 20 As shown, α-SMA immunohistochemical staining Fig.21 As shown, Fig. 20 and Fig.21 In the figure, from top to bottom and from left to right are the results of the wild-type mouse group, the diabetes group, the empty adeno-associated virus intervention db / db control group, the TGR5 overexpression adeno-associated virus db / db group, the solvent intervention db / db group, the Ft1 intervention db / db group, and the EMP intervention db / db group, 20×, scale bar = 50μm. Semi-quantitative analysis of the expression levels of TGF-β and α-SMA, 5 fields of view were randomly selected for each slice for measurement, and the results are shown as follows: Fig. 22 and Fig.23 Shown are Mean±SD, n=6, ****P<0.0001.

[0105] Depend on Figure 20-23 It can be seen that compared with the WT group, the expression of TGF-β and α-SMA in the kidney tissue of the db / db group mice was higher (P<0.05), indicating that the db / db mice had significant renal fibrosis damage. Compared with the db / db+AAV9-NC group, the expression of TGF-β and α-SMA in the kidney tissue of the db / db+AAV9-TGR5 ​​group mice was lower (P<0.05), indicating that overexpression of TGR5 can significantly improve the renal fibrosis damage of db / db mice. Compared with the db / db+Vehicle group, the expression of TGF-β and α-SMA in the kidney tissue of the db / db+Ft1 and db / db+EMP groups mice was lower (P<0.05), indicating that Ft1 or EMP intervention can improve the renal fibrosis damage of db / db mice.

[0106] Example 11 TGR5 overexpression or Ft1 intervention can alleviate cell apoptosis in kidney tissue of diabetic mice

[0107] TUNEL staining can be used to evaluate the occurrence of cell apoptosis. At 8 weeks after the corresponding intervention, TUNEL staining was used to evaluate the cell damage in kidney tissue. Fig.24 As shown, Fig.24 From top to bottom, from left to right are the results of wild-type mice group, diabetes group, empty adeno-associated virus intervention db / db control group, TGR5 overexpression adeno-associated virus db / db group, solvent intervention db / db group, Ft1 intervention db / db group and EMP intervention db / db group, 20×, scale bar = 50μm. Semi-quantitative analysis of the proportion of TUNEL(+) cells in the renal tissue in the field of view, 5 fields of view were randomly selected for each section for measurement, and the results are shown in Fig.25 Shown are Mean±SD, n=6, ***P<0.001, ****P<0.0001.

[0108] Depend on Fig.24 and Fig.25 It can be seen that compared with the WT group, the number of apoptotic cells in the kidney tissue of the db / db group of mice was higher (P<0.05), indicating that diabetes can lead to aggravated cell apoptosis in the kidney tissue. Compared with the db / db+AAV9-NC group, the number of apoptotic cells in the kidney tissue of the db / db+AAV9-TGR5 ​​group of mice was lower (P<0.05), indicating that TGR5 overexpression can improve cell apoptosis in the kidney tissue of db / db mice. Compared with the db / db+Vehicle group, the number of apoptotic cells in the kidney tissue of the db / db+Ft1 and db / db+EMP groups of mice was lower (all P<0.05), indicating that both Ft1 and EMP intervention can improve cell apoptosis in the kidney tissue of db / db mice.

[0109] Example 12: TGR5 overexpression or Ft1 intervention reduces ROS content in kidney tissue of diabetic mice

[0110] DHE staining can be used to assess the ROS (reactive oxygen species) content in tissues. When ferroptosis occurs, the ROS content in tissues increases. At 8 weeks after the corresponding intervention, the ROS content in the kidney tissues of mice was detected. The results are shown in Fig.26 As shown, Fig.26 In the figure, from top to bottom and from left to right, the results of the wild-type mouse group, the diabetes group, the empty adeno-associated virus intervention db / db control group, the TGR5 overexpression adeno-associated virus db / db group, the solvent intervention db / db group, the Ft1 intervention db / db group, and the EMP intervention db / db group are shown in Figure 20×, scale bar = 50 μm. The content of reactive oxygen species in kidney tissue was detected, and 5 fields of view were randomly selected for measurement in each slice. The results are shown in Figure 20×, scale bar = 50 μm. Fig. 27 Shown are Mean±SD, n=6, ****P<0.0001.

[0111] Depend on Fig.26 and Fig. 27 It can be seen that compared with the WT group, the ROS content in the kidney tissue of the db / db group mice was higher (P<0.05), indicating that the ROS production in the kidney tissue of db / db mice increased. Compared with the db / db+AAV9-NC group, the ROS content in the kidney tissue of the db / db+AAV9-TGR5 ​​group mice was lower (P<0.05), indicating that overexpression of TGR5 can significantly reduce the production of ROS in the kidney tissue of db / db mice. Compared with the db / db+Vehicle group, the ROS content in the kidney tissue of the db / db+Ft1 and db / db+EMP groups was lower (all P<0.05), indicating that both Ft1 and EMP intervention can reduce the production of ROS in the kidney tissue of db / db mice.

[0112] Example 13 TGR5 overexpression or Ft1 intervention reduces lipid peroxidation in kidney tissue of db / db mice

[0113] 4-HNE (4-hydroxynonenal) and MDA (malondialdehyde) are both important indicators for assessing the degree of lipid peroxidation. When ferroptosis occurs, lipid peroxidation in the body increases, leading to increased 4-HNE expression and MDA content. At week 8 after the corresponding intervention, 4-HNE in kidney tissue was detected by immunohistochemical staining, and the MDA content in kidney tissue was detected by a kit. 4-HNE immunohistochemical staining is shown in Figure 2. Fig.28 The expression level of 4-HNE in kidney tissue was detected to evaluate the lipid peroxidation status. Five fields of view were randomly selected for each slice for measurement. The results are shown in Fig.29 The MDA kit was used to detect the MDA content in kidney tissue. Fig.30 Shown are Mean±SD, n=6, **P<0.01, ***P<0.001, ****P<0.0001.

[0114] Depend on Figure 28-Figure 30 It can be seen that compared with the WT group, the expression of 4-HNE and the content of MDA in the kidney tissue of db / db mice were increased (P<0.05), indicating that the level of lipid peroxidation in the kidney tissue of db / db mice increased. Compared with the db / db+AAV9-NC group, the expression of 4-HNE and the content of MDA in the kidney tissue of db / db+AAV9-TGR5 ​​mice were significantly decreased (P<0.05), indicating that overexpression of TGR5 can significantly improve lipid peroxidation in the kidney tissue of db / db mice. Compared with the db / db+Vehicle group, the expression of 4-HNE and the content of MDA in the kidney tissue of db / db+Ft1 and db / db+EMP groups were significantly decreased (all P<0.05), indicating that both Ft1 and EMP intervention can significantly reduce lipid peroxidation in the kidney tissue of db / db mice.

[0115] Example 14: TGR5 overexpression or Ft1 intervention improves mitochondrial damage in renal tubular epithelial cells of diabetic mice

[0116] Mitochondrial atrophy, reduced cristae, and increased membrane density are characteristic mitochondrial damage changes of ferroptosis. At 8 weeks after the corresponding intervention, the mitochondrial morphology of renal tubular epithelial cells was observed by transmission electron microscopy. Fig.31 and Fig.32 As shown, Fig.31 The magnification is 6000×. Fig.32 The magnifications are 1200×; 6000×, scale bar = 2 μm; 12000×, scale bar = 1 μm.

[0117] Depend on Fig.31 and Fig.32It can be seen that compared with the WT group, the mitochondrial shrinkage of the renal tubular epithelial cells of the db / db group mice increased, indicating that mitochondrial damage characteristic of ferroptosis occurred in the renal tubular epithelial cells of db / db mice. Compared with the db / db+AAV9-NC group, the mitochondrial shrinkage in the renal tubular epithelial cells of the db / db+AAV9-TGR5 ​​group mice was reduced, indicating that overexpression of TGR5 can improve the mitochondrial damage characteristic of ferroptosis in the renal tubular epithelial cells of db / db mice. Compared with the db / db+Vehicle group, the mitochondrial shrinkage in the renal tubular epithelial cells of the db / db+Ft1 and db / db+EMP groups mice was reduced, indicating that both Ft1 and EMP intervention can improve the mitochondrial damage characteristic of ferroptosis in the renal tubular epithelial cells of db / db mice.

[0118] Example 15 Effects of TGR5 overexpression or Ft1 intervention on the expression of ferroptosis-related proteins in mouse kidney tissue

[0119] Ferritin (ferritin) and GPX4 (glutathione peroxidase 4) are both key proteins involved in ferroptosis. Among them, Ferritin is related to the iron metabolism status in tissues, while GPX4 mainly protects cell membranes from oxidative damage by clearing intracellular lipid peroxides. When ferroptosis occurs, the expression of both Ferritin and GPX4 decreases. At 8 weeks after the corresponding intervention, the expression levels of Ferritin and GPX4 in renal tissues were evaluated by immunohistochemistry. Ferritin and GPX4 immunohistochemical staining are shown as follows: Fig.33 and Fig.34 As shown, Fig.33 and Fig.34 In the figure, from top to bottom and from left to right, the results of the wild-type mouse group, the diabetes group, the empty adeno-associated virus intervention db / db control group, the TGR5 overexpression adeno-associated virus db / db group, the solvent intervention db / db group, the Ft1 intervention db / db group, and the EMP intervention db / db group are shown in Figure 20×, scale bar = 50 μm. In order to detect the expression levels of Ferritin and GPX4 in kidney tissue and then evaluate the cellular iron metabolism status and anti-lipid peroxidation level, 5 fields of view were randomly selected from each slice for measurement, and the results were shown in Figure 20×, scale bar = 50 μm. Fig.35 and Fig.36 Shown are Mean±SD, n=6, **P<0.01, ***P<0.001, ****P<0.0001.

[0120] Depend on Figure 33-Figure 36It can be seen that compared with the WT group, the expression levels of Ferritin and GPX4 in the kidney tissue of db / db mice were lower (P<0.05), indicating that iron metabolism disorders and reduced anti-lipid peroxidation ability occurred in the kidney tissue of db / db mice. Compared with the db / db+AAV9-NC group, the expression levels of Ferritin and GPX4 in the kidney tissue of db / db+AAV9-TGR5 ​​group mice were higher (P<0.05), indicating that TGR5 overexpression can significantly increase the expression of Ferritin and GPX4 in the kidney tissue of db / db mice, thereby improving iron metabolism and anti-lipid peroxidation ability. Compared with the db / db+Vehicle group, the expression levels of Ferritin and GPX4 in the kidney tissue of db / db+Ft1 and db / db+EMP groups were higher (all P<0.05), indicating that Ft1 and EMP intervention can significantly increase the expression of Ferritin and GPX4 in the kidney tissue of db / db mice, thereby improving iron metabolism and anti-lipid peroxidation ability.

[0121] Example 16 RT-PCR evaluation of the effect of TGR5 overexpression or Ft1 intervention on PTGS2 gene expression in mouse kidney tissue

[0122] During the occurrence of ferroptosis, the expression level of prostaglandin endoperoxide synthase 2 (PTGS2), a key rate-limiting enzyme in arachidonic acid metabolism, increased significantly, and it has become a key molecule related to the evaluation of ferroptosis. At week 8 after the corresponding intervention, the expression of PTGS2 in kidney tissue was detected by RT-PCR. The complete sequence of the gene was obtained from the NCBI database in the United States, and the Premier primers were designed and screened. The primers were purified by ULTRAPAGE method. The primer sequences are as follows:

[0123] PTGS2 upstream primer: CTGCGCCTTTTCAAGGATGG

[0124] PTGS2 downstream primer: GGGGATACACCTCTCCACCA

[0125] PCR reaction system: 2×Real PCR EasyTM Mix-SYBR (10 μL) + Forward Primer (10 μM, 0.8 μL) + Reverse Primer (10 μM, 0.8 μL) + Template (DNA) (2 μL) + ddH2O (6.4 μL);

[0126] PCR reaction procedure: pre-denaturation (at 95°C for 30 s) → denaturation (at 95°C for 5 s) → annealing (at 55°C for 30 s) → full extension and fluorescence collection (at 72°C for 30 s), with 45 cycles.

[0127] Using Thermo Scientific's QuantStudio TM Design & Analysis SE software was used to analyze the Threshold cycle (CT) value of each sample to be tested and calculate the mRNA expression level using the following formula:

[0128] △CT=CT target gene-CT internal reference

[0129] The fold difference of X mRNA expression was 2 -(△CT实验-△CT对照) Indicates that the result is Fig.37 Mean ± SD, n = 6, ****P < 0.0001.

[0130] Depend on Fig.37 It can be seen that compared with the WT group, the expression level of PTGS2 gene in the kidney tissue of db / db mice was higher (P<0.05), indicating that the expression of PTGS2 gene, a key molecule of ferroptosis, in the kidney tissue of db / db mice was significantly increased. Compared with the db / db+AAV9-NC group, the expression of PTGS2 gene in the kidney tissue of db / db+AAV9-TGR5 ​​group mice was lower (P<0.05), indicating that TGR5 overexpression can significantly reduce the expression of PTGS2 gene in the kidney tissue of db / db mice. Compared with the db / db+Vehicle group, the expression level of PTGS2 gene in the kidney tissue of db / db+Ft1 and db / db+EMP groups mice was lower (all P<0.05), indicating that both Ft1 and EMP intervention can significantly reduce the expression of PTGS2 gene in the kidney tissue of db / db mice.

[0131] Example 17 WB evaluation of the effects of TGR5 or Ft1 intervention on the expression of TGR5 and ferroptosis-related proteins in mouse kidney tissue

[0132] GPX4, SLC7A11 and Ferritin are all key molecules involved in ferroptosis. The role of SLC7A11 in ferroptosis is to regulate the level of intracellular oxidative stress, thereby affecting cell survival and death. When ferroptosis occurs, the expression of these proteins is reduced. At 8 weeks after the corresponding intervention, WB (Western blotting) evaluated the expression levels of TGR5 and ferroptosis-related proteins GPX4, SLC7A11 and Ferritin in kidney tissue. The WB detection results of TGR5, GPX4, SLC7A11 and Ferritin proteins are shown in the figure. Fig.38 Semi-quantitative analysis of the protein expression of TGR5, GPX4, SLC7A11 and Ferritin in kidney tissues showed that Fig.39 shown. Fig.39 Figures AD show the results of TGR5, GPX4, SLC7A11 and Ferritin, respectively, with Mean±SD, n=3, ****P<0.0001.

[0133] Depend on Fig.38 and Fig.39 It can be seen that compared with the WT group, the expression of TGR5, GPX4, SLC7A11 and Ferritin in the kidney tissue of db / db mice was lower (P<0.05), indicating that abnormal iron metabolism occurred in the kidney tissue of db / db mice, and the ability to resist lipid peroxidation and oxidative stress decreased. Compared with the db / db+AAV9-NC group, the expression levels of TGR5, GPX4, SLC7A11 and Ferritin in the kidney tissue of db / db+AAV9-TGR5 ​​group were higher (P<0.05), indicating that TGR5 overexpression can significantly improve the iron metabolism disorder in the kidney tissue of db / db mice, as well as the ability to resist lipid peroxidation and oxidative stress. Compared with the db / db+Vehicle group, the expression levels of TGR5, GPX4, SLC7A11 and Ferritin in the kidney tissue of mice in the db / db+Ft1 and db / db+EMP groups were higher (all P<0.05), indicating that Ft1 or EMP intervention can significantly improve the iron metabolism disorder in the kidney tissue of db / db mice, as well as the ability to resist lipid peroxidation and oxidative stress.

[0134] Example 18 TGR5 overexpression or notoginseng saponin Ft1 intervention can inhibit the JNK signaling pathway in the kidney tissue of diabetic mice

[0135] Both JNK and p-JNK proteins are key proteins in the JNK signaling pathway. Increased p-JNK expression and p-JNK / JNK ratio indicate that the JNK signaling pathway is activated, whereas decreased p-JNK / JNK ratio indicates that the JNK signaling pathway is inhibited. At week 8 after the corresponding intervention, the expression levels of JNK and p-JNK proteins related to the JNK signaling pathway in the kidney tissue of mice were detected by WB. The results of WB detection are shown in Figure 2. Fig.40 The expression levels of TGR5, JNK, and p-JNK are shown in Fig.41 As shown, the p-JNK / JNK ratio is Fig.42 Shown, Mean±SD, n=3, ****P<0.0001.

[0136] Depend on Figure 40-Figure 42It can be seen that compared with the WT group, the p-JNK expression and p-JNK / JNK ratio in the kidney tissue of the db / db group mice were increased (P<0.05), indicating that the JNK signaling pathway was activated in the kidney tissue of db / db mice. Compared with the db / db+AAV9-NC group, the p-JNK expression and p-JNK / JNK ratio in the kidney tissue of the db / db+AAV9-TGR5 ​​group mice were decreased, indicating that TGR5 overexpression can inhibit the activated JNK signaling pathway in diabetes. Compared with the db / db+Vehicle group, the p-JNK expression and p-JNK / JNK ratio in the kidney tissue of the db / db+Ft1 and db / db+EMP groups were decreased (all P<0.05), indicating that Ft1 or EMP intervention can effectively inhibit the activated JNK signaling pathway in diabetes.

[0137] In summary, TGR5 overexpression can improve kidney damage in diabetic mice and inhibit renal ferroptosis and activated JNK signaling pathway. Ft1 intervention can significantly increase the expression of TGR5 in the kidney tissue of diabetic mice, alleviate kidney damage in diabetic mice, and inhibit renal ferroptosis and activated JNK signaling pathway.

[0138] Although the specific implementation of the present invention is described in detail in conjunction with the drawings, it should not be understood as limiting the scope of protection of this patent. Within the scope described in the claims, various modifications and variations that can be made by those skilled in the art without creative work still fall within the scope of protection of this patent.

Claims

1. Application of Panax notoginseng saponin Ft1 in the preparation of ferroptosis inhibitors for renal tubular epithelial cells in diabetic nephropathy.

2. The use according to claim 1, characterized in that The diabetes is type 2 diabetes.

3. The use according to claim 1, characterized in that The notoginseng saponin Ft1 is used in the preparation of a drug for improving diabetic nephropathy caused by ferroptosis of renal tubular epithelial cells.

4. A drug for improving ferroptosis of renal tubular epithelial cells in diabetic nephropathy, characterized in that: It comprises the notoginseng saponin Ft1 described in claim 1 and a medically acceptable carrier.

Images